GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 03:46:21, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_134324               1454 bp    mRNA    linear   PRI 24-JUL-2020
DEFINITION  Homo sapiens TARBP2 subunit of RISC loading complex (TARBP2),
            transcript variant 2, mRNA.
ACCESSION   NM_134324
VERSION     NM_134324.3
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1454)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   2  (bases 1 to 1454)
  AUTHORS   Takahashi T, Nakano Y, Onomoto K, Yoneyama M and Ui-Tei K.
  TITLE     LGP2 virus sensor enhances apoptosis by upregulating apoptosis
            regulatory genes through TRBP-bound miRNAs during viral infection
  JOURNAL   Nucleic Acids Res. 48 (3), 1494-1507 (2020)
   PUBMED   31799626
  REMARK    GeneRIF: Our findings may shed light on the mechanism of apoptosis,
            induced by the TRBP-bound miRNAs through the interaction of TRBP
            with LGP2, as an antiviral defense system in mammalian cells.
REFERENCE   3  (bases 1 to 1454)
  AUTHORS   Fish L, Navickas A, Culbertson B, Xu Y, Nguyen HCB, Zhang S,
            Hochman M, Okimoto R, Dill BD, Molina H, Najafabadi HS, Alarcon C,
            Ruggero D and Goodarzi H.
  TITLE     Nuclear TARBP2 Drives Oncogenic Dysregulation of RNA Splicing and
            Decay
  JOURNAL   Mol. Cell 75 (5), 967-981 (2019)
   PUBMED   31300274
  REMARK    GeneRIF: TARBP2 affects tumor growth in the lung and that this is
            dependent on TARBP2-mediated destabilization of ABCA3 and FOXN3.
            Finally, we establish ZNF143 as an upstream regulator of TARBP2
            expression.
REFERENCE   4  (bases 1 to 1454)
  AUTHORS   Ling T, Weng GX, Li J, Li C, Wang W, Cao L, Rao H, Ju C and Xu LG.
  TITLE     TARBP2 inhibits IRF7 activation by suppressing TRAF6-mediated
            K63-linked ubiquitination of IRF7
  JOURNAL   Mol. Immunol. 109, 116-125 (2019)
   PUBMED   30927622
  REMARK    GeneRIF: TARBP2 participates in the interaction between IRF7 and
            TRAF6, thereby suppressing TRAF6-mediated K63-linked ubiquitination
            of IRF7.
REFERENCE   5  (bases 1 to 1454)
  AUTHORS   Lai HH, Li CW, Hong CC, Sun HY, Chiu CF, Ou DL and Chen PS.
  TITLE     TARBP2-mediated destabilization of Nanog overcomes sorafenib
            resistance in hepatocellular carcinoma
  JOURNAL   Mol Oncol 13 (4), 928-945 (2019)
   PUBMED   30657254
  REMARK    GeneRIF: The TARBP2 protein was destabilized through
            autophagic-lysosomal proteolysis, thereby stabilizing the
            expression of the cancer stem cell marker protein Nanog, which
            facilitates sorafenib resistance in Hepatocellular carcinoma cells.
REFERENCE   6  (bases 1 to 1454)
  AUTHORS   Gatignol A, Duarte M, Daviet L, Chang YN and Jeang KT.
  TITLE     Sequential steps in Tat trans-activation of HIV-1 mediated through
            cellular DNA, RNA, and protein binding factors
  JOURNAL   Gene Expr. 5 (4-5), 217-228 (1996)
   PUBMED   8723388
REFERENCE   7  (bases 1 to 1454)
  AUTHORS   Cosentino GP, Venkatesan S, Serluca FC, Green SR, Mathews MB and
            Sonenberg N.
  TITLE     Double-stranded-RNA-dependent protein kinase and TAR RNA-binding
            protein form homo- and heterodimers in vivo
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (21), 9445-9449 (1995)
   PUBMED   7568151
REFERENCE   8  (bases 1 to 1454)
  AUTHORS   Kozak CA, Gatignol A, Graham K, Jeang KT and McBride OW.
  TITLE     Genetic mapping in human and mouse of the locus encoding TRBP, a
            protein that binds the TAR region of the human immunodeficiency
            virus (HIV-1)
  JOURNAL   Genomics 25 (1), 66-72 (1995)
   PUBMED   7774957
REFERENCE   9  (bases 1 to 1454)
  AUTHORS   Gatignol A, Buckler C and Jeang KT.
  TITLE     Relatedness of an RNA-binding motif in human immunodeficiency virus
            type 1 TAR RNA-binding protein TRBP to human P1/dsI kinase and
            Drosophila staufen
  JOURNAL   Mol. Cell. Biol. 13 (4), 2193-2202 (1993)
   PUBMED   8455607
REFERENCE   10 (bases 1 to 1454)
  AUTHORS   Gatignol A, Buckler-White A, Berkhout B and Jeang KT.
  TITLE     Characterization of a human TAR RNA-binding protein that activates
            the HIV-1 LTR
  JOURNAL   Science 251 (5001), 1597-1600 (1991)
   PUBMED   2011739
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023509.42, BI771121.1 and
            BC002419.2.
            On May 31, 2019 this sequence version replaced NM_134324.2.
            
            Summary: HIV-1, the causative agent of acquired immunodeficiency
            syndrome (AIDS), contains an RNA genome that produces a
            chromosomally integrated DNA during the replicative cycle.
            Activation of HIV-1 gene expression by the transactivator Tat is
            dependent on an RNA regulatory element (TAR) located downstream of
            the transcription initiation site. The protein encoded by this gene
            binds between the bulge and the loop of the HIV-1 TAR RNA
            regulatory element and activates HIV-1 gene expression in synergy
            with the viral Tat protein. Alternative splicing results in
            multiple transcript variants encoding different isoforms. This gene
            also has a pseudogene. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) has an alternate 5' exon and
            uses a downstream AUG codon for translation, as compared to variant
            1. The encoded isoform (b) thus has a shorter N-terminus, as
            compared to isoform a.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1163658.175881.1,
                                           SRR3476690.138809.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-7                 AC023509.42        121178-121184       c
            8-33                BI771121.1         4-29
            34-123              AC023509.42        121062-121151       c
            124-293             AC023509.42        120586-120755       c
            294-396             AC023509.42        119641-119743       c
            397-492             AC023509.42        118962-119057       c
            493-565             AC023509.42        118301-118373       c
            566-683             AC023509.42        117955-118072       c
            684-811             AC023509.42        117508-117635       c
            812-1013            AC023509.42        116920-117121       c
            1014-1454           BC002419.2         1415-1855
FEATURES             Location/Qualifiers
     source          1..1454
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..1454
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="TARBP2 subunit of RISC loading complex"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
     exon            1..123
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       10
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176666366"
     variation       15
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455242920"
     variation       16
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188499799"
     variation       17
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592731977"
     variation       20
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391310345"
     variation       23
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208882495"
     variation       29
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487260819"
     variation       31
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264078339"
     variation       34
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561274139"
     variation       36
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218446438"
     variation       37
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286015410"
     variation       42
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1373306496"
     variation       43
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531501207"
     variation       43
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1238594650"
     variation       44
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161790631"
     variation       47..52
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="ta"
                     /replace="taaata"
                     /db_xref="dbSNP:748255959"
     misc_feature    47..49
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="upstream in-frame stop codon"
     variation       47
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:948790754"
     variation       59
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919615757"
     variation       63
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565897676"
     variation       67
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389621874"
     variation       74
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405615916"
     variation       75
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550051207"
     variation       76
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325042127"
     variation       83
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565897701"
     variation       90..93
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="actg"
                     /replace="actgactg"
                     /db_xref="dbSNP:1362421064"
     variation       92
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436443070"
     variation       95
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377698566"
     variation       100
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978954422"
     variation       111
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197493599"
     variation       112
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430930487"
     variation       115
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263462802"
     variation       117
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565897738"
     exon            124..293
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       129
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954159306"
     variation       130
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776121643"
     CDS             134..1171
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="isoform b is encoded by transcript variant 2; TAR
                     (HIV) RNA-binding protein 2; trans-activation responsive
                     RNA-binding protein; TAR RNA binding protein 2;
                     RISC-loading complex subunit TARBP2; TAR (HIV) RNA-binding
                     protein TRBP1; TAR (HIV-1) RNA binding protein 2; TARBP2,
                     RISC loading complex RNA binding subunit"
                     /codon_start=1
                     /product="RISC-loading complex subunit TARBP2 isoform b"
                     /protein_id="NP_599151.2"
                     /db_xref="CCDS:CCDS41791.1"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
                     /translation="
MLAANPGKTPISLLQEYGTRIGKTPVYDLLKAEGQAHQPNFTFRVTVGDTSCTGQGPSKKAAKHKAAEVALKHLKGGSMLEPALEDSSSFSPLDSSLPEDIPVFTAAAAATPVPSVVLTRSPPMELQPPVSPQQSECNPVGALQELVVQKGWRLPEYTVTQESGPAHRKEFTMTCRVERFIEIGSGTSKKLAKRNAAAKMLLRVHTVPLDARDGNEVEPDDDHFSIGVGSRLDGLRNRGPGCTWDSLRNSVGEKILSLRSCSLGSLGALGPACCRVLSELSEEQAFHVSYLDIEELSLSGLCQCLVELSTQPATVCHGSATTREAARGEAARRALQYLKIMAGSK"
     misc_feature    order(158..160,176..181,302..313,320..322)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     misc_feature    161..>307
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif; Region: DSRM;
                     smart00358"
                     /db_xref="CDD:214634"
     misc_feature    545..736
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:238007"
     misc_feature    order(545..547,563..568,692..703,710..712)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     variation       140
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309859516"
     variation       142
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771057883"
     variation       144
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690659"
     variation       146
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262810724"
     variation       149
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201806294"
     variation       154
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138314225"
     variation       160
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758015411"
     variation       162
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372439760"
     variation       163
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767974443"
     variation       173
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192856939"
     variation       194
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200955588"
     variation       199
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391904346"
     variation       204
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162993139"
     variation       205
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472107347"
     variation       214
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429327123"
     variation       216
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750705674"
     variation       217
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592733187"
     variation       221
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382746266"
     variation       229
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143814054"
     variation       232
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439231897"
     variation       238
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780361324"
     variation       243
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592733237"
     variation       245
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014274919"
     variation       255
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374404200"
     variation       256
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753982762"
     variation       262
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755169835"
     variation       270
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368515319"
     variation       271
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542850740"
     variation       272
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347448032"
     variation       273
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772132398"
     variation       283
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777651228"
     variation       285
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023348175"
     variation       291
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970176065"
     variation       292
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746713420"
     exon            294..396
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       302
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164684860"
     variation       319
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387489855"
     variation       322
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866781136"
     variation       328
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423213318"
     variation       329
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323511961"
     variation       340
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554613712"
     variation       341
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355136438"
     variation       344
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467754312"
     variation       347
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402072069"
     variation       348
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170948533"
     variation       350
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478389003"
     variation       353
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444514983"
     variation       358
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565898900"
     variation       359
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296633887"
     variation       360
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146234229"
     variation       361
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138922911"
     variation       362
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010245473"
     variation       364
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361367468"
     variation       366
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029867627"
     variation       368
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289122609"
     variation       371
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565898979"
     variation       377
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307535361"
     variation       379
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206092363"
     variation       383
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230810380"
     variation       388
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457000872"
     exon            397..492
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       400
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760147843"
     variation       402
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460234051"
     variation       404
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761011672"
     variation       407
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243185624"
     variation       409
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415958345"
     variation       411
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752833291"
     variation       415
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375489701"
     variation       417
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764228291"
     variation       420..439
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="cactgcctgaggacattccg"
                     /db_xref="dbSNP:1592736949"
     variation       420
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745993749"
     variation       421
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141294828"
     variation       428
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457898855"
     variation       430
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780987963"
     variation       433
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412536394"
     variation       434
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745624083"
     variation       437
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756051687"
     variation       438
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770393984"
     variation       439
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776097598"
     variation       441..442
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gcaggttggag"
                     /replace="gcaggttggagtttgttgctcctctggttcttgggtacaaagataccc
                     tc"
                     /db_xref="dbSNP:767162268"
     variation       444..445
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gttgctcctctggttcttgggtacaaagataccctcttc"
                     /db_xref="dbSNP:1223635437"
     variation       447
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1248163777"
     variation       455
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768121847"
     variation       456
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183009410"
     variation       459
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773885391"
     variation       462
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199537568"
     variation       466
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747773992"
     variation       475
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449119698"
     variation       478
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371431074"
     variation       479
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777136581"
     variation       481
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759919100"
     variation       485
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765682240"
     variation       487
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775926522"
     exon            493..565
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       493
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471036080"
     variation       494
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156673068"
     variation       495
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365833083"
     variation       496..502
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750181498"
     variation       497
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767214517"
     variation       498
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150772647"
     variation       499
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374358069"
     variation       500
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126157"
     variation       501
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374557769"
     variation       502
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329118435"
     variation       510
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975785057"
     variation       511
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337225186"
     variation       513
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444143862"
     variation       516
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308904527"
     variation       519..520
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:758159322"
     variation       520
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761830924"
     variation       522..530
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tctcccctc"
                     /replace="tctcccctctcccctc"
                     /db_xref="dbSNP:1305242054"
     variation       522
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149488319"
     variation       525
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366777172"
     variation       531
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750681842"
     variation       532
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760878717"
     variation       535
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766141345"
     variation       550
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145961214"
     variation       551
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569814780"
     variation       553
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178260351"
     variation       556
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778864218"
     variation       557
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445068208"
     variation       560
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189495402"
     exon            566..683
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       566
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167249207"
     variation       568
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139830544"
     variation       569
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017529442"
     variation       571
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775368806"
     variation       577
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266282543"
     variation       585
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762989017"
     variation       593
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592739488"
     variation       597
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1468672830"
     variation       598
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200766710"
     variation       601
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378855936"
     variation       602
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592739552"
     variation       605
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199668545"
     variation       607
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1240848066"
     variation       607
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756838679"
     variation       610
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309616693"
     variation       614
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766905092"
     variation       616
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750154771"
     variation       620
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755706552"
     variation       628
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779260033"
     variation       631
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748440443"
     variation       633
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3203547"
     variation       635
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340168203"
     variation       636
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317193037"
     variation       654
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991539629"
     variation       659
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140420856"
     variation       660
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304703342"
     variation       664
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377165322"
     variation       668
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771112623"
     variation       669
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776561374"
     variation       675
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322966734"
     variation       680
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218815083"
     variation       681
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264363271"
     variation       682
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386990720"
     variation       683
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480716144"
     exon            684..811
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       685
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200876264"
     variation       687
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781338254"
     variation       691
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745896435"
     variation       705
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263471950"
     variation       713
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181823540"
     variation       714
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310414330"
     variation       716
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908630420"
     variation       718
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770162814"
     variation       719
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360596837"
     variation       720
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957530072"
     variation       721
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490292161"
     variation       723
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990309686"
     variation       724
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190258088"
     variation       725
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368267516"
     variation       726
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470432970"
     variation       730
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768637478"
     variation       731
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360713175"
     variation       734
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445665081"
     variation       740
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252922819"
     variation       741
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:562284475"
     variation       742
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370797559"
     variation       745
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771834045"
     variation       747
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772806614"
     variation       748
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166955"
     variation       750
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765847634"
     variation       751
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112692079"
     variation       752
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764458087"
     variation       756
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751806180"
     variation       758
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757814657"
     variation       761
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565901417"
     variation       765
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243946764"
     variation       767
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148798022"
     variation       768
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769109279"
     variation       770
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253025169"
     variation       775
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227984426"
     variation       777
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306446661"
     variation       783
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592741622"
     variation       789
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914943975"
     variation       790
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480862877"
     variation       791
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:945051944"
     variation       795
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756301639"
     variation       796
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412582897"
     variation       798
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592741683"
     variation       799
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333420845"
     variation       801
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361150643"
     variation       803
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401786389"
     variation       805
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295741009"
     variation       806
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780275010"
     variation       807
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042406221"
     variation       809
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749578666"
     variation       810
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768939962"
     exon            812..1013
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       819
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778949628"
     variation       822
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1126500"
     variation       824
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054935527"
     variation       825
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944494841"
     variation       826
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748374345"
     variation       830
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039189459"
     variation       839
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758198296"
     variation       840
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387986904"
     variation       841
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777612501"
     variation       844
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331675284"
     variation       845
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746965828"
     variation       846
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445111857"
     variation       847
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770788999"
     variation       849
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776152218"
     variation       853
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247627871"
     variation       856
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373114872"
     variation       859
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369459694"
     variation       864
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355764465"
     variation       866
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313561496"
     variation       870
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463307270"
     variation       875
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769325580"
     variation       876
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759508001"
     variation       879
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458924600"
     variation       884
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196590779"
     variation       885
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443341256"
     variation       886
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762662765"
     variation       891..896
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="aga"
                     /replace="agaaga"
                     /db_xref="dbSNP:775195616"
     variation       895
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374237346"
     variation       899
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046307879"
     variation       900
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341587285"
     variation       903
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773651708"
     variation       904
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761266200"
     variation       908
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766949070"
     variation       909
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753986429"
     variation       911
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463743576"
     variation       912
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331015937"
     variation       915..933
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gctccctggg"
                     /replace="gctccctgggctccctggg"
                     /replace="gctccctgggctccctgggctccctggg"
                     /db_xref="dbSNP:760313807"
     variation       920
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755056741"
     variation       922
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765359372"
     variation       924
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752922813"
     variation       927..942
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="ccctggg"
                     /replace="ccctgggtgccctggg"
                     /db_xref="dbSNP:776328245"
     variation       928
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758592168"
     variation       929
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902214"
     variation       931
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777436345"
     variation       934
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557863636"
     variation       935..943
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gccctgggc"
                     /db_xref="dbSNP:1332154856"
     variation       940
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:994678523"
     variation       944
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411548962"
     variation       945
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573277126"
     variation       947
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781157651"
     variation       948
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557386671"
     variation       951
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483483059"
     variation       953
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1359444252"
     variation       956
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202227515"
     variation       957
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769254353"
     variation       962
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485049554"
     variation       964
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775050428"
     variation       966
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425150109"
     variation       967
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476611229"
     variation       974
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169339085"
     variation       979
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748904808"
     variation       988
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902388"
     variation       994
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370082621"
     variation       995
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773741239"
     variation       1008
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402193215"
     variation       1012
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61499963"
     exon            1014..1454
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       1014
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489219038"
     variation       1016
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189130688"
     variation       1017
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471926971"
     variation       1023
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764128981"
     variation       1025
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568264666"
     variation       1027
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944361913"
     variation       1051
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762008935"
     variation       1053
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011575053"
     variation       1060
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902749"
     variation       1061
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592745371"
     variation       1062
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245217899"
     variation       1068
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372769309"
     variation       1069
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750164824"
     variation       1070
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151303646"
     variation       1080
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325665386"
     variation       1082
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902807"
     variation       1084
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779990767"
     variation       1085
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753692741"
     variation       1087
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393422620"
     variation       1089
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447334061"
     variation       1094
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754571823"
     variation       1096
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778556313"
     variation       1112
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747821228"
     variation       1113
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771785979"
     variation       1114
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290294258"
     variation       1120
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781716209"
     variation       1124
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387428580"
     variation       1125
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592745561"
     variation       1127
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535268850"
     variation       1128
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573462744"
     variation       1130
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034727"
     variation       1131
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140535249"
     variation       1132
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770792947"
     variation       1133
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1177356537"
     variation       1135
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200848880"
     variation       1137
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592745636"
     variation       1139
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763366180"
     variation       1142
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480566806"
     variation       1147
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182971982"
     variation       1149
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383312955"
     variation       1154
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416021586"
     variation       1157
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422180932"
     variation       1162
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768780952"
     variation       1164
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424684422"
     variation       1166
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774355466"
     variation       1172
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568796843"
     variation       1176
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767686359"
     variation       1177
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750204119"
     variation       1180
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1303409598"
     variation       1181
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380699334"
     variation       1183
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423088988"
     variation       1188
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539489466"
     variation       1189
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766053638"
     variation       1191
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753874744"
     variation       1192
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754908800"
     variation       1193
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247635221"
     variation       1195..1206
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tgc"
                     /replace="tgcaccctttgc"
                     /db_xref="dbSNP:750331078"
     variation       1196
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764848884"
     variation       1197
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376072604"
     variation       1199
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752218932"
     variation       1201
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758146970"
     variation       1202
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482312106"
     variation       1204
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462439135"
     variation       1205
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201937693"
     variation       1208..1223
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cc"
                     /replace="ccctgctctttctgcc"
                     /db_xref="dbSNP:758150043"
     variation       1208
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371130451"
     variation       1209
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168828171"
     variation       1210
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756569872"
     variation       1211
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409223430"
     variation       1213
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015897163"
     variation       1214..1220
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tct"
                     /replace="tctttct"
                     /db_xref="dbSNP:766141270"
     variation       1215
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375653873"
     variation       1222
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990519804"
     variation       1226
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364100736"
     variation       1228
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241444633"
     variation       1229
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2531"
     variation       1234
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540730822"
     variation       1236..1238
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:1294930306"
     variation       1237
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433367946"
     variation       1239
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592746008"
     variation       1242
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895247433"
     variation       1243
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865946250"
     variation       1247
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466021617"
     variation       1251
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022441650"
     variation       1255
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170635842"
     variation       1256
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450151580"
     variation       1261..1267
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gtg"
                     /replace="gtgggtg"
                     /db_xref="dbSNP:1474369753"
     variation       1261
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555550158"
     variation       1271
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186834640"
     variation       1272
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418677935"
     variation       1275
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978399323"
     variation       1277
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425362598"
     variation       1285
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463064142"
     variation       1286
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256531694"
     variation       1295
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923782799"
     variation       1297
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276688115"
     variation       1298
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345079403"
     variation       1300
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019620844"
     variation       1303
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340771541"
     variation       1305
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574204578"
     variation       1307
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935211665"
     variation       1308
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340677655"
     variation       1312
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780176078"
     variation       1317
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395803381"
     variation       1318
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377704001"
     variation       1322
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592746222"
     variation       1325
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310325074"
     variation       1327
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430487808"
     variation       1334
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291021604"
     variation       1350
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544802344"
     variation       1354
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459687847"
     variation       1362
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138108626"
     variation       1363
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117830235"
     variation       1368
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:545668585"
     variation       1370
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947379214"
     variation       1378
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253906725"
     variation       1381
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143775286"
     variation       1389
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1182731496"
     variation       1402..1404
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:1248924891"
     variation       1402..1403
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1293515177"
     variation       1402
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336398738"
     variation       1403..1407
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1356691149"
     variation       1409
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185547953"
     variation       1414
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039469222"
     variation       1417
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:546700312"
     variation       1420
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907745713"
     variation       1434
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320216475"
     variation       1438
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73313239"
     variation       1444
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410921775"
     variation       1445
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045529392"
     variation       1447
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907133067"
     variation       1450
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306305760"
ORIGIN      
agtggttcccggcgtgcaccggggcagtggctgctgcctccagctctaaatagtttggggttggcccggttcccagactgcactggaacactgggctttatgcccccacattcagtgcatttgtatagagcaaatgctggccgccaacccaggcaagaccccgatcagccttctgcaggagtatgggaccagaatagggaagacgcctgtgtacgaccttctcaaagccgagggccaagcccaccagcctaatttcaccttccgggtcaccgttggcgacaccagctgcactggtcagggccccagcaagaaggcagccaagcacaaggcagctgaggtggccctcaaacacctcaaaggggggagcatgctggagccggccctggaggacagcagttctttttctcccctagactcttcactgcctgaggacattccggtttttactgctgcagcagctgctaccccagttccatctgtagtcctaaccaggagcccccccatggaactgcagccccctgtctcccctcagcagtctgagtgcaaccccgttggtgctctgcaggagctggtggtgcagaaaggctggcggttgccggagtacacagtgacccaggagtctgggccagcccaccgcaaagaattcaccatgacctgtcgagtggagcgtttcattgagattgggagtggcacttccaaaaaattggcaaagcggaatgcggcggccaaaatgctgcttcgagtgcacacggtgcctctggatgcccgggatggcaatgaggtggagcctgatgatgaccacttctccattggtgtgggctcccgcctggatggtcttcgaaaccggggcccaggttgcacctgggattctctacgaaattcagtaggagagaagatcctgtccctccgcagttgctccctgggctccctgggtgccctgggccctgcctgctgccgtgtcctcagtgagctctctgaggagcaggcctttcacgtcagctacctggatattgaggagctgagcctgagtggactctgccagtgcctggtggaactgtccacccagccggccactgtgtgtcatggctctgcaaccaccagggaggcagcccgtggtgaggctgcccgccgtgccctgcagtacctcaagatcatggcaggcagcaagtgaagccccagctggactcatggatgtgcaccctttgctccctgctctttctgcctctgggctcatgtatctgcgcagctctggtaccctctgtgggtgccatctctacctctgacacagactgcctgccttgaagctgagaaggcacagggcaaggagccaaggaccacagagcctcagccagcccaggatccgtcctcattttattggtgatgatgaatgggaatgaaatcagggggctgtctactagagcctggaataaatatgctgctttgtggatttttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]