LOCUS       NM_177931               2560 bp    mRNA    linear   ROD 20-JUN-2021
DEFINITION  Rattus norvegicus origin recognition complex, subunit 1 (Orc1),
            mRNA.
ACCESSION   NM_177931
VERSION     NM_177931.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2560)
  AUTHORS   Grolimund L, Aeby E, Hamelin R, Armand F, Chiappe D, Moniatte M and
            Lingner J.
  TITLE     A quantitative telomeric chromatin isolation protocol identifies
            different telomeric states
  JOURNAL   Nat Commun 4, 2848 (2013)
   PUBMED   24270157
REFERENCE   2  (bases 1 to 2560)
  AUTHORS   Patel DJ and Wang Z.
  TITLE     Readout of epigenetic modifications
  JOURNAL   Annu Rev Biochem 82, 81-118 (2013)
   PUBMED   23642229
  REMARK    Review article
REFERENCE   3  (bases 1 to 2560)
  AUTHORS   Bartke T, Vermeulen M, Xhemalce B, Robson SC, Mann M and Kouzarides
            T.
  TITLE     Nucleosome-interacting proteins regulated by DNA and histone
            methylation
  JOURNAL   Cell 143 (3), 470-484 (2010)
   PUBMED   21029866
REFERENCE   4  (bases 1 to 2560)
  AUTHORS   Shen Z, Sathyan KM, Geng Y, Zheng R, Chakraborty A, Freeman B, Wang
            F, Prasanth KV and Prasanth SG.
  TITLE     A WD-repeat protein stabilizes ORC binding to chromatin
  JOURNAL   Mol Cell 40 (1), 99-111 (2010)
   PUBMED   20932478
REFERENCE   5  (bases 1 to 2560)
  AUTHORS   Shu MQ, Qin YL and Jiang MH.
  TITLE     RNA interference targeting ORC1 gene suppresses the proliferation
            of vascular smooth muscle cells in rats
  JOURNAL   Exp Mol Pathol 84 (3), 206-212 (2008)
   PUBMED   18499104
  REMARK    GeneRIF: ORC1 gene silencing causes rat VSMCs to enter a reversible
            G(0) quiescent, growth arrested state; thus, ORC1 gene may be an
            important new target for suppressing VSMCs proliferation.
REFERENCE   6  (bases 1 to 2560)
  AUTHORS   Siddiqui K and Stillman B.
  TITLE     ATP-dependent assembly of the human origin recognition complex
  JOURNAL   J Biol Chem 282 (44), 32370-32383 (2007)
   PUBMED   17716973
REFERENCE   7  (bases 1 to 2560)
  AUTHORS   Minami H, Takahashi J, Suto A, Saitoh Y and Tsutsumi K.
  TITLE     Binding of AlF-C, an Orc1-binding transcriptional regulator,
            enhances replicator activity of the rat aldolase B origin
  JOURNAL   Mol Cell Biol 26 (23), 8770-8780 (2006)
   PUBMED   16982680
REFERENCE   8  (bases 1 to 2560)
  AUTHORS   Miyake Y, Mizuno T, Yanagi K and Hanaoka F.
  TITLE     Novel splicing variant of mouse Orc1 is deficient in nuclear
            translocation and resistant for proteasome-mediated degradation
  JOURNAL   J Biol Chem 280 (13), 12643-12652 (2005)
   PUBMED   15634681
REFERENCE   9  (bases 1 to 2560)
  AUTHORS   Natale DA, Li CJ, Sun WH and DePamphilis ML.
  TITLE     Selective instability of Orc1 protein accounts for the absence of
            functional origin recognition complexes during the M-G(1)
            transition in mammals
  JOURNAL   EMBO J 19 (11), 2728-2738 (2000)
   PUBMED   10835370
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB105378.1.
            On Jun 3, 2003 this sequence version replaced NM_177931.1.
            
            Summary: mouse homolog is an origin recognition complex that may be
            involved in initiation of DNA replication [RGD, Feb 2006].
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB105378.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132296, SAMD00132297
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2560
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5q34"
     gene            1..2560
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="origin recognition complex, subunit 1"
                     /db_xref="GeneID:313479"
                     /db_xref="RGD:631435"
     CDS             1..2547
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /codon_start=1
                     /product="origin recognition complex subunit 1"
                     /protein_id="NP_808792.1"
                     /db_xref="GeneID:313479"
                     /db_xref="RGD:631435"
                     /translation="

MPSYVTRQKTRQTFSWVGRPLPNRKQFYQMYKEICMKINGCSEIHIKVGQFVLIQGEDNQKPYVAKLIELFENGSEVPPKKYARVQWFVRFCEIPIPKRHLLGRRPSAQEIFWYDCSDCDNDIHVETIIGPVQVVALAPEDEIPVNQKSEETLFVKLSWNKKNFAPLPPEELAALRRLECQKPLEAKTKSVKSPSWSTAEQEVKRIESSHSTSRSYQDPAHTVTPNAMKSLECGGFTRKPNMRLSRKILCDSLDSQKTCKRRAAFSETTSPPKKPQPGEIKTSSALETLGKNGHTQPFFAKSSMVLRTRGTAVKTTKLTVESALSPVRSRSRYSVAPSVGLTPQYIGRKAKEQETHKEPIHTSLRARRRSSLLTLKRIKQQLWLLDDDKSDQEEEESISSVEVSDSSSEEEDESVPSPPTGKPVGQSRTRRTASKPSSQTPSKSPKKTFRPRPPLHATPQIRDRNLAVQEPASVLEEARLRLHVSAVPDSLPCREQEFQDIYSFVESKLLDGTGGCMYISGVPGTGKTATVHEVIRCLQQAAQTNDVPPFEYVEVNGMKLTEPHQVYVQILQKLTGQKATANHAAELLAKQFCSRGSQKETTVLLVDELDLLWTHKQDVLYNLFDWPTHKGARLVVLTIANTMDLPERIMMNRVASRLGLTRMSFQPYSHSQLKQILVSRLKHLKAFEDDAVQLVARKVAALSGDARRCLDICRRATEICEVSHQRGDSQCLVTVAHLMEAIDEMFSSSYITAIKNSSVLEQSFLRAIIAEFRRSGLEEATFQQIYSQHVALCRMEGLPYPTMSETMAVCSRLGSCRILLVEPSRNDLLLRVRLNVSQNDVLYALKEE"

     misc_feature    127..507
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="BAH, or Bromo Adjacent Homology domain, as present
                     in animal homologs of Saccharomyces cerevisiae Orc1p. Orc1
                     is part of the Yeast Sir1-origin recognition complex. The
                     Orc1p BAH doman functions in epigenetic silencing. In
                     vertebrates, a similar ORC...; Region: BAH_Orc1p_animal;
                     cd04719"
                     /db_xref="CDD:240070"
     misc_feature    277..279
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Histone H4K20me2 binding.
                     /evidence=ECO:0000250|UniProtKB:Q9Z1N2; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); other site"
     misc_feature    565..681
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80Z32.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    577..579
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    754..756
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z1N2; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    781..840
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80Z32.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    808..810
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    850..852
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    940..942
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); acetylation site"
     misc_feature    973..975
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z1N2; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    1030..1095
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80Z32.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1162..1398
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80Z32.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1210..1212
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    1219..1221
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13415; propagated from
                     UniProtKB/Swiss-Prot (Q80Z32.1); phosphorylation site"
     misc_feature    1444..2442
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="orc1/cdc6 family replication initiation protein;
                     Region: TIGR02928"
                     /db_xref="CDD:274354"
     misc_feature    1462..2544
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80Z32.1);
                     Region: Necessary and sufficient for ORC complex assembly.
                     /evidence=ECO:0000250"
     misc_feature    1471..>1623
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="AAA ATPase domain; Region: AAA_16; pfam13191"
                     /db_xref="CDD:289934"
     misc_feature    1549..1986
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl21455"
                     /db_xref="CDD:304359"
     misc_feature    1561..1584
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="Walker A motif; other site"
                     /db_xref="CDD:99707"
     misc_feature    order(1564..1587,1927..1929)
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:99707"
     misc_feature    1969..1971
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="arginine finger; other site"
                     /db_xref="CDD:99707"
     misc_feature    2293..2514
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="CDC6, C terminal; Region: Cdc6_C; pfam09079"
                     /db_xref="CDD:286205"
     misc_feature    order(2347..2349,2410..2415,2467..2469,2473..2475,
                     2485..2493)
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:176573"
     exon            1..95
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            96..220
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            221..399
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            400..703
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            704..1043
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1044..1148
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1149..1344
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1345..1442
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1443..1544
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1545..1716
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1717..1824
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1825..1974
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            1975..2094
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            2095..2264
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            2265..2352
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
     exon            2353..2560
                     /gene="Orc1"
                     /gene_synonym="Orc1l"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgccgtcctatgtcacaaggcagaagaccagacaaactttctcatgggttggcaggccattgccgaatcgaaaacagttctaccaaatgtacaaagaaatttgtatgaaaatcaatggttgttctgagattcacatcaaggttggacagtttgtattgattcaaggggaagataatcaaaagccctatgttgctaaactgattgaattatttgaaaatgggtctgaagttcctcccaagaaatatgcgcgagtacaatggtttgtccgattctgtgagattcctatccctaaaaggcatttgttaggacggagaccttctgcacaggagatattctggtatgactgttctgactgtgataacgacattcatgtggagaccatcattggccctgttcaggtagtggcattagccccagaagacgagatccctgtgaatcagaaaagtgaggagacactgtttgtgaagctgtcctggaataaaaagaactttgcgccactgccaccagaagaacttgcagcattgaggagactggagtgccaaaaacctttagaagccaagactaagagtgttaaaagcccttcctggagcacagcagaacaagaggtcaaaaggattgaatcaagtcattccacttccagatcttaccaggatcctgctcatactgtcactcccaacgcaatgaagtctctggaatgtggtggttttaccaggaagcctaacatgaggctgtcacggaagatcttgtgtgattccttggattctcaaaaaacatgtaaacgaagagcagccttctctgagaccacctcaccacctaaaaagcctcaacctggtgaaatcaagacctcctcagctttggaaactctaggaaaaaatgggcatactcaacccttttttgccaaaagtagcatggttctgagaacccggggcacagctgtgaagaccacaaagcttactgtggagagtgcacttagccctgtcaggagcaggtcgaggtactcagtggcaccctctgtgggtctgacacctcaatacattgggaggaaggcaaaagaacaagaaactcacaaagaacccatccatacttctcttcgtgcccgtagaaggagttctctcttgactttgaagcggattaagcaacagctttggcttctagatgatgataaaagtgaccaagaagaggaagagtccatatcctctgtggaagtgtcagactccagtagtgaggaggaagatgagtctgttccctcccctccaacaggaaaacccgtggggcagtccaggacccggagaactgcctctaagccatcatcacagaccccctccaagtcaccaaagaaaacttttagacctagaccacctcttcatgctactcctcagatccgagacagaaacttggctgtccaagagccagctagtgtgcttgaagaggcccggctcaggctgcatgtttctgccgtgcctgactctcttccctgtcgagagcaggagttccaagacatctacagctttgtggaaagtaaacttcttgatggaaccggagggtgtatgtacatttctggggtccctgggacagggaagacagccactgtgcatgaagtcatacgctgtctgcagcaggcagcacaaacaaatgatgttcctccctttgaatacgttgaggttaatgggatgaagctgacagaaccccaccaggtctatgtgcagattttacagaaactgacaggccagaaggcaacagctaatcatgcagcagaactgctggcaaagcaattctgcagccgagggtcccagaaggaaaccactgtgctgcttgtggatgagcttgaccttctttggactcacaaacaagatgtgttgtacaacctctttgattggcctactcacaaaggagcccggttggtcgtgttgactattgccaataccatggaccttccagagaggatcatgatgaaccgtgtggctagccgcctgggcctcaccaggatgtctttccaaccctactctcacagccaactgaaacaaatcttagtgtcccgactgaagcatttaaaggcctttgaggatgatgccgtccagttggtagccagaaaggtagcagccctttctggagatgcccggcgctgcctggacatctgcaggcgtgccacagagatctgcgaggtttcccatcagcgtggtgactctcagtgcctggtgactgtggcccacttaatggaagctatagatgaaatgttttcctcatcctatattactgccatcaaaaactcttctgtcctggaacagagcttcctgagagccatcattgcggaattccgtcgatcaggactggaggaagctacatttcaacagatatacagtcagcatgtggctctgtgcagaatggagggactgccttacccaaccatgtcagagaccatggccgtgtgctcgcgtctgggttcttgccgcattcttctggtggagcctagcaggaatgacctactccttcgagtgagactcaatgttagccagaatgatgtgctgtatgctctcaaagaagagtgaaggacttaacaaa

//