LOCUS       NM_153821               1377 bp    mRNA    linear   ROD 28-MAR-2024
DEFINITION  Rattus norvegicus paired related homeobox 1 (Prrx1), mRNA.
ACCESSION   NM_153821
VERSION     NM_153821.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1377)
  AUTHORS   Yin,L., Liu,M.X., Wang,F.Y., Wang,X., Tang,Y.H., Zhao,Q.Y.,
            Wang,T., Chen,Y.T. and Huang,C.X.
  TITLE     Transcription Factor prrx1 Promotes Brown Adipose-Derived Stem
            Cells Differentiation to Sinus Node-Like Cells
  JOURNAL   DNA Cell Biol 38 (11), 1313-1322 (2019)
   PUBMED   31545082
  REMARK    GeneRIF: Overexpression of prrx1 can successfully induce sinus
            node-like cells.
REFERENCE   2  (bases 1 to 1377)
  AUTHORS   Gong,J., Han,J., He,J., Liu,J., Han,P., Wang,Y., Li,M., Li,D.,
            Ding,X., Du,Z., Liao,J. and Tian,D.
  TITLE     Paired related homeobox protein 1 regulates PDGF-induced chemotaxis
            of hepatic stellate cells in liver fibrosis
  JOURNAL   Lab Invest 97 (9), 1020-1032 (2017)
   PUBMED   28737764
  REMARK    GeneRIF: Studied and identified Prrx1 as a novel valuable target in
            liver fibrosis. Prxx1 was found to have a major role in
            PDGF-induced migration and chemotaxis.
REFERENCE   3  (bases 1 to 1377)
  AUTHORS   Takahashi,T., Zimmer,J., Friedmacher,F. and Puri,P.
  TITLE     Expression of Prx1 and Tcf4 is decreased in the diaphragmatic
            muscle connective tissue of nitrofen-induced congenital
            diaphragmatic hernia
  JOURNAL   J Pediatr Surg 51 (12), 1931-1935 (2016)
   PUBMED   27665494
  REMARK    GeneRIF: expression of Prx1 and Tcf4 is decreased in the developing
            diaphragm in the nitrofen-induced congenital diaphragmatic hernia
            in Sprague- Dawley rats animal model.
REFERENCE   4  (bases 1 to 1377)
  AUTHORS   Liu,N., Xue,L., Guan,Y., Li,Q.Z., Cao,F.Y., Pang,S.L. and Guan,W.J.
  TITLE     Expression of Peroxiredoxins and Pulmonary Surfactant Protein A
            Induced by Silica in Rat Lung Tissue
  JOURNAL   Biomed Environ Sci 29 (8), 584-588 (2016)
   PUBMED   27660222
  REMARK    GeneRIF: Prdx1 and Prdx6 proteins is involved in pulmonary fibrosis
            induced by silica.
REFERENCE   5  (bases 1 to 1377)
  AUTHORS   Higuchi,M., Kato,T., Yoshida,S., Ueharu,H., Nishimura,N. and
            Kato,Y.
  TITLE     PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are
            involved in vasculogenesis during rat embryonic pituitary
            development
  JOURNAL   Cell Tissue Res 361 (2), 557-565 (2015)
   PUBMED   25795141
  REMARK    GeneRIF: PRRX1- and PRRX2-positive mesenchymal stem/progenitor
            cells are present at the periphery of the embryonic pituitary and
            participate in pituitary vasculogenesis by differentiation into
            vascular endothelial cells and pericytes.
REFERENCE   6  (bases 1 to 1377)
  AUTHORS   Lu,M.F., Cheng,H.T., Kern,M.J., Potter,S.S., Tran,B.,
            Diekwisch,T.G. and Martin,J.F.
  TITLE     prx-1 functions cooperatively with another paired-related homeobox
            gene, prx-2, to maintain cell fates within the craniofacial
            mesenchyme
  JOURNAL   Development 126 (3), 495-504 (1999)
   PUBMED   9876178
REFERENCE   7  (bases 1 to 1377)
  AUTHORS   Lu,M.F., Cheng,H.T., Lacy,A.R., Kern,M.J., Argao,E.A., Potter,S.S.,
            Olson,E.N. and Martin,J.F.
  TITLE     Paired-related homeobox genes cooperate in handplate and hindlimb
            zeugopod morphogenesis
  JOURNAL   Dev Biol 205 (1), 145-157 (1999)
   PUBMED   9882503
REFERENCE   8  (bases 1 to 1377)
  AUTHORS   ten Berge,D., Brouwer,A., Korving,J., Martin,J.F. and Meijlink,F.
  TITLE     Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region,
            inner ear and limbs
  JOURNAL   Development 125 (19), 3831-3842 (1998)
   PUBMED   9729491
REFERENCE   9  (bases 1 to 1377)
  AUTHORS   Hu,Y., Flanagan,J., Brennan,D.P., Zhou,H., Ng,K.W., Eisman,J.A. and
            Morrison,N.A.
  TITLE     rHox: a homeobox gene expressed in osteoblastic cells
  JOURNAL   J Cell Biochem 59 (4), 486-497 (1995)
   PUBMED   8749718
REFERENCE   10 (bases 1 to 1377)
  AUTHORS   Martin,J.F., Bradley,A. and Olson,E.N.
  TITLE     The paired-like homeo box gene MHox is required for early events of
            skeletogenesis in multiple lineages
  JOURNAL   Genes Dev 9 (10), 1237-1249 (1995)
   PUBMED   7758948
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAXUCZ010000013.1.
            
            On Nov 27, 2020 this sequence version replaced NM_153821.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR26643299.52634.1,
                                           SRR26643285.36778.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760386 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-570               JAXUCZ010000013.1  78203504-78204073   c
            571-746             JAXUCZ010000013.1  78151992-78152167   c
            747-928             JAXUCZ010000013.1  78146475-78146656   c
            929-1377            JAXUCZ010000013.1  78136783-78137231   c
FEATURES             Location/Qualifiers
     source          1..1377
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="13"
                     /map="13q22"
     gene            1..1377
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="paired related homeobox 1"
                     /db_xref="GeneID:266813"
                     /db_xref="RGD:628884"
     exon            1..570
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    144..146
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="upstream in-frame stop codon"
     CDS             330..1067
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="rHox; paired-related homeobox protein 1; paired
                     mesoderm homeobox 1"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 1"
                     /protein_id="NP_722543.1"
                     /db_xref="GeneID:266813"
                     /db_xref="RGD:628884"
                     /translation="

MTSSYGHVLERQPALGGRLDSPGNLDTLQAKKNFSVSHLLDLEEAGDMVAAQADESVGEAGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLANKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSATCANNSPAQGINMANSIANLRLKAKEYSLQRNQVPTVN"

     misc_feature    330..401
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="propagated from UniProtKB/Swiss-Prot (P63014.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    390..392
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P63014.1); phosphorylation site"
     misc_feature    489..638
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="propagated from UniProtKB/Swiss-Prot (P63014.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    624..782
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    807..809
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:P63013; propagated from
                     UniProtKB/Swiss-Prot (P63014.1); acetylation site"
     misc_feature    918..920
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="Phosphoserine. /evidence=ECO:0000255; propagated
                     from UniProtKB/Swiss-Prot (P63014.1); phosphorylation
                     site"
     misc_feature    984..1034
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     misc_feature    993..1034
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /note="propagated from UniProtKB/Swiss-Prot (P63014.1);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     exon            571..746
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /inference="alignment:Splign:2.1.0"
     exon            747..928
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /inference="alignment:Splign:2.1.0"
     exon            929..1377
                     /gene="Prrx1"
                     /gene_synonym="Pmx1; Prx-1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

tttttttttctttctgatttaagcttagcgtgtttgtttgtttggtttggtttttaaactttttttggtgtggattatctctctggaccacgccggacttggcttcagcgaagcaaccgaagctgggagaaagttacttgtgctgaaagttctgcacttcagaagggggtttctctctctctctctctctctctctctctctctctctctctctctcctccactcccccctctttcttccccactcggctcctctcccccctcacgcccacagcgtttggtgttgattcgagcgggaagaggggggtgggtgggattggagggaagaccatgacctccagctacgggcacgttctggagcggcaaccggctctgggcggccgcttggatagccctggcaacctcgacaccctgcaggcgaaaaagaacttctccgtcagtcacctgctagacctggaggaggccggggacatggtggcggcacaggcggacgaaagcgtgggcgaggcgggccggagcctgctggagtcaccgggactgaccagtggcagcgacacccctcagcaggacaatgatcagctgaactctgaggagaagaagaagagaaagcaacggagaaacaggacaaccttcaatagcagccagctgcaggccttggagcgtgtcttcgagaggacccattacccggatgcttttgtacgggaagatcttgcacgtcgggtgaacctcacggaggccagagtgcaggtgtggtttcagaaccgaagagccaagttccgcaggaatgagcgagccatgctggccaataaaaacgcttctctcctcaagtcctactcaggagacgtgactgccgtggaacaacccattgtacctcgtcctgctcccagacccaccgattatctctcctgggggacagcctctccgtacagcgccatggctacttattctgccacatgtgccaacaatagccctgcgcagggtatcaacatggccaacagcattgccaacctgagactgaaggccaaggaatatagtttacagaggaaccaggtgccaacagtcaactgaggaaaaaaataattaaacaggcctaagaagaaatcaaaaaccataagacacctatcctgttctgtcatttcttcatccgccggaaaaaaaaagataaaagcaaacaaacaaagccagaactaaaatattgggaccatggcggagaaaagcaggagaggaacaaaatgaaaattagttaacaaatgtttcttcttcctcttggataccatcaccatttgttgtgtgtgtattttttttccttctacccatgctttgctaagtatacttcaggcttcttctattaggctcaacccacccattcctataattg

//