2025-07-04 12:06:11, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_153627 689 bp mRNA linear ROD 31-MAR-2024 DEFINITION Rattus norvegicus PROP paired-like homeobox 1 (Prop1), mRNA. ACCESSION NM_153627 XM_001072330 XM_039085313 VERSION NM_153627.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 689) AUTHORS Yoshida,S., Fujiwara,K., Nishihara,H., Kato,T., Yashiro,T. and Kato,Y. TITLE Retinoic acid signalling is a candidate regulator of the expression of pituitary-specific transcription factor Prop1 in the developing rodent pituitary JOURNAL J Neuroendocrinol 30 (3), e12570 (2018) PUBMED 29356182 REMARK GeneRIF: Ex vivo organ culture using Rathke's pouch and an in vitro reporter assay demonstrated that retinoic acid signalling increases the expression level of Prop1 via RARalpha REFERENCE 2 (bases 1 to 689) AUTHORS Nishihara,H., Yoshida,S., Kanno,N., Nishimura,N., Ueharu,H., Ohgane,J., Kato,T. and Kato,Y. TITLE Involvement of DNA methylation in regulating rat Prop1 gene expression during pituitary organogenesis JOURNAL J Reprod Dev 63 (1), 37-44 (2017) PUBMED 27773885 REMARK GeneRIF: Prop1 is under regulation by CpG methylation during the early period of pituitary primordium development around E13.5 REFERENCE 3 (bases 1 to 689) AUTHORS Nishimura,N., Ueharu,H., Nishihara,H., Shibuya,S., Yoshida,S., Higuchi,M., Kanno,N., Horiguchi,K., Kato,T. and Kato,Y. TITLE Search for regulatory factors of the pituitary-specific transcription factor PROP1 gene JOURNAL J Reprod Dev 62 (1), 93-102 (2016) PUBMED 26640231 REMARK GeneRIF: SOX2 is a regulatory factor of Prop1 expression REFERENCE 4 (bases 1 to 689) AUTHORS Yako,H., Kato,T., Yoshida,S., Higuchi,M., Chen,M., Kanno,N., Ueharu,H. and Kato,Y. TITLE Three-dimensional studies of Prop1-expressing cells in the rat pituitary just before birth JOURNAL Cell Tissue Res 354 (3), 837-847 (2013) PUBMED 24026438 REMARK GeneRIF: Five cell types were observed expressing Sox2, Prop1 and Prx; these were heterogeneously distributed in the mediolateral and dorsoventral axes of the pituitary gland. REFERENCE 5 (bases 1 to 689) AUTHORS Yoshida,S., Kato,T., Susa,T., Cai,L.Y., Nakayama,M. and Kato,Y. TITLE PROP1 coexists with SOX2 and induces PIT1-commitment cells JOURNAL Biochem Biophys Res Commun 385 (1), 11-15 (2009) PUBMED 19442651 REMARK GeneRIF: PROP1 is consistently expressed in SOX2-expressing stem/progenitor cells in the rat pituitary from embryonic (E) to postnatal periods. REFERENCE 6 (bases 1 to 689) AUTHORS Raetzman,L.T., Ward,R. and Camper,S.A. TITLE Lhx4 and Prop1 are required for cell survival and expansion of the pituitary primordia JOURNAL Development 129 (18), 4229-4239 (2002) PUBMED 12183375 REFERENCE 7 (bases 1 to 689) AUTHORS Fluck,C., Deladoey,J., Rutishauser,K., Eble,A., Marti,U., Wu,W. and Mullis,P.E. TITLE Phenotypic variability in familial combined pituitary hormone deficiency caused by a PROP1 gene mutation resulting in the substitution of Arg-->Cys at codon 120 (R120C) JOURNAL J Clin Endocrinol Metab 83 (10), 3727-3734 (1998) PUBMED 9768691 REFERENCE 8 (bases 1 to 689) AUTHORS Wu,W., Cogan,J.D., Pfaffle,R.W., Dasen,J.S., Frisch,H., O'Connell,S.M., Flynn,S.E., Brown,M.R., Mullis,P.E., Parks,J.S., Phillips,J.A. 3rd and Rosenfeld,M.G. TITLE Mutations in PROP1 cause familial combined pituitary hormone deficiency JOURNAL Nat Genet 18 (2), 147-149 (1998) PUBMED 9462743 REFERENCE 9 (bases 1 to 689) AUTHORS Romero,M.I. and Phelps,C.J. TITLE Identification of growth hormone-releasing hormone and somatostatin neurons projecting to the median eminence in normal and growth hormone-deficient Ames dwarf mice JOURNAL Neuroendocrinology 65 (2), 107-116 (1997) PUBMED 9067988 REFERENCE 10 (bases 1 to 689) AUTHORS Cheng,T.C., Beamer,W.G., Phillips,J.A. 3rd, Bartke,A., Mallonee,R.L. and Dowling,C. TITLE Etiology of growth hormone deficiency in little, Ames, and Snell dwarf mice JOURNAL Endocrinology 113 (5), 1669-1678 (1983) PUBMED 6194978 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000010.1. On or before Mar 9, 2021 this sequence version replaced XM_039085313.1, NM_153627.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AB037922.1, SRR26360190.507508.1 [ECO:0000332] RNAseq introns :: partial sample support SAMEA5760383, SAMEA5760389 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-112 JAXUCZ010000010.1 35775332-35775443 c 113-336 JAXUCZ010000010.1 35774055-35774278 c 337-689 JAXUCZ010000010.1 35772968-35773320 c FEATURES Location/Qualifiers source 1..689 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="10" /map="10q22" gene 1..689 /gene="Prop1" /note="PROP paired-like homeobox 1" /db_xref="GeneID:266738" /db_xref="RGD:628759" exon 1..112 /gene="Prop1" /inference="alignment:Splign:2.1.0" CDS 4..675 /gene="Prop1" /note="prophet of Pit1, paired-like homeodomain transcription factor; paired like homeodomain factor 1" /codon_start=1 /product="homeobox protein prophet of Pit-1" /protein_id="NP_705891.1" /db_xref="GeneID:266738" /db_xref="RGD:628759" /translation="
MEAQRRSQQEKQTKGPVCGRSLPESQAASGTLISTVDRSPETSKRLSGTGLGRPKLCPQRGRPHSRRRHRTTFNPAQLGQLESAFGRNQYPDIWVREGLAQDTGLSEARIQVWFQNRRAKQRKQERSLLQPTAHLSPATFSGFLSESSPYPYTYTTPPPPVPCFPHPYNHALPSQPCTGASLTLPAQPEDWYPTLHPTHTGHLACPPPPPMFSLSLETPKSWN"
misc_feature 202..372 /gene="Prop1" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 113..336 /gene="Prop1" /inference="alignment:Splign:2.1.0" exon 337..689 /gene="Prop1" /inference="alignment:Splign:2.1.0" ORIGIN
gccatggaagctcaaagaaggagccagcaggaaaagcaaacaaagggccctgtctgtggccgatccctgcctgagtcacaggcggcctctgggactctgatctccacagtagacaggagccctgagacttctaagagactctctggtacagggctggggagacccaagctttgcccacagaggggccgtccccactcccggcgtcgccaccgcaccaccttcaacccagcacagctgggacagctggagtcagcctttgggaggaaccagtatcctgacatctgggttcgagaggggcttgcccaagacactggcctcagcgaagccagaatccaggtctggttccagaaccgcagggctaagcaacggaagcaagagcggtcactactccagccaacagcccatctgtctccggccaccttctctggcttcttgtcagagtcctctccttacccctacacctatacaacaccacctccacccgtaccctgcttccctcacccctacaaccacgctctcccctcccagccctgtacgggtgcctcactcactcttcctgcccagcctgaggactggtaccccaccttgcacccaacccacactggtcatctggcctgtcccccacccccacccatgttttccctcagcctggagacaccaaagtcctggaactgagcggtgccgtcacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]