GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 03:28:51, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_133620               4530 bp    mRNA    linear   ROD 03-JUL-2021
DEFINITION  Rattus norvegicus zinc fingers and homeoboxes 1 (Zhx1), mRNA.
ACCESSION   NM_133620
VERSION     NM_133620.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 4530)
  AUTHORS   Clement LC, Liu G, Perez-Torres I, Kanwar YS, Avila-Casado C and
            Chugh SS.
  TITLE     Early changes in gene expression that influence the course of
            primary glomerular disease
  JOURNAL   Kidney Int 72 (3), 337-347 (2007)
   PUBMED   17457373
  REMARK    GeneRIF: Upregulation of B7.1 with the downregulation of GLEPP1,
            Wilms' tumor gene (WT1), megalin, and vascular endothelial growth
            factor started early and persisted through the course of primary
            glomerular disease.
REFERENCE   2  (bases 1 to 4530)
  AUTHORS   Kim SH, Park J, Choi MC, Kim HP, Park JH, Jung Y, Lee JH, Oh DY, Im
            SA, Bang YJ and Kim TY.
  TITLE     Zinc-fingers and homeoboxes 1 (ZHX1) binds DNA methyltransferase
            (DNMT) 3B to enhance DNMT3B-mediated transcriptional repression
  JOURNAL   Biochem Biophys Res Commun 355 (2), 318-323 (2007)
   PUBMED   17303076
REFERENCE   3  (bases 1 to 4530)
  AUTHORS   Liu G, Clement LC, Kanwar YS, Avila-Casado C and Chugh SS.
  TITLE     ZHX proteins regulate podocyte gene expression during the
            development of nephrotic syndrome
  JOURNAL   J Biol Chem 281 (51), 39681-39692 (2006)
   PUBMED   17056598
  REMARK    GeneRIF: ZHX proteins 1, 2 and 3 are major transcriptional
            mediators of podocyte disease
            Erratum:[J Biol Chem. 2007 Apr 27;282(17):13140]
REFERENCE   4  (bases 1 to 4530)
  AUTHORS   Kawata H, Yamada K, Shou Z, Mizutani T, Yazawa T, Yoshino M,
            Sekiguchi T, Kajitani T and Miyamoto K.
  TITLE     Zinc-fingers and homeoboxes (ZHX) 2, a novel member of the ZHX
            family, functions as a transcriptional repressor
  JOURNAL   Biochem J 373 (Pt 3), 747-757 (2003)
   PUBMED   12741956
REFERENCE   5  (bases 1 to 4530)
  AUTHORS   Yamada K, Kawata H, Shou Z, Hirano S, Mizutani T, Yazawa T,
            Sekiguchi T, Yoshino M, Kajitani T and Miyamoto K.
  TITLE     Analysis of zinc-fingers and homeoboxes (ZHX)-1-interacting
            proteins: molecular cloning and characterization of a member of the
            ZHX family, ZHX3
  JOURNAL   Biochem J 373 (Pt 1), 167-178 (2003)
   PUBMED   12659632
REFERENCE   6  (bases 1 to 4530)
  AUTHORS   Yamada K, Kawata H, Matsuura K, Shou Z, Hirano S, Mizutani T,
            Yazawa T, Yoshino M, Sekiguchi T, Kajitani T and Miyamoto K.
  TITLE     Functional analysis and the molecular dissection of zinc-fingers
            and homeoboxes 1 (ZHX1)
  JOURNAL   Biochem Biophys Res Commun 297 (2), 368-374 (2002)
   PUBMED   12237128
REFERENCE   7  (bases 1 to 4530)
  AUTHORS   Hirano S, Yamada K, Kawata H, Shou Z, Mizutani T, Yazawa T,
            Kajitani T, Sekiguchi T, Yoshino M, Shigematsu Y, Mayumi M and
            Miyamoto K.
  TITLE     Rat zinc-fingers and homeoboxes 1 (ZHX1), a nuclear
            factor-YA-interacting nuclear protein, forms a homodimer
  JOURNAL   Gene 290 (1-2), 107-114 (2002)
   PUBMED   12062805
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000185.1.
            On Nov 26, 2020 this sequence version replaced NM_133620.1.
            
            Summary: may bind the activation domain of the A subunit of nuclear
            factor-Y to regulate transcription; localized to the nucleus; can
            form a homodimer in vitro [RGD, Feb 2006].
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB072439.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760434, SAMEA5760494
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-54                JACYVU010000185.1  72241268-72241321   c
            55-165              JACYVU010000185.1  72234512-72234622   c
            166-3017            JACYVU010000185.1  72218017-72220868   c
            3018-4530           JACYVU010000185.1  72213043-72214555   c
FEATURES             Location/Qualifiers
     source          1..4530
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q33"
     gene            1..4530
                     /gene="Zhx1"
                     /note="zinc fingers and homeoboxes 1"
                     /db_xref="GeneID:171159"
                     /db_xref="RGD:620010"
     exon            1..54
                     /gene="Zhx1"
                     /inference="alignment:Splign:2.1.0"
     exon            55..165
                     /gene="Zhx1"
                     /inference="alignment:Splign:2.1.0"
     exon            166..3017
                     /gene="Zhx1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    354..356
                     /gene="Zhx1"
                     /note="upstream in-frame stop codon"
     CDS             393..3014
                     /gene="Zhx1"
                     /note="zinc finger and homeodomain protein 1"
                     /codon_start=1
                     /product="zinc fingers and homeoboxes protein 1"
                     /protein_id="NP_598304.2"
                     /db_xref="GeneID:171159"
                     /db_xref="RGD:620010"
                     /translation="
MASRRKSTTPCMVLASEQDPDLELISDLEEGPPVLTPVENARAESVSSDEEVHESVDSDNQQNKKVEGGYECKYCTFQTPDLNMFTFHVDSEHPNVVLNSSYVCVECNFLTKRYDALSEHNLKYHPGEENFKLTMVKRNNQTIFEQTINDLTFDGSFVKEENTEQGESIDVSSSGISISKTPIMKMMKNKVENKRITVHHNSAEGTSEEKENGVKASREENAENTSSSASESNTSTSTVNRVHPSPAGTVVTPTAVLPGLAQVITAVSAQQNSNLVPKVLIPVNSIPTYNAALDNNPLLLNTYNKFPYPTMSEITVLSAQAKYTEEQIKIWFSAQRLKHGVSWTPEEVEEARRKQFNGTVHTVPQTITVIPTHISTGSNGLPSILQTCQIVGQPGLVLTQVAGANTLPVTAPIALTVAGVPNQTNVQKSQVPAAQPAAETKPATAAVPSSPSVRPEAALVNPDSFGIRAKKTKEQLAELKVSYLKNQFPHDSEIIRLMKITGLTKGEIKKWFSDTRYNQRNSKSNQCLHLNNDSSATIIIDSSDETPEPPAAAASQPKQSWNPFPDFAPQKFKEKTAEQLRVLQASFLNSSVLTDEELNRLRAQTKLTRREIDAWFTEKNKTKALKDEKVEVDESNVGSSKEEPGENSPGDEAVAPKSAGTGKICKKTPEQLHMLKSAFVRTQWPSPEEYDKLAEESGLARTDIVSWFGDTRYAWKNGNLKWYYYYQSSNSSSLNGLSSLRKRGRGRPKGRGRGRPRGRPRGGKRMNTWDRVPSLIKFKTGTAILKDYYLKHKFLNEQDLDELVNRSHMGYEQVREWFAERQRRSELGIELFEENEEEDEVIDDQEEDEEETDDSDTWEPPRHVKRKLSKSDD"
     misc_feature    393..581
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    498..500
                     /gene="Zhx1"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:Q9UKY1; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    525..527
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9UKY1; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    531..533
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    534..536
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    684..842
                     /gene="Zhx1"
                     /note="Zinc-fingers and homeoboxes C2H2 finger domain;
                     Region: zf_C2H2_ZHX; pfam18387"
                     /db_xref="CDD:408186"
     misc_feature    984..1133
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    996..998
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9UKY1; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    1206..2084
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Required for interaction with NFYA.
                     /evidence=ECO:0000250"
     misc_feature    1206..1688
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Required for dimerization. /evidence=ECO:0000250"
     misc_feature    <1287..1421
                     /gene="Zhx1"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    1680..1757
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1794..1961
                     /gene="Zhx1"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    2010..2096
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2118..2240
                     /gene="Zhx1"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    2271..2384
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2334..2336
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9UKY1; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    2385..2540
                     /gene="Zhx1"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    2583..2693
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2592..2696
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Required for nuclear localization.
                     /evidence=ECO:0000250"
     misc_feature    2712..2714
                     /gene="Zhx1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9UKY1; propagated from
                     UniProtKB/Swiss-Prot (Q8R515.1); phosphorylation site"
     misc_feature    <2745..2855
                     /gene="Zhx1"
                     /note="Homeodomain leucine-zipper encoding, Homez; Region:
                     Homez; pfam11569"
                     /db_xref="CDD:288426"
     misc_feature    2877..3011
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2883..3011
                     /gene="Zhx1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8R515.1);
                     Region: Required for repressor activity.
                     /evidence=ECO:0000250"
     exon            3018..4530
                     /gene="Zhx1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctctgaaatgcaagatggcggcggcgaggcgctgaggcgaggcggcccctgcagaagactgctagctactttgggacaatttgcaatgatggcctgagccaagtacctcatttgaagggataaccttccgctttaaggaacataatgctgaagaagctatggcaggtgattggagttgtgcttcatacatttcagcagttcagcagtgttttatctgccaactaagctttttacttgagtgcaccatggagacgctactaatgagacttgttgagcacaaaagtggacttgaagagccagaagccactgttttccaatgaaggattccaaacagttttaagcctcagtgcttttaaatcaccagagattccctccctgcccctaaaatcaaaatggcaagcagacgaaaatcaacaacaccttgcatggtccttgccagtgagcaggatccagatcttgagttgatatcggatttggaagaaggccctcccgtccttacacccgtagaaaatgctagagcagagagtgtctccagcgatgaagaagttcacgaatctgtggattctgacaatcagcaaaataagaaagtggaagggggctatgaatgtaaatactgtacttttcaaactccagatctaaatatgtttactttccatgtagattcagaacatcccaatgttgtgctgaattcatcctatgtttgtgttgaatgcaattttcttaccaaaaggtatgatgcactttctgagcataatctgaaataccacccaggagaagaaaatttcaaactgactatggtgaagcggaataaccagacaatctttgaacagacaataaatgatctgacttttgatggcagttttgttaaagaggagaatacagaacaaggagaatccatagatgtttcttcttcgggaatctccattagtaaaactcccattatgaaaatgatgaaaaataaggtagaaaacaaacggattacagttcaccataactcagctgagggcacttctgaagagaaagagaatggagtaaaagcaagccgggaagaaaatgcagaaaatacgagttcttcagcttcagaatctaacacaagtacttccactgtcaaccgagtgcatcccagtcctgcaggcacagtggtgacccccacagctgttcttcctgggctagcacaggtgataactgcagtctccgctcaacagaactcaaacttggtccctaaggtcttaatccctgttaatagcattccaacctacaatgctgcattggataacaatcctcttctacttaacacctacaacaaattcccttatcctacaatgtcagaaattacagttctttctgctcaagcaaaatatacagaggaacagatcaagatctggttttcagcccaacgtttaaagcatggggttagttggactcctgaagaagtagaggaggcaagaagaaaacaattcaatggaacagtgcatactgtacctcagaccataactgttattcctacacacatttccacaggaagtaatgggttaccatctattttacaaacatgccaaatagttggtcagccaggtctggtccttactcaagtagctggagcaaacaccttgccagtaacggctcccattgctctgacagtggcaggggttccaaatcaaacaaatgtacaaaagagtcaagtgcctgctgctcagcctgctgcagaaacaaagccagccacagcagcagttccatcatcgccaagtgtcaggcctgaagctgcactagtgaacccagattcatttggtattcgggccaaaaagactaaggaacagctggcagaactgaaagttagctaccttaaaaaccagtttccccacgactcagagatcatcaggcttatgaaaataacaggccttaccaaaggcgagattaaaaaatggtttagtgatacaaggtacaaccagagaaattcaaagagtaaccagtgcttacatctcaataacgactcctctgccactatcatcatagactccagtgatgaaaccccagaacccccagctgcagctgcgtcacagccgaaacagtcctggaatccctttcctgactttgctccccagaagtttaaagagaaaactgcagagcaacttcgtgtccttcaggcaagttttctcaacagttctgtacttacagatgaagaattaaataggttaagagcgcaaaccaaacttactagaagagaaattgatgcttggtttacagagaaaaataaaacaaaagctttaaaggatgagaaagtagaagtagatgaaagtaatgtaggtagttccaaagaagaacctggagaaaattctcctggagacgaagccgttgcacctaagtcagcagggacaggcaagatatgtaagaagacaccagagcaactgcacatgcttaaaagtgcatttgtccgaacacagtggccgtcaccagaagagtatgacaagctggctgaagaaagtgggcttgccagaacagacatagttagttggtttggagatacccgttatgcttggaagaatgggaacttgaaatggtactactactatcaaagctccaattcaagtagtttgaatggtctgtcctcccttaggaaaagagggagaggcagacccaaaggacgaggcagaggcagaccacgtgggcggcccagaggaggaaaaagaatgaacacctgggacagggtaccgtcgctcataaagtttaaaactggaacagcaatacttaaagattattacctgaagcacaaatttcttaatgagcaagaccttgatgaacttgtcaacagatcacacatgggttacgagcaggtcagagagtggtttgcagaaagacaaagaagatctgagttaggtatagaattatttgaggaaaatgaggaggaagatgaggttattgatgatcaggaagaagatgaagaagaaacagatgatagtgacacttgggaacccccacgacatgtgaagcggaagctttctaaatcggatgactgaaatctacttaaaattctgaaggagaataagttcttcaattcaagatgtctgaattactgtgaatgggcccaaccaatccttgatgacactgagaatgctttggggcatacatactttcaaaacagaatccaatatccaaaagaaatggagctccatgttgtgccaaagtcaaactgctgcagtcgggggcggttctgcaatgtaaatagagcgctaattaaaacaaacagactgtaaaagtgaaattttattctgacaggatgcaaaccttgtgaatctttgactttctaaggggttaatgaccactagagcttgtcctcacctcgactccagcatacagctctgtaagacaggctgtattacctgtattctttgacatgtgattaagcttacagctttgagtgaccaaacattttacagagtaaaagttgttagaaatgggagaggagaaccaaaccctactttctgtgtcttatttttcaggccctcaccaaattaaaagttgtacatgggcttacacagtttgcagtgtaaaagcagcctgtgcctgttatgttaggacagaaagacctgtggcttgctggcctttatgacgagaccctccactgaacactcatataaaccagtttctacttgtgcacttgtggggcttctctttgtcagaatccgatttgctttttactaagctgaagatactaccccagcaggagaaggaactcagtagggaacactctaaacatgttccaaacatgtgagagtccatagtgaaatacatgtggtgtgttctcaccggcgtgggactcaggaaggccagacagtctcaggttggattttgcaggaattaccttttcatgaagttgtaccttatgtaacaatttcagtgaacagaggggaaaaaaaattggaacctagcaagttaaaaatttccttttgatgtaagaatcagggcgtgttagcggtaactgtgctgcagcagaagacagagttcctactgacttgtaacagactggtgctgacgttcgtgctgggaaggaccctttctgttgtgatcataggaccacttttcaaactgtgctttcctcacagaacaaaatttttagttttattagatttggatttaaaatttttttgaatgatcacacatagtgggtttggccagttcatctttttctaacttaatgaataataaatactaagctcttggtttaatgtttgtcagctaatgagagatgttatgaaaaagccttgaatatgcatgctgctttcatttttataaactttttattttttaactatagctttattagcaattcccaaatgctgcaatttgctgatttcttcactcagacagctggctttgtgggcggctttttcatactactgttaactttttgaaaacgaagtgatgtaaagactgtaacaattgaatgcactaagctgtttttcttttacacatttaaaaacttcttaaagtactctgtattataatgattaaattgctccctttttaaaacca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]