GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 06:10:04, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_199286               1100 bp    mRNA    linear   PRI 25-JUL-2020
DEFINITION  Homo sapiens developmental pluripotency associated 3 (DPPA3), mRNA.
ACCESSION   NM_199286 XM_290555
VERSION     NM_199286.4
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1100)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   2  (bases 1 to 1100)
  AUTHORS   Du W, Dong Q, Zhang Z, Liu B, Zhou T, Xu RM, Wang H, Zhu B and Li
            Y.
  TITLE     Stella protein facilitates DNA demethylation by disrupting the
            chromatin association of the RING finger-type E3 ubiquitin ligase
            UHRF1
  JOURNAL   J. Biol. Chem. 294 (22), 8907-8917 (2019)
   PUBMED   31018966
  REMARK    GeneRIF: Stella employs a multilayered mechanism to achieve robust
            UHRF1 inhibition, which involves the dissociation from chromatin
            and cytoplasmic sequestration of UHRF1.
REFERENCE   3  (bases 1 to 1100)
  AUTHORS   Farshchian M, Matin MM, Bahrami M, Geerts D, Dastpak M, Shahriyari
            M, Tajeran M, Mirahmadi M and Bahrami AR.
  TITLE     Pluripotency induction in HEK293T cells by concurrent expression of
            STELLA, OCT4 and NANOS2
  JOURNAL   Biochem. Biophys. Res. Commun. 480 (4), 635-640 (2016)
   PUBMED   27794480
  REMARK    GeneRIF: We conclude that heterogeneous population of the HEK293T
            cells might be easily shifted towards expression of the
            pluripotency markers by ectopic expression of the SON factors or by
            growth in serum depleted media.
REFERENCE   4  (bases 1 to 1100)
  AUTHORS   Blinka S, Reimer MH Jr, Pulakanti K and Rao S.
  TITLE     Super-Enhancers at the Nanog Locus Differentially Regulate
            Neighboring Pluripotency-Associated Genes
  JOURNAL   Cell Rep 17 (1), 19-28 (2016)
   PUBMED   27681417
  REMARK    GeneRIF: Super-enhancers at the Nanog locus differentially regulate
            neighboring pluripotency-associated genes, in particular, DPPA3.
REFERENCE   5  (bases 1 to 1100)
  AUTHORS   Funaki S, Nakamura T, Nakatani T, Umehara H, Nakashima H, Okumura
            M, Oboki K, Matsumoto K, Saito H and Nakano T.
  TITLE     Global DNA hypomethylation coupled to cellular transformation and
            metastatic ability
  JOURNAL   FEBS Lett. 589 (24 Pt B), 4053-4060 (2015)
   PUBMED   26608031
  REMARK    GeneRIF: Data suggest enforced expression of Stella into normal
            cells induces not only global DNA demethylation but also neoplastic
            transformation and increases metastatic ability; these changes
            involve altered regulation of neoplastic gene expression.
REFERENCE   6  (bases 1 to 1100)
  AUTHORS   Bortvin A, Goodheart M, Liao M and Page DC.
  TITLE     Dppa3 / Pgc7 / stella is a maternal factor and is not required for
            germ cell specification in mice
  JOURNAL   BMC Dev. Biol. 4, 2 (2004)
   PUBMED   15018652
  REMARK    GeneRIF: In mice, knockout experiments show this gene may be a
            maternal factor in cleavage stage embryogenesis.
            Publication Status: Online-Only
REFERENCE   7  (bases 1 to 1100)
  AUTHORS   Clark AT, Rodriguez RT, Bodnar MS, Abeyta MJ, Cedars MI, Turek PJ,
            Firpo MT and Reijo Pera RA.
  TITLE     Human STELLAR, NANOG, and GDF3 genes are expressed in pluripotent
            cells and map to chromosome 12p13, a hotspot for teratocarcinoma
  JOURNAL   Stem Cells 22 (2), 169-179 (2004)
   PUBMED   14990856
REFERENCE   8  (bases 1 to 1100)
  AUTHORS   Payer B, Saitou M, Barton SC, Thresher R, Dixon JP, Zahn D,
            Colledge WH, Carlton MB, Nakano T and Surani MA.
  TITLE     Stella is a maternal effect gene required for normal early
            development in mice
  JOURNAL   Curr. Biol. 13 (23), 2110-2117 (2003)
   PUBMED   14654002
  REMARK    GeneRIF: In mice, a targeted mutation results in reduced female
            fertility and may function as a mammalian maternal effect gene.
REFERENCE   9  (bases 1 to 1100)
  AUTHORS   Bowles J, Teasdale RP, James K and Koopman P.
  TITLE     Dppa3 is a marker of pluripotency and has a human homologue that is
            expressed in germ cell tumours
  JOURNAL   Cytogenet. Genome Res. 101 (3-4), 261-265 (2003)
   PUBMED   14684992
REFERENCE   10 (bases 1 to 1100)
  AUTHORS   Sato M, Kimura T, Kurokawa K, Fujita Y, Abe K, Masuhara M, Yasunaga
            T, Ryo A, Yamamoto M and Nakano T.
  TITLE     Identification of PGC7, a new gene expressed specifically in
            preimplantation embryos and germ cells
  JOURNAL   Mech. Dev. 113 (1), 91-94 (2002)
   PUBMED   11900980
  REMARK    GeneRIF: In mice, this gene may play a role in oogenesis and
            primordial germ cell development.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC006517.46 and AY317075.1.
            On Nov 23, 2018 this sequence version replaced NM_199286.3.
            
            Summary: This gene encodes a protein that in mice may function as a
            maternal factor during the preimplantation stage of development. In
            mice, this gene may play a role in transcriptional repression, cell
            division, and maintenance of cell pluripotentiality. In humans,
            related intronless loci are located on chromosomes 14 and X.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY317075.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2142363
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000345088.3/ ENSP00000339250.2
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-21                AC006517.46        154274-154294       c
            22-645              AY317075.1         1-624
            646-646             AC006517.46        148622-148622       c
            647-1100            AY317075.1         626-1079
FEATURES             Location/Qualifiers
     source          1..1100
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.31"
     gene            1..1100
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /note="developmental pluripotency associated 3"
                     /db_xref="GeneID:359787"
                     /db_xref="HGNC:HGNC:19199"
                     /db_xref="MIM:608408"
     exon            1..220
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746807997"
     variation       13
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453754678"
     variation       16
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923271006"
     variation       19..20
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1190288609"
     variation       19
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761685271"
     variation       29
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953525319"
     variation       30
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195162921"
     variation       32
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985360677"
     variation       33..36
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1254381790"
     variation       35..36
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1210206866"
     variation       48
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182659505"
     variation       49
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300378463"
     variation       52
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364992775"
     variation       55
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009023134"
     variation       56
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017399226"
     variation       57
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911174603"
     variation       66..68
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1433495532"
     variation       67
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964548692"
     variation       73
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447568835"
     variation       90
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171068404"
     variation       91
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757389493"
     variation       93
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415226476"
     variation       94
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778942940"
     variation       95
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758379254"
     variation       96
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398188813"
     variation       100
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745846830"
     variation       103
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309808777"
     variation       106
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772079804"
     variation       107
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946531509"
     variation       108
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370059392"
     variation       112
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369510829"
     variation       115
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923781148"
     variation       116
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205167247"
     variation       117
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776411466"
     misc_feature    118..120
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /note="upstream in-frame stop codon"
     variation       121
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456886891"
     variation       123
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565453902"
     variation       124..128
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tgt"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:759767569"
     variation       129
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1210277654"
     variation       131
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592080093"
     variation       134
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935067596"
     variation       137
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761544146"
     variation       138
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056634870"
     CDS             139..618
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /note="stella-related protein"
                     /codon_start=1
                     /product="developmental pluripotency-associated protein 3"
                     /protein_id="NP_954980.1"
                     /db_xref="CCDS:CCDS8582.1"
                     /db_xref="GeneID:359787"
                     /db_xref="HGNC:HGNC:19199"
                     /db_xref="MIM:608408"
                     /translation="
MDPSQFNPTYIPGSPQMLTEENSRDDSGASQISSETLIKNLSNLTINASSESVSPLSEALLRRESVGAAVLREIEDEWLYSRRGVRTLLSVQREKMARLRYMLLGGVRTHERRPTNKEPKGVKKESRPFKCPCSFCVSNGWDPSENARIGNQDTKPLQP"
     misc_feature    139..576
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /note="PGC7/Stella/Dppa3 domain; Region: PGC7_Stella;
                     pfam15549"
                     /db_xref="CDD:292186"
     variation       140
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769473757"
     variation       142
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772814233"
     variation       144
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762510958"
     variation       149..152
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:753132119"
     variation       150
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178785748"
     variation       152
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421583322"
     variation       159
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768088723"
     variation       162
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896135895"
     variation       163
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753082207"
     variation       166
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761171303"
     variation       169
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764357366"
     variation       170
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011897598"
     variation       171
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61753205"
     variation       172
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151225281"
     variation       173
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765403550"
     variation       177
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750526957"
     variation       178
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224978450"
     variation       179
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341905156"
     variation       182..194
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="cac"
                     /replace="cacaaatgctcac"
                     /db_xref="dbSNP:761379312"
     variation       183
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310052458"
     variation       184..185
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:764713061"
     variation       189
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141485606"
     variation       190
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252531059"
     variation       193
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350634983"
     variation       195
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780044057"
     variation       199
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1015063710"
     variation       200
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309292967"
     variation       204
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1208565256"
     variation       205
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746914036"
     variation       206
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201819455"
     variation       208
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747839745"
     variation       214
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769596879"
     variation       215
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772947924"
     variation       219
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:915992389"
     exon            221..465
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /inference="alignment:Splign:2.1.0"
     variation       222
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772855721"
     variation       223
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384240409"
     variation       225
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592081604"
     variation       231
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200489855"
     variation       234..240
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ctcc"
                     /replace="ctcctcc"
                     /db_xref="dbSNP:776230873"
     variation       234
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765579960"
     variation       235
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748053839"
     variation       236
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958449068"
     variation       239
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773479310"
     variation       240
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147622937"
     variation       245
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482329730"
     variation       246
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766520317"
     variation       249
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907109131"
     variation       255
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405894178"
     variation       259..269
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="cttagtaactt"
                     /replace="cttagtaacttagtaactt"
                     /db_xref="dbSNP:1243789802"
     variation       259
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402301968"
     variation       262
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372874876"
     variation       263
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003560166"
     variation       264
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759608098"
     variation       274
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379460934"
     variation       275
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767572862"
     variation       278
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160870878"
     variation       279
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361652678"
     variation       280
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752611710"
     variation       283
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756083363"
     variation       284
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777692242"
     variation       285
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753572092"
     variation       289
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2024320"
     variation       292
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778579886"
     variation       293
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745385909"
     variation       294..296
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1565454838"
     variation       295
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200485546"
     variation       299
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189470689"
     variation       303
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773416967"
     variation       304
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141958540"
     variation       306
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771075777"
     variation       307
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774572384"
     variation       308
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868633668"
     variation       309
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759689613"
     variation       311
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344674574"
     variation       313
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767695227"
     variation       314
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752734036"
     variation       321
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760662809"
     variation       322
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753598013"
     variation       323
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757020246"
     variation       325
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778436625"
     variation       326..330
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1415152446"
     variation       328
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201681638"
     variation       329
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757960183"
     variation       331..333
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:781194347"
     variation       331
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430798017"
     variation       332
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565454886"
     variation       333..335
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="tgt"
                     /db_xref="dbSNP:765107200"
     variation       333
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:770060744"
     variation       336
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:899879366"
     variation       338
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188717764"
     variation       339
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996942396"
     variation       346
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329939142"
     variation       348
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748693604"
     variation       353..355
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1214600808"
     variation       353
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370250392"
     variation       354
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778289810"
     variation       355
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375466437"
     variation       359
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:972861232"
     variation       360
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774501247"
     variation       361
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138428433"
     variation       364
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775292053"
     variation       367
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775747053"
     variation       379
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760791872"
     variation       381
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308070806"
     variation       382
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763952337"
     variation       384..388
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="gagag"
                     /replace="gagagag"
                     /db_xref="dbSNP:1244782107"
     variation       386..392
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="gaggagt"
                     /db_xref="dbSNP:1487999614"
     variation       387
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776567517"
     variation       388
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241336037"
     variation       389
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565454912"
     variation       391
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270536573"
     variation       392
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359567488"
     variation       392
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1484731724"
     variation       393
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1476624233"
     variation       399
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746059802"
     variation       405
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761582573"
     variation       410
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1411074666"
     variation       411
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753558650"
     variation       413
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750091662"
     variation       415
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408394617"
     variation       416
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192627361"
     variation       422
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764232682"
     variation       423
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:777980798"
     variation       423
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425053808"
     variation       427
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758015220"
     variation       428
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304106948"
     variation       432
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765976630"
     variation       433
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398376094"
     variation       437
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751087453"
     variation       440
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754423298"
     variation       441
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778144205"
     variation       442
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749795424"
     variation       450..455
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="cgg"
                     /replace="cggcgg"
                     /db_xref="dbSNP:749564515"
     variation       450
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377017895"
     variation       451
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461440543"
     variation       452
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779308718"
     variation       453
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746199036"
     variation       454
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772450929"
     variation       455
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775798049"
     variation       460
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476085353"
     variation       461
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201295949"
     variation       464
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539126010"
     variation       465
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770300091"
     exon            466..507
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /inference="alignment:Splign:2.1.0"
     variation       467
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374414555"
     variation       468
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939387612"
     variation       469
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770705059"
     variation       471..477
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:762322563"
     variation       477
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774045171"
     variation       483..485
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1261977056"
     variation       486
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759197527"
     variation       488
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1186746478"
     variation       491
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767040190"
     variation       499
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245460533"
     variation       507
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553079854"
     exon            508..1100
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /inference="alignment:Splign:2.1.0"
     variation       514
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302285824"
     variation       516
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367743953"
     variation       518
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406392754"
     variation       521..526
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ca"
                     /replace="cattca"
                     /db_xref="dbSNP:1417741781"
     variation       521
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760300436"
     variation       530
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325296375"
     variation       532
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227348930"
     variation       537
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1252364765"
     variation       538
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148824844"
     variation       540
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751017919"
     variation       542
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565455276"
     variation       546
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763520543"
     variation       547
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571145972"
     variation       557
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751975318"
     variation       559
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201591750"
     variation       561
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215934615"
     variation       563
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781477315"
     variation       566..570
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1266184704"
     variation       567
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193833467"
     variation       573
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374775709"
     variation       577
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565455290"
     variation       578
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752855109"
     variation       588
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756241587"
     variation       590
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012564150"
     variation       591
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777805500"
     variation       592
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749328525"
     variation       593
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770880705"
     variation       595
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426179467"
     variation       598
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778767361"
     variation       599
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383658690"
     variation       600
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745684454"
     variation       604
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775271861"
     variation       606
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367248153"
     variation       610
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328772507"
     variation       611
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143467337"
     variation       613..614
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:769175476"
     variation       613
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768323428"
     variation       621
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293717407"
     variation       624
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776309829"
     variation       625..629
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1320514241"
     variation       625
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866774862"
     variation       626
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211457619"
     variation       627
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259130582"
     variation       631
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368642966"
     variation       633
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767002542"
     variation       635
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774650399"
     variation       642
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442772420"
     variation       646
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11055388"
     variation       649
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385640303"
     variation       651
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446189321"
     variation       652
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767759523"
     variation       653
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753011196"
     variation       658
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232856367"
     variation       659
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479956616"
     variation       662
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565455318"
     variation       663..664
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:777066234"
     variation       665
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453992279"
     variation       671
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:762529956"
     variation       677
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429826621"
     variation       680
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759550763"
     variation       682..684
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1268310582"
     variation       684
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889450230"
     variation       691
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139963560"
     variation       692
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273826012"
     variation       694
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043400905"
     variation       698
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483569706"
     variation       701
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902739382"
     variation       705
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592082484"
     variation       726
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999745809"
     variation       730
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747990311"
     variation       731
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035128154"
     variation       732
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311369895"
     variation       735..739
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tt"
                     /replace="ttttt"
                     /db_xref="dbSNP:975427631"
     variation       747
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230836602"
     variation       752
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592082497"
     variation       762
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200786984"
     variation       768
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192874132"
     variation       773
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914655494"
     variation       778
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968749394"
     variation       789
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474028156"
     variation       793
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355435083"
     variation       798
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168838614"
     variation       799
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924807156"
     variation       801
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938828901"
     variation       809
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762830375"
     variation       811..818
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="ta"
                     /replace="taacttta"
                     /db_xref="dbSNP:1423856642"
     variation       812
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916150166"
     variation       832
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773639169"
     variation       835
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055423"
     variation       847
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252194451"
     variation       854
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055425"
     variation       855
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985158873"
     variation       858
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388970111"
     variation       862
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:993175072"
     variation       867
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014936053"
     variation       870
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311243249"
     variation       892..905
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="cagtgagatgaaac"
                     /replace="cagtgagatgaaacagtgagatgaaac"
                     /db_xref="dbSNP:554667088"
     variation       899
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374525198"
     variation       909
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:961258569"
     variation       911
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890326911"
     variation       913
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307003504"
     variation       916
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796947611"
     variation       920..921
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1448581174"
     variation       920
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008716155"
     variation       929
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369653343"
     variation       932
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:972666610"
     variation       937
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922415258"
     variation       938
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207237917"
     variation       940
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933845839"
     variation       943..945
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:200516222"
     variation       953..954
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1184162292"
     variation       956
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964631129"
     variation       963
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985223727"
     variation       967..970
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tata"
                     /replace="tatata"
                     /db_xref="dbSNP:1251388055"
     variation       968
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997255664"
     variation       979
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270131429"
     variation       994
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592082571"
     variation       1001
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:796123395"
     variation       1007
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021592305"
     variation       1017
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910923426"
     variation       1018
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592082576"
     variation       1023..1025
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1351615030"
     variation       1024..1028
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1204791326"
     variation       1025
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330509699"
     variation       1026
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574473896"
     variation       1033
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533764585"
     variation       1036
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043757192"
     variation       1046
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902206549"
     variation       1048
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386924224"
     variation       1057
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776799035"
     variation       1058..1063
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="tata"
                     /replace="tatata"
                     /db_xref="dbSNP:992981043"
     variation       1058
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553389025"
     variation       1061
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056671689"
     variation       1062
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456967436"
     variation       1068
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257487757"
     variation       1069..1073
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:1161220051"
     variation       1080
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896652809"
     variation       1088
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749655337"
     variation       1090
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1183659363"
     variation       1095
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1012870785"
     variation       1096..1100
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1435189516"
     variation       1099
                     /gene="DPPA3"
                     /gene_synonym="Pgc7; STELLA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265530244"
ORIGIN      
gtcagttctttgaccattcgttggagctccggttttcagcctctttccgggctacctggtagcaatttgaggctctgtcatcagtttctgctacgtttcaaagatcctggagaagcctagtgttgtgtcaagacgccgatggacccatcacagtttaatccaacctacatcccagggtctccacaaatgctcaccgaagaaaattcccgggacgattcaggggcctctcaaatctcctccgagacgttgataaagaaccttagtaacttgactatcaacgctagtagcgaatctgtttcccctctatcggaagctttactccgtcgagagtctgtaggagcagcagtcctcagggaaatcgaagatgagtggctttacagcaggagaggagtaagaacattgctgtctgtgcagagagaaaagatggcaagattgagatacatgttactcggcggagttcgtacgcatgaaagaagaccaacaaacaaggagcctaagggagttaagaaggaatcaagaccattcaaatgtccctgcagtttctgcgtgtctaatggatgggatccttctgagaatgctagaatagggaatcaagacaccaagccacttcagccataaatcttattcttgcacctttttttcttggtagtaattttatatagcaggttgagaaagctactctatgctagtatagactatacaccaataattttgataatgagttctaggatgtatttttcttgtatctttttcttcctactatgatactagtaattcataagggatctgtgtaatctgaatgtatttgaataactttagctctactgtttgatttgacccaaagaagccaagatgatataagtattcccatgtgtcttagaagcccaaagtcagtgagatgaaacccaacatcaagaaattgaagcaaagttacttatggataaagaaagcattaggtagttgggctatagcataattagattttctggctttcaaaaatttggattgcaatcacagcaaactttgttatttttacagttttcagtacaaaagtgtttatatagaaacaataaagttgacatttgagtaccttttaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]