GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 05:30:17, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_134323               1510 bp    mRNA    linear   PRI 25-JUL-2020
DEFINITION  Homo sapiens TARBP2 subunit of RISC loading complex (TARBP2),
            transcript variant 1, mRNA.
ACCESSION   NM_134323
VERSION     NM_134323.2
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1510)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   2  (bases 1 to 1510)
  AUTHORS   Takahashi T, Nakano Y, Onomoto K, Yoneyama M and Ui-Tei K.
  TITLE     LGP2 virus sensor enhances apoptosis by upregulating apoptosis
            regulatory genes through TRBP-bound miRNAs during viral infection
  JOURNAL   Nucleic Acids Res. 48 (3), 1494-1507 (2020)
   PUBMED   31799626
  REMARK    GeneRIF: Our findings may shed light on the mechanism of apoptosis,
            induced by the TRBP-bound miRNAs through the interaction of TRBP
            with LGP2, as an antiviral defense system in mammalian cells.
REFERENCE   3  (bases 1 to 1510)
  AUTHORS   Fish L, Navickas A, Culbertson B, Xu Y, Nguyen HCB, Zhang S,
            Hochman M, Okimoto R, Dill BD, Molina H, Najafabadi HS, Alarcon C,
            Ruggero D and Goodarzi H.
  TITLE     Nuclear TARBP2 Drives Oncogenic Dysregulation of RNA Splicing and
            Decay
  JOURNAL   Mol. Cell 75 (5), 967-981 (2019)
   PUBMED   31300274
  REMARK    GeneRIF: TARBP2 affects tumor growth in the lung and that this is
            dependent on TARBP2-mediated destabilization of ABCA3 and FOXN3.
            Finally, we establish ZNF143 as an upstream regulator of TARBP2
            expression.
REFERENCE   4  (bases 1 to 1510)
  AUTHORS   Ling T, Weng GX, Li J, Li C, Wang W, Cao L, Rao H, Ju C and Xu LG.
  TITLE     TARBP2 inhibits IRF7 activation by suppressing TRAF6-mediated
            K63-linked ubiquitination of IRF7
  JOURNAL   Mol. Immunol. 109, 116-125 (2019)
   PUBMED   30927622
  REMARK    GeneRIF: TARBP2 participates in the interaction between IRF7 and
            TRAF6, thereby suppressing TRAF6-mediated K63-linked ubiquitination
            of IRF7.
REFERENCE   5  (bases 1 to 1510)
  AUTHORS   Lai HH, Li CW, Hong CC, Sun HY, Chiu CF, Ou DL and Chen PS.
  TITLE     TARBP2-mediated destabilization of Nanog overcomes sorafenib
            resistance in hepatocellular carcinoma
  JOURNAL   Mol Oncol 13 (4), 928-945 (2019)
   PUBMED   30657254
  REMARK    GeneRIF: The TARBP2 protein was destabilized through
            autophagic-lysosomal proteolysis, thereby stabilizing the
            expression of the cancer stem cell marker protein Nanog, which
            facilitates sorafenib resistance in Hepatocellular carcinoma cells.
REFERENCE   6  (bases 1 to 1510)
  AUTHORS   Gatignol A, Duarte M, Daviet L, Chang YN and Jeang KT.
  TITLE     Sequential steps in Tat trans-activation of HIV-1 mediated through
            cellular DNA, RNA, and protein binding factors
  JOURNAL   Gene Expr. 5 (4-5), 217-228 (1996)
   PUBMED   8723388
REFERENCE   7  (bases 1 to 1510)
  AUTHORS   Cosentino GP, Venkatesan S, Serluca FC, Green SR, Mathews MB and
            Sonenberg N.
  TITLE     Double-stranded-RNA-dependent protein kinase and TAR RNA-binding
            protein form homo- and heterodimers in vivo
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (21), 9445-9449 (1995)
   PUBMED   7568151
REFERENCE   8  (bases 1 to 1510)
  AUTHORS   Kozak CA, Gatignol A, Graham K, Jeang KT and McBride OW.
  TITLE     Genetic mapping in human and mouse of the locus encoding TRBP, a
            protein that binds the TAR region of the human immunodeficiency
            virus (HIV-1)
  JOURNAL   Genomics 25 (1), 66-72 (1995)
   PUBMED   7774957
REFERENCE   9  (bases 1 to 1510)
  AUTHORS   Gatignol A, Buckler C and Jeang KT.
  TITLE     Relatedness of an RNA-binding motif in human immunodeficiency virus
            type 1 TAR RNA-binding protein TRBP to human P1/dsI kinase and
            Drosophila staufen
  JOURNAL   Mol. Cell. Biol. 13 (4), 2193-2202 (1993)
   PUBMED   8455607
REFERENCE   10 (bases 1 to 1510)
  AUTHORS   Gatignol A, Buckler-White A, Berkhout B and Jeang KT.
  TITLE     Characterization of a human TAR RNA-binding protein that activates
            the HIV-1 LTR
  JOURNAL   Science 251 (5001), 1597-1600 (1991)
   PUBMED   2011739
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC002419.2 and BC005860.2.
            On May 17, 2019 this sequence version replaced NM_134323.1.
            
            Summary: HIV-1, the causative agent of acquired immunodeficiency
            syndrome (AIDS), contains an RNA genome that produces a
            chromosomally integrated DNA during the replicative cycle.
            Activation of HIV-1 gene expression by the transactivator Tat is
            dependent on an RNA regulatory element (TAR) located downstream of
            the transcription initiation site. The protein encoded by this gene
            binds between the bulge and the loop of the HIV-1 TAR RNA
            regulatory element and activates HIV-1 gene expression in synergy
            with the viral Tat protein. Alternative splicing results in
            multiple transcript variants encoding different isoforms. This gene
            also has a pseudogene. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) is the longer transcript and
            encodes the longer isoform (a).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7346977.321528.1, BC005860.2
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000266987.7/ ENSP00000266987.2
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-452               BC002419.2         363-814
            453-1510            BC005860.2         680-1737
FEATURES             Location/Qualifiers
     source          1..1510
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..1510
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="TARBP2 subunit of RISC loading complex"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
     exon            1..179
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       1..15
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="agcgtgccccgcggc"
                     /replace="g"
                     /replace="tgggcgggggactccatatcccagcgtgccccgcggcg"
                     /db_xref="dbSNP:1272510316"
     variation       9
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1242961505"
     variation       15
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898222132"
     variation       23
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193174332"
     variation       24
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995286067"
     variation       25
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972079980"
     variation       26
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919222946"
     variation       29
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376120977"
     variation       31
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938780660"
     variation       36
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311496612"
     variation       37
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1275925847"
     variation       41
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215867121"
     variation       43
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1362001327"
     variation       50
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1044223576"
     misc_feature    55..57
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="upstream in-frame stop codon"
     variation       60
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397736004"
     variation       61
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592731126"
     variation       62..63
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1555213461"
     variation       62
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338918065"
     variation       63
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544243086"
     variation       64
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992922068"
     variation       73
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372620817"
     variation       78
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469377203"
     variation       79
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160156676"
     variation       81
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779422499"
     variation       82
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753563878"
     variation       83
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316028056"
     variation       85
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325652397"
     variation       87
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916086798"
     variation       89
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948901939"
     variation       91
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043588507"
     variation       92
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904802030"
     variation       95
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285147193"
     variation       101
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562148014"
     variation       104
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1222415828"
     variation       107
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577179415"
     variation       108
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747332122"
     variation       109
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203020828"
     variation       111
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170305449"
     variation       114
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283923450"
     variation       117
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002751169"
     variation       120
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757764019"
     variation       121
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781681576"
     variation       124
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367720214"
     variation       125
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183068848"
     variation       126
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746347538"
     CDS             127..1227
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="isoform a is encoded by transcript variant 1; TAR
                     (HIV) RNA-binding protein 2; trans-activation responsive
                     RNA-binding protein; TAR RNA binding protein 2;
                     RISC-loading complex subunit TARBP2; TAR (HIV) RNA-binding
                     protein TRBP1; TAR (HIV-1) RNA binding protein 2; TARBP2,
                     RISC loading complex RNA binding subunit"
                     /codon_start=1
                     /product="RISC-loading complex subunit TARBP2 isoform a"
                     /protein_id="NP_599150.1"
                     /db_xref="CCDS:CCDS8861.1"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
                     /translation="
MSEEEQGSGTTTGCGLPSIEQMLAANPGKTPISLLQEYGTRIGKTPVYDLLKAEGQAHQPNFTFRVTVGDTSCTGQGPSKKAAKHKAAEVALKHLKGGSMLEPALEDSSSFSPLDSSLPEDIPVFTAAAAATPVPSVVLTRSPPMELQPPVSPQQSECNPVGALQELVVQKGWRLPEYTVTQESGPAHRKEFTMTCRVERFIEIGSGTSKKLAKRNAAAKMLLRVHTVPLDARDGNEVEPDDDHFSIGVGSRLDGLRNRGPGCTWDSLRNSVGEKILSLRSCSLGSLGALGPACCRVLSELSEEQAFHVSYLDIEELSLSGLCQCLVELSTQPATVCHGSATTREAARGEAARRALQYLKIMAGSK"
     misc_feature    190..441
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15633.3);
                     Region: Sufficient for interaction with PRKRA"
     misc_feature    order(214..216,232..237,358..369,376..378)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     misc_feature    217..>363
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif; Region: DSRM;
                     smart00358"
                     /db_xref="CDD:214634"
     misc_feature    580..828
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15633.3);
                     Region: Sufficient for interaction with PRKRA"
     misc_feature    580..582
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:24275569; propagated from
                     UniProtKB/Swiss-Prot (Q15633.3); phosphorylation site"
     misc_feature    601..792
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:238007"
     misc_feature    order(601..603,619..624,748..759,766..768)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     misc_feature    808..1224
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15633.3);
                     Region: Sufficient for interaction with DICER1"
     misc_feature    985..1224
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15633.3);
                     Region: Sufficient for interaction with PRKRA"
     variation       131
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468741558"
     variation       135
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158215824"
     variation       138
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544720790"
     variation       139
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425088611"
     variation       140
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775401324"
     variation       146
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749572733"
     variation       149
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403788459"
     variation       151
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867774226"
     variation       152
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533321752"
     variation       158
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236387428"
     variation       159
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278618568"
     variation       160
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565897406"
     variation       161..175
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cgggctgc"
                     /replace="cgggctgcgggctgc"
                     /db_xref="dbSNP:777061679"
     variation       164
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248682577"
     variation       165
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216416067"
     variation       166
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768952302"
     variation       168
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371506572"
     variation       170
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374991961"
     variation       171
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968511769"
     variation       173
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148956859"
     variation       178
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767373404"
     variation       179
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868841904"
     exon            180..349
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       185
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954159306"
     variation       186
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776121643"
     variation       196
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309859516"
     variation       198
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771057883"
     variation       200
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690659"
     variation       202
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262810724"
     variation       205
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201806294"
     variation       210
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138314225"
     variation       216
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758015411"
     variation       218
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372439760"
     variation       219
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767974443"
     variation       229
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192856939"
     variation       250
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200955588"
     variation       255
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391904346"
     variation       260
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162993139"
     variation       261
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472107347"
     variation       270
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429327123"
     variation       272
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750705674"
     variation       273
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592733187"
     variation       277
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382746266"
     variation       285
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143814054"
     variation       288
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439231897"
     variation       294
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780361324"
     variation       299
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592733237"
     variation       301
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014274919"
     variation       311
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374404200"
     variation       312
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753982762"
     variation       318
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755169835"
     variation       326
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368515319"
     variation       327
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542850740"
     variation       328
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347448032"
     variation       329
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772132398"
     variation       339
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777651228"
     variation       341
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023348175"
     variation       347
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970176065"
     variation       348
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746713420"
     exon            350..452
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       358
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164684860"
     variation       375
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387489855"
     variation       378
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866781136"
     variation       384
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423213318"
     variation       385
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323511961"
     variation       396
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554613712"
     variation       397
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355136438"
     variation       400
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467754312"
     variation       403
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402072069"
     variation       404
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170948533"
     variation       406
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478389003"
     variation       409
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444514983"
     variation       414
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565898900"
     variation       415
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296633887"
     variation       416
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146234229"
     variation       417
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138922911"
     variation       418
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010245473"
     variation       420
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361367468"
     variation       422
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029867627"
     variation       424
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289122609"
     variation       427
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565898979"
     variation       433
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307535361"
     variation       435
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206092363"
     variation       439
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230810380"
     variation       444
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457000872"
     exon            453..548
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       456
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760147843"
     variation       458
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460234051"
     variation       460
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761011672"
     variation       463
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243185624"
     variation       465
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415958345"
     variation       467
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752833291"
     variation       471
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375489701"
     variation       473
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764228291"
     variation       476..495
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="cactgcctgaggacattccg"
                     /db_xref="dbSNP:1592736949"
     variation       476
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745993749"
     variation       477
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141294828"
     variation       484
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457898855"
     variation       486
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780987963"
     variation       489
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412536394"
     variation       490
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745624083"
     variation       493
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756051687"
     variation       494
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770393984"
     variation       495
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776097598"
     variation       497..498
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gcaggttggag"
                     /replace="gcaggttggagtttgttgctcctctggttcttgggtacaaagataccc
                     tc"
                     /db_xref="dbSNP:767162268"
     variation       500..501
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gttgctcctctggttcttgggtacaaagataccctcttc"
                     /db_xref="dbSNP:1223635437"
     variation       503
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1248163777"
     variation       511
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768121847"
     variation       512
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183009410"
     variation       515
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773885391"
     variation       518
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199537568"
     variation       522
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747773992"
     variation       531
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449119698"
     variation       534
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371431074"
     variation       535
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777136581"
     variation       537
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759919100"
     variation       541
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765682240"
     variation       543
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775926522"
     exon            549..621
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       549
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471036080"
     variation       550
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156673068"
     variation       551
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365833083"
     variation       552..558
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750181498"
     variation       553
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767214517"
     variation       554
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150772647"
     variation       555
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374358069"
     variation       556
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126157"
     variation       557
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374557769"
     variation       558
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329118435"
     variation       566
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975785057"
     variation       567
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337225186"
     variation       569
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444143862"
     variation       572
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308904527"
     variation       575..576
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:758159322"
     variation       576
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761830924"
     variation       578..586
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tctcccctc"
                     /replace="tctcccctctcccctc"
                     /db_xref="dbSNP:1305242054"
     variation       578
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149488319"
     variation       581
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366777172"
     variation       587
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750681842"
     variation       588
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760878717"
     variation       591
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766141345"
     variation       606
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145961214"
     variation       607
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569814780"
     variation       609
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178260351"
     variation       612
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778864218"
     variation       613
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445068208"
     variation       616
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189495402"
     exon            622..739
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       622
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167249207"
     variation       624
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139830544"
     variation       625
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017529442"
     variation       627
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775368806"
     variation       633
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266282543"
     variation       641
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762989017"
     variation       649
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592739488"
     variation       653
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1468672830"
     variation       654
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200766710"
     variation       657
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378855936"
     variation       658
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592739552"
     variation       661
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199668545"
     variation       663
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1240848066"
     variation       663
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756838679"
     variation       666
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309616693"
     variation       670
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766905092"
     variation       672
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750154771"
     variation       676
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755706552"
     variation       684
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779260033"
     variation       687
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748440443"
     variation       689
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3203547"
     variation       691
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340168203"
     variation       692
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317193037"
     variation       710
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991539629"
     variation       715
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140420856"
     variation       716
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304703342"
     variation       720
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377165322"
     variation       724
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771112623"
     variation       725
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776561374"
     variation       731
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322966734"
     variation       736
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218815083"
     variation       737
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264363271"
     variation       738
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386990720"
     variation       739
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480716144"
     exon            740..867
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       741
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200876264"
     variation       743
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781338254"
     variation       747
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745896435"
     variation       761
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263471950"
     variation       769
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181823540"
     variation       770
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310414330"
     variation       772
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908630420"
     variation       774
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770162814"
     variation       775
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360596837"
     variation       776
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957530072"
     variation       777
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490292161"
     variation       779
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990309686"
     variation       780
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190258088"
     variation       781
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368267516"
     variation       782
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470432970"
     variation       786
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768637478"
     variation       787
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360713175"
     variation       790
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445665081"
     variation       796
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252922819"
     variation       797
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:562284475"
     variation       798
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370797559"
     variation       801
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771834045"
     variation       803
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772806614"
     variation       804
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166955"
     variation       806
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765847634"
     variation       807
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112692079"
     variation       808
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764458087"
     variation       812
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751806180"
     variation       814
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757814657"
     variation       817
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565901417"
     variation       821
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243946764"
     variation       823
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148798022"
     variation       824
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769109279"
     variation       826
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253025169"
     variation       831
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227984426"
     variation       833
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306446661"
     variation       839
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592741622"
     variation       845
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914943975"
     variation       846
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480862877"
     variation       847
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:945051944"
     variation       851
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756301639"
     variation       852
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412582897"
     variation       854
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592741683"
     variation       855
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333420845"
     variation       857
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361150643"
     variation       859
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401786389"
     variation       861
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295741009"
     variation       862
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780275010"
     variation       863
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042406221"
     variation       865
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749578666"
     variation       866
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768939962"
     exon            868..1069
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       875
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778949628"
     variation       878
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1126500"
     variation       880
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054935527"
     variation       881
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944494841"
     variation       882
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748374345"
     variation       886
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039189459"
     variation       895
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758198296"
     variation       896
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387986904"
     variation       897
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777612501"
     variation       900
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331675284"
     variation       901
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746965828"
     variation       902
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445111857"
     variation       903
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770788999"
     variation       905
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776152218"
     variation       909
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247627871"
     variation       912
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373114872"
     variation       915
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369459694"
     variation       920
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355764465"
     variation       922
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313561496"
     variation       926
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463307270"
     variation       931
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769325580"
     variation       932
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759508001"
     variation       935
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458924600"
     variation       940
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196590779"
     variation       941
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443341256"
     variation       942
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762662765"
     variation       947..952
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="aga"
                     /replace="agaaga"
                     /db_xref="dbSNP:775195616"
     variation       951
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374237346"
     variation       955
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046307879"
     variation       956
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341587285"
     variation       959
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773651708"
     variation       960
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761266200"
     variation       964
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766949070"
     variation       965
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753986429"
     variation       967
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463743576"
     variation       968
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331015937"
     variation       971..989
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gctccctggg"
                     /replace="gctccctgggctccctggg"
                     /replace="gctccctgggctccctgggctccctggg"
                     /db_xref="dbSNP:760313807"
     variation       976
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755056741"
     variation       978
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765359372"
     variation       980
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752922813"
     variation       983..998
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="ccctggg"
                     /replace="ccctgggtgccctggg"
                     /db_xref="dbSNP:776328245"
     variation       984
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758592168"
     variation       985
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902214"
     variation       987
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777436345"
     variation       990
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557863636"
     variation       991..999
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gccctgggc"
                     /db_xref="dbSNP:1332154856"
     variation       996
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:994678523"
     variation       1000
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411548962"
     variation       1001
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573277126"
     variation       1003
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781157651"
     variation       1004
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557386671"
     variation       1007
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483483059"
     variation       1009
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1359444252"
     variation       1012
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202227515"
     variation       1013
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769254353"
     variation       1018
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485049554"
     variation       1020
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775050428"
     variation       1022
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425150109"
     variation       1023
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476611229"
     variation       1030
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169339085"
     variation       1035
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748904808"
     variation       1044
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902388"
     variation       1050
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370082621"
     variation       1051
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773741239"
     variation       1064
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402193215"
     variation       1068
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61499963"
     exon            1070..1510
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       1070
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489219038"
     variation       1072
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189130688"
     variation       1073
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471926971"
     variation       1079
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764128981"
     variation       1081
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568264666"
     variation       1083
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944361913"
     variation       1107
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762008935"
     variation       1109
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011575053"
     variation       1116
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902749"
     variation       1117
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592745371"
     variation       1118
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245217899"
     variation       1124
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372769309"
     variation       1125
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750164824"
     variation       1126
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151303646"
     variation       1136
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325665386"
     variation       1138
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902807"
     variation       1140
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779990767"
     variation       1141
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753692741"
     variation       1143
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393422620"
     variation       1145
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447334061"
     variation       1150
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754571823"
     variation       1152
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778556313"
     variation       1168
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747821228"
     variation       1169
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771785979"
     variation       1170
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290294258"
     variation       1176
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781716209"
     variation       1180
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387428580"
     variation       1181
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592745561"
     variation       1183
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535268850"
     variation       1184
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573462744"
     variation       1186
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034727"
     variation       1187
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140535249"
     variation       1188
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770792947"
     variation       1189
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1177356537"
     variation       1191
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200848880"
     variation       1193
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592745636"
     variation       1195
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763366180"
     variation       1198
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480566806"
     variation       1203
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182971982"
     variation       1205
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383312955"
     variation       1210
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416021586"
     variation       1213
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422180932"
     variation       1218
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768780952"
     variation       1220
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424684422"
     variation       1222
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774355466"
     variation       1228
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568796843"
     variation       1232
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767686359"
     variation       1233
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750204119"
     variation       1236
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1303409598"
     variation       1237
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380699334"
     variation       1239
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423088988"
     variation       1244
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539489466"
     variation       1245
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766053638"
     variation       1247
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753874744"
     variation       1248
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754908800"
     variation       1249
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247635221"
     variation       1251..1262
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tgc"
                     /replace="tgcaccctttgc"
                     /db_xref="dbSNP:750331078"
     variation       1252
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764848884"
     variation       1253
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376072604"
     variation       1255
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752218932"
     variation       1257
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758146970"
     variation       1258
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482312106"
     variation       1260
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462439135"
     variation       1261
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201937693"
     variation       1264..1279
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cc"
                     /replace="ccctgctctttctgcc"
                     /db_xref="dbSNP:758150043"
     variation       1264
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371130451"
     variation       1265
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168828171"
     variation       1266
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756569872"
     variation       1267
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409223430"
     variation       1269
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015897163"
     variation       1270..1276
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tct"
                     /replace="tctttct"
                     /db_xref="dbSNP:766141270"
     variation       1271
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375653873"
     variation       1278
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990519804"
     variation       1282
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364100736"
     variation       1284
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241444633"
     variation       1285
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2531"
     variation       1290
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540730822"
     variation       1292..1294
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:1294930306"
     variation       1293
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433367946"
     variation       1295
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592746008"
     variation       1298
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895247433"
     variation       1299
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865946250"
     variation       1303
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466021617"
     variation       1307
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022441650"
     variation       1311
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170635842"
     variation       1312
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450151580"
     variation       1317..1323
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gtg"
                     /replace="gtgggtg"
                     /db_xref="dbSNP:1474369753"
     variation       1317
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555550158"
     variation       1327
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186834640"
     variation       1328
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418677935"
     variation       1331
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978399323"
     variation       1333
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425362598"
     variation       1341
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463064142"
     variation       1342
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256531694"
     variation       1351
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923782799"
     variation       1353
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276688115"
     variation       1354
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345079403"
     variation       1356
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019620844"
     variation       1359
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340771541"
     variation       1361
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574204578"
     variation       1363
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935211665"
     variation       1364
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340677655"
     variation       1368
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780176078"
     variation       1373
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395803381"
     variation       1374
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377704001"
     variation       1378
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592746222"
     variation       1381
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310325074"
     variation       1383
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430487808"
     variation       1390
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291021604"
     variation       1406
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544802344"
     variation       1410
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459687847"
     variation       1418
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138108626"
     variation       1419
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117830235"
     variation       1424
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:545668585"
     variation       1426
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947379214"
     variation       1434
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253906725"
     variation       1437
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143775286"
     variation       1445
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1182731496"
     variation       1458..1460
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:1248924891"
     variation       1458..1459
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1293515177"
     variation       1458
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336398738"
     variation       1459..1463
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1356691149"
     variation       1465
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185547953"
     variation       1470
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039469222"
     variation       1473
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:546700312"
     variation       1476
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907745713"
     variation       1490
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320216475"
     variation       1494
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73313239"
     variation       1500
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410921775"
     variation       1501
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045529392"
     variation       1503
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907133067"
     variation       1506
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306305760"
ORIGIN      
agcgtgccccgcggcgggccctaccggccgcgactccgggcttggccccggccctagctcgtcggctgtgtattggggcgcgtggaggctgcagtcacggtggcgcccgcggggacggaggagggaatgagtgaagaggagcaaggctccggcactaccacgggctgcgggctgcctagtatagagcaaatgctggccgccaacccaggcaagaccccgatcagccttctgcaggagtatgggaccagaatagggaagacgcctgtgtacgaccttctcaaagccgagggccaagcccaccagcctaatttcaccttccgggtcaccgttggcgacaccagctgcactggtcagggccccagcaagaaggcagccaagcacaaggcagctgaggtggccctcaaacacctcaaaggggggagcatgctggagccggccctggaggacagcagttctttttctcccctagactcttcactgcctgaggacattccggtttttactgctgcagcagctgctaccccagttccatctgtagtcctaaccaggagcccccccatggaactgcagccccctgtctcccctcagcagtctgagtgcaaccccgttggtgctctgcaggagctggtggtgcagaaaggctggcggttgccggagtacacagtgacccaggagtctgggccagcccaccgcaaagaattcaccatgacctgtcgagtggagcgtttcattgagattgggagtggcacttccaaaaaattggcaaagcggaatgcggcggccaaaatgctgcttcgagtgcacacggtgcctctggatgcccgggatggcaatgaggtggagcctgatgatgaccacttctccattggtgtgggctcccgcctggatggtcttcgaaaccggggcccaggttgcacctgggattctctacgaaattcagtaggagagaagatcctgtccctccgcagttgctccctgggctccctgggtgccctgggccctgcctgctgccgtgtcctcagtgagctctctgaggagcaggcctttcacgtcagctacctggatattgaggagctgagcctgagtggactctgccagtgcctggtggaactgtccacccagccggccactgtgtgtcatggctctgcaaccaccagggaggcagcccgtggtgaggctgcccgccgtgccctgcagtacctcaagatcatggcaggcagcaagtgaagccccagctggactcatggatgtgcaccctttgctccctgctctttctgcctctgggctcatgtatctgcgcagctctggtaccctctgtgggtgccatctctacctctgacacagactgcctgccttgaagctgagaaggcacagggcaaggagccaaggaccacagagcctcagccagcccaggatccgtcctcattttattggtgatgatgaatgggaatgaaatcagggggctgtctactagagcctggaataaatatgctgctttgtggatttttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]