2024-04-25 14:27:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_205434 1964 bp mRNA linear VRT 19-SEP-2023 DEFINITION Gallus gallus homeobox D13 (HOXD13), mRNA. ACCESSION NM_205434 XM_429309 VERSION NM_205434.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1964) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1964) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1964) AUTHORS Bangs F, Welten M, Davey MG, Fisher M, Yin Y, Downie H, Paton B, Baldock R, Burt DW and Tickle C. TITLE Identification of genes downstream of the Shh signalling in the developing chick wing and syn-expressed with Hoxd13 using microarray and 3D computational analysis JOURNAL Mech Dev 127 (9-12), 428-441 (2010) PUBMED 20708683 REMARK GeneRIF: Hoxd13 and Sall1 are syn-expressed in the posterior region of early chick wing buds together with 6 novel genes which are likely to be functionally related and represent secondary targets of Shh signalling. REFERENCE 4 (bases 1 to 1964) AUTHORS Rogina B and Upholt WB. TITLE Cloning of full coding chicken cDNAs for the homeobox-containing gene Hoxd-13 JOURNAL Nucleic Acids Res 21 (5), 1316 (1993) PUBMED 8096637 REFERENCE 5 (bases 1 to 1964) AUTHORS Izpisua-Belmonte JC, Tickle C, Dolle P, Wolpert L and Duboule D. TITLE Expression of the homeobox Hox-4 genes and the specification of position in chick wing development JOURNAL Nature 350 (6319), 585-589 (1991) PUBMED 1673231 REFERENCE 6 (bases 1 to 1964) AUTHORS Nohno T, Noji S, Koyama E, Ohyama K, Myokai F, Kuroiwa A, Saito T and Taniguchi S. TITLE Involvement of the Chox-4 chicken homeobox genes in determination of anteroposterior axial polarity during limb development JOURNAL Cell 64 (6), 1197-1205 (1991) PUBMED 1672266 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from L09550.1. On Aug 30, 2004 this sequence version replaced XM_429309.1. ##Evidence-Data-START## Transcript exon combination :: L09550.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3109051, SAMN08016554 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1964 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="7" /map="7" /breed="Leghorn" gene 1..1964 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="homeobox D13" /db_xref="CGNC:7049" /db_xref="GeneID:396415" CDS 11..916 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="homeobox protein hoxd13; homeobox protein Hox-4G; homeobox protein Hox-4.8; Hox D13" /codon_start=1 /product="homeobox protein Hox-D13" /protein_id="NP_990765.1" /db_xref="CGNC:7049" /db_xref="GeneID:396415" /translation="
MDGLRGDSSGGGGGGGTPGQCRNFLSSPVFGAAHTGRAAAAAAAAASGFAYAGGGERSGAAARPDPPAKDCPGSGAPPAAPALGYGYHFGNGYYSCRMSNGVGIQQNALKSPPHASIGGFPVEKYMDVSSLTSTSVPANEVSTRAKEVSSYQGYTNPYQHVPGYIDMVSTFGSGEPRHETYISMEGYQSWTLANGWNGQVYCAKDQTQSSHFWKSSFPGDVALNQPEMCVYRRGRKKRVPYTKLQLKELENEYAINKFINKDKRRRISAATNLSERQVTIWFQNRRVKDKKIVSKLKDNVS"
misc_feature 11..70 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="propagated from UniProtKB/Swiss-Prot (P24344.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 68..442 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="Hox protein A13 N terminal; Region: HoxA13_N; pfam12284" /db_xref="CDD:432453" misc_feature 173..235 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="propagated from UniProtKB/Swiss-Prot (P24344.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(713..727,731..733,782..784,800..802,839..841, 845..850,857..862,866..874,878..883) /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 719..880 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(719..721,728..730,848..850,857..862,869..871) /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" polyA_site 1218 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="alternate" ORIGIN
gggctgggagatggacggactgcgcggcgacagcagcggcggcggcggcggcggcggcacccccgggcagtgccgtaactttctctcctcgcccgttttcggcgcggcgcacacgggccgcgcggccgccgccgccgccgccgccgcctcggggttcgcctacgccggcggaggggagcgctcgggggcggcggcgcggcccgaccccccggccaaggactgcccgggctccggcgcgccgcccgccgcccccgcgctcggctacgggtatcactttggcaacggatactatagctgcaggatgtccaacggggttgggatccagcagaacgccctgaagtctcccccccatgcctccattggcggctttcccgtggaaaagtacatggacgtctccagtctgaccagcacgagtgtccccgccaatgaagtctccaccagggctaaagaagtgtcctcctaccagggctatacaaacccctaccagcacgttcctgggtacatagacatggtctcaacgtttggctctggggaaccgagacacgaaacgtacatatccatggagggctatcagtcctggactctggctaatggctggaacggccaggtgtactgtgccaaagatcagacacagagctcgcacttctggaaatcgtcctttccaggggacgttgcactaaaccagcccgagatgtgcgtctaccggcgcgggaggaagaagagagtgccctacaccaagctccagcttaaggaactcgagaacgaatacgccattaacaagttcattaacaaggacaagaggcgaaggatatccgcggccacgaacctgtccgaacgccaggtcaccatttggtttcagaacaggagggtgaaggataagaaaatagtctccaaactgaaagacaacgtttcttgatcgattccttgcggacagtggcggatatacaacctccgtttacgaccagctgcggacttttggaaagacttgaaaatatatttaatattttttttctcttctccttccagcggtggcgaagtttcgtgaattgttttctattcccgtgaaagccggcgttgttctctcggtggaagggagcgccgacaagccgtgactttagcgttgtttcttccttcctttttttaaaaaaaaataatattaatattaattatattttctatccttccctctaggccagtataaacgaatttaaacgtgtcgaacggttccatttataactttcttaaatgcttatctctttggggaggggacccggggtttttatctccgaacgtcggccggtgcccgaaagtgtcggactcgatttggtgtattggtcggaaaacgcgagtgagcgcgttcccgcagtcactgccggcaaaagccgcattgccggagtccgcacggggctccgcggatgtcggaagcagcggctccggaagggaattgtttgcactgcagtgggatcgctctttttattctttatgatttgattttgctggcgggcaatctgctaccggcttttcctggggtacggagcgcggcctcggctcctctcgttggatccgaaggggcagcgatgctccccgcagcagcgcccgggggtccctccggccgccccgtcccatcccgtcccgtcccgtcccgtcccgtcccgaggtgcgcacgtacctccgtgcggaccccgcgtgcgcataacgcacttcccggtcggagaagtgaagttcaccgctaactttcagtttgcaaaactaaacgggtgttaatgacagaagcaataaatgattcgtttcaaaagatgccataatttatgtaggccgaaaggctgggactcggttgggtttttgtaattttaaacctagcgtgcatgttatgctatacgcagggaggtcagctcctgggaaagagaagcgatgtcctccctgttcatgtgcctcgtgtaattattaaatggtgtgtgtttcga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]