GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 14:38:01, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_133322               4158 bp    mRNA    linear   ROD 03-JUL-2021
DEFINITION  Rattus norvegicus potassium voltage-gated channel subfamily Q
            member 2 (Kcnq2), mRNA.
ACCESSION   NM_133322
VERSION     NM_133322.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 4158)
  AUTHORS   Djouhri L, Zeidan A and Abd El-Aleem SA.
  TITLE     Changes in expression of Kv7.5 and Kv7.2 channels in dorsal root
            ganglion neurons in the streptozotocin rat model of painful
            diabetic neuropathy
  JOURNAL   Neurosci Lett 736, 135277 (2020)
   PUBMED   32739272
  REMARK    GeneRIF: Changes in expression of Kv7.5 and Kv7.2 channels in
            dorsal root ganglion neurons in the streptozotocin rat model of
            painful diabetic neuropathy.
REFERENCE   2  (bases 1 to 4158)
  AUTHORS   Bian G, Liu J, Guo Y, Yang Y, Li L, Qiao H, Li W, Xu T and Zhang Q.
  TITLE     Kv7.2 subunit-containing M-type potassium channels in the lateral
            habenula are involved in the regulation of working memory in
            parkinsonian rats
  JOURNAL   Neuropharmacology 168, 108012 (2020)
   PUBMED   32067988
  REMARK    GeneRIF: Kv7.2 subunit-containing M-type potassium channels in the
            lateral habenula are involved in the regulation of working memory
            in parkinsonian rats.
REFERENCE   3  (bases 1 to 4158)
  AUTHORS   Harada K, Matsuoka H and Inoue M.
  TITLE     Expression and regulation of M-type K(+) channel in PC12 cells and
            rat adrenal medullary cells
  JOURNAL   Cell Tissue Res 372 (3), 457-468 (2018)
   PUBMED   29488002
  REMARK    GeneRIF: the M channel is not expressed in rat adrenal medulla
            cells and this absence of expression may be ascribed to the
            suppression by glucocorticoid activity.
            Erratum:[Cell Tissue Res. 2018 Mar 19;:. PMID: 29552724]
REFERENCE   4  (bases 1 to 4158)
  AUTHORS   Ling J, Erol F and Gu JG.
  TITLE     Role of KCNQ2 channels in orofacial cold sensitivity: KCNQ2
            upregulation in trigeminal ganglion neurons after infraorbital
            nerve chronic constrictive injury
  JOURNAL   Neurosci Lett 664, 84-90 (2018)
   PUBMED   29133175
  REMARK    GeneRIF: Our results suggest that KCNQ2 channels are involved in
            regulating orofacial cold sensitivity
REFERENCE   5  (bases 1 to 4158)
  AUTHORS   Valdor M, Wagner A, Rohrs V, Berg J, Fechner H, Schroder W,
            Tzschentke TM, Bahrenberg G, Christoph T and Kurreck J.
  TITLE     RNA interference-based functional knockdown of the voltage-gated
            potassium channel Kv7.2 in dorsal root ganglion neurons after in
            vitro and in vivo gene transfer by adeno-associated virus vectors
  JOURNAL   Mol Pain 14, 1744806917749669 (2018)
   PUBMED   29212407
  REMARK    GeneRIF: RNA interference-mediated silencing of KCNQ2 is a suitable
            approach to create an ex vivo model for testing the specificity of
            novel Kv7.2/Kv7.3 agonists.
REFERENCE   6  (bases 1 to 4158)
  AUTHORS   Pan Z, Selyanko AA, Hadley JK, Brown DA, Dixon JE and McKinnon D.
  TITLE     Alternative splicing of KCNQ2 potassium channel transcripts
            contributes to the functional diversity of M-currents
  JOURNAL   J Physiol 531 (Pt 2), 347-358 (2001)
   PUBMED   11230508
REFERENCE   7  (bases 1 to 4158)
  AUTHORS   Jow F and Wang K.
  TITLE     Cloning and functional expression of rKCNQ2 K(+) channel from rat
            brain
  JOURNAL   Brain Res Mol Brain Res 80 (2), 269-278 (2000)
   PUBMED   11038262
REFERENCE   8  (bases 1 to 4158)
  AUTHORS   Watanabe H, Nagata E, Kosakai A, Nakamura M, Yokoyama M, Tanaka K
            and Sasai H.
  TITLE     Disruption of the epilepsy KCNQ2 gene results in neural
            hyperexcitability
  JOURNAL   J Neurochem 75 (1), 28-33 (2000)
   PUBMED   10854243
REFERENCE   9  (bases 1 to 4158)
  AUTHORS   Schwake M, Pusch M, Kharkovets T and Jentsch TJ.
  TITLE     Surface expression and single channel properties of KCNQ2/KCNQ3,
            M-type K+ channels involved in epilepsy
  JOURNAL   J Biol Chem 275 (18), 13343-13348 (2000)
   PUBMED   10788442
REFERENCE   10 (bases 1 to 4158)
  AUTHORS   Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE and
            McKinnon D.
  TITLE     KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of
            the M-channel
  JOURNAL   Science 282 (5395), 1890-1893 (1998)
   PUBMED   9836639
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JACYVU010000123.1.
            On Nov 26, 2020 this sequence version replaced NM_133322.1.
            
            Summary: potassium channel involved in sympathetic neuronal
            excitability [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF087453.2 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-411               JACYVU010000123.1  3851063-3851473     c
            412-502             JACYVU010000123.1  3831290-3831380     c
            503-629             JACYVU010000123.1  3830233-3830359     c
            630-805             JACYVU010000123.1  3829726-3829901     c
            806-931             JACYVU010000123.1  3828539-3828664     c
            932-1042            JACYVU010000123.1  3826182-3826292     c
            1043-1138           JACYVU010000123.1  3825547-3825642     c
            1139-1233           JACYVU010000123.1  3821640-3821734     c
            1234-1263           JACYVU010000123.1  3819987-3820016     c
            1264-1332           JACYVU010000123.1  3816948-3817016     c
            1333-1362           JACYVU010000123.1  3814124-3814153     c
            1363-1586           JACYVU010000123.1  3805282-3805505     c
            1587-1695           JACYVU010000123.1  3804498-3804606     c
            1696-1827           JACYVU010000123.1  3803885-3804016     c
            1828-1951           JACYVU010000123.1  3799299-3799422     c
            1952-4158           JACYVU010000123.1  3796520-3798726     c
FEATURES             Location/Qualifiers
     source          1..4158
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q43"
     gene            1..4158
                     /gene="Kcnq2"
                     /note="potassium voltage-gated channel subfamily Q member
                     2"
                     /db_xref="GeneID:170848"
                     /db_xref="RGD:621504"
     exon            1..411
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    98..100
                     /gene="Kcnq2"
                     /note="upstream in-frame stop codon"
     CDS             116..2674
                     /gene="Kcnq2"
                     /note="potassium voltage-gated channel, KQT-like
                     subfamily, member 2; KQT-like 2; potassium channel subunit
                     alpha KvLQT2; voltage-gated potassium channel subunit
                     Kv7.2; potassium channel, voltage-gated KQT-like subfamily
                     Q, member 2"
                     /codon_start=1
                     /product="potassium voltage-gated channel subfamily KQT
                     member 2"
                     /protein_id="NP_579856.2"
                     /db_xref="GeneID:170848"
                     /db_xref="RGD:621504"
                     /translation="
MVQKSRNGGVYPGTSGEKKLKVGFVGLDPGAPDSTRDGALLIAGSEAPKRGSVLSKPRTGGAGAGKPPKRNAFYRKLQNFLYNVLERPRGWAFIYHAYVFLLVFSCLVLSVFSTIKEYEKSSEGALYILEIVTIVVFGVEYFVRIWAAGCCCRYRGWRGRLKFARKPFCVIDIMVLIASIAVLAAGSQGNVFATSALRSLRFLQILRMIRMDRRGGTWKLLGSVVYAHSKELVTAWYIGFLCLILASFLVYLAEKGENDHFDTYADALWWGLITLTTIGYGDKYPQTWNGRLLAATFTLIGVSFFALPAGILGSGFALKVQEQHRQKHFEKRRNPAAGLIQSAWRFYATNLSRTDLHSTWQYYERTVTVPMYSSQTQTYGASRLIPPLNQLELLRNLKSKSGLTFRKEPQPEPSPSQKVSLKDRVFSSPRGVAAKGKGSPQAQTVRRSPSADQSLDDSPSKVPKSWSFGDRSRARQAFRIKGAASRQNSEEASLPGEDIVEDNKSCNCEFVTEDLTPGLKVSIRAVCVMRFLVSKRKFKESLRPYDVMDVIEQYSAGHLDMLSRIKSLQSRVDQIVGRGPTITDKDRTKGPAETELPEDPSMMGRLGKVEKQVLSMEKKLDFLVSIYTQRMGIPPAETEAYFGAKEPEPAPPYHSPEDSRDHADKHGCIIKIVRSTSSTGQRNYAAPPVMPPAQCPPSTSWQQSHQRHGTSPVGDHGSLVRIPPPPAHERSLSAYSGGNRASTEFLRLEGTPACRPSEAALRDSDTSISIPSVDHEELERSFSGFSISQSKENLDALASCYAAVAPCAKVRPYIAEGESDTDSDLCTPCGPPPRSATGEGPFGDVAWAGPRK"
     misc_feature    269..271
                     /gene="Kcnq2"
                     /note="Phosphoserine, by PKA.
                     /evidence=ECO:0000250|UniProtKB:O43526; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    389..1087
                     /gene="Kcnq2"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:395416"
     misc_feature    389..451
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    482..544
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    614..676
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    707..778
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    809..871
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    944..961
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Selectivity filter. /evidence=ECO:0000250"
     misc_feature    989..1051
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     transmembrane region"
     misc_feature    1064..1681
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Mediates interaction with calmodulin.
                     /evidence=ECO:0000250|UniProtKB:O43526"
     misc_feature    1325..1522
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1457..2017
                     /gene="Kcnq2"
                     /note="KCNQ voltage-gated potassium channel; Region:
                     KCNQ_channel; pfam03520"
                     /db_xref="CDD:397540"
     misc_feature    1457..1459
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1463..1465
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1475..1477
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1487..1489
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1493..1495
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1580..1582
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    1850..1918
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2042..2101
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2060..2323
                     /gene="Kcnq2"
                     /note="Unstructured region on Potassium channel subunit
                     alpha KvLQT2; Region: KCNQ2_u3; pfam16642"
                     /db_xref="CDD:406935"
     misc_feature    2078..2080
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    2129..2269
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2357..2659
                     /gene="Kcnq2"
                     /note="Ankyrin-G binding motif of KCNQ2-3; Region:
                     KCNQC3-Ank-G_bd; pfam11956"
                     /db_xref="CDD:403240"
     misc_feature    2456..2458
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    2462..2464
                     /gene="Kcnq2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
     misc_feature    2567..2671
                     /gene="Kcnq2"
                     /note="propagated from UniProtKB/Swiss-Prot (O88943.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            412..502
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            503..629
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            630..805
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            806..931
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            932..1042
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1043..1138
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1139..1233
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1234..1263
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1264..1332
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1333..1362
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1363..1586
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1587..1695
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1696..1827
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1828..1951
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
     exon            1952..4158
                     /gene="Kcnq2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agccgcagccgcctcggccatgcggctgccggacccggggcctgggctggggcccgcgccaccccctgcgcgccgcccccgctgagcccgcgccggatagggcgccgccggcaccatggtgcagaagtcgcgcaacggtggcgtgtaccccggcaccagcggggaaaaaaagctcaaggtgggcttcgtggggctggaccccggcgcgcccgactccactcgcgacggcgcgctactcatcgcgggctccgaggcccccaagcgcggcagcgttttgagcaagccgcggacgggcggcgcgggagccgggaagcccccaaagcgcaacgccttctaccgcaagctgcagaatttcctatacaacgtgctagagcggccccgcggttgggcgttcatctaccacgcctacgtgtttcttttagtcttctcctgccttgtgctttccgtgttttccaccatcaaggagtatgagaagagttccgagggggccctctacatcttggaaatcgtgaccatcgtggtattcggtgttgagtactttgtgagaatctgggctgcaggctgctgctgccggtatcgaggctggaggggccggctcaagtttgccaggaagccattctgtgtgatcgacatcatggtgctgattgcctccattgctgtgctggctgctggctcccagggcaatgtctttgccacatctgcacttcggagcttgcggttcttacaaatcttacggatgatccgtatggaccggaggggcggcacctggaagctcctgggatcggtggtctacgctcacagcaaggagctggtgactgcgtggtacattggcttcctctgcctcatcctggcctcgtttctggtgtacttggcagaaaagggtgagaatgaccacttcgacacctacgcggatgcactctggtggggtctgatcaccctgacaaccattggctacggggacaagtaccctcagacctggaacgggaggctgttagcagcgacgtttaccctcattggtgtctcattcttcgctcttcctgctggcattttgggatccggctttgccctgaaagtccaagagcagcatcggcaaaaacactttgagaaacggcggaatcctgcggcaggtctgatccagtctgcctggagattctatgctactaacctctcacgcaccgacctgcactccacgtggcagtactacgagcggacagtcactgtccccatgtacagctcacaaactcaaacctatggggcctccagactcattccgcctctgaaccagctggagctgctgaggaatctcaagagcaaatctggactcaccttcaggaaggagccacagccagagccatcaccaagtcagaaggtcagtttgaaagatcgtgtcttctccagcccccgaggcgtggctgccaaggggaaggggtctccccaggcccagacggtccggcggtcccccagtgcggatcagagtctcgatgacagcccaagcaaggtgcccaagagctggagctttggtgaccgcagccgtgcacgccaggctttccgtatcaagggcgctgcatcccggcagaactcagaagaagcaagcctccctggggaggatatcgtggaggacaacaagagctgtaactgcgagtttgtgactgaagatcttacccctggcctcaaagtcagcatcagagctgtgtgtgttatgcggttcttggtatctaagcgaaagttcaaagagagtctgcgcccatatgacgtgatggatgtcatcgaacagtactcggccggacacttggatatgttgtcccgaatcaagagcctgcagtccagagtggaccagattgtggggcggggcccgacaataacggacaaggaccgcaccaaaggcccagcggagacggaactgcccgaagaccccagcatgatgggacgccttgggaaggtggaaaaacaggtcttgtccatggaaaagaagctagacttcctggtgagcatctacacacagagaatgggcatcccaccagcagagacagaggcctatttcggggccaaggagcctgagccggcaccaccctaccacagcccggaggacagccgtgaccatgcagacaagcatggctgtattattaagattgtccgctccaccagctctacgggccagaggaactacgccgcacccccagtcatgccccctgcccagtgtcccccatccacctcgtggcagcagagccaccagcgccacggcacctcccccgtgggagaccatggctcactggtacgcatcccaccaccccctgcgcacgagcgctcactgtctgcctacagtgggggcaacagagccagtaccgagttcttgaggctggagggcaccccagcctgcaggccctctgaggcagccctgcgggatagcgacacgtccatctccatcccttcggtggaccacgaggagctggagcgttcctttagcggtttcagtatctcccagtccaaggagaacctggatgccctggccagctgttatgcagctgtggcgccgtgcgccaaggtcaggccctacattgcagagggtgagtctgacacagactcagacctctgcacaccgtgtgggccacccccacgctctgccactggtgaaggcccctttggagatgtggcttgggcagggcctaggaagtgagtctgggttgggctgctggccccatgccacacccactcttgttcagttttagagctggagttccagggcctttcttaaagtgacagagcggcatagagtagtgtgggttgtgaggatgctcatgggatctcgctctcagggtcaatgtggagtggaaatgaggcagggttccttagcacatacagtaacattttatagaagttcttttccaaccaggagagggtggttgaggccgggccctggaggcccttgggagctccctatggcagcaaagctagccctgcctagtcttcttgggggacatattgccctgtgagtgaggagggacagcgtgatggttagcctctgtgagtgggggtgtggctgggagcaagtccgtgggaggtagtggtgaaatgaaacaggcccgtctactgctgatagccagtcctgaggcccatgggtctctcagtttagtctgggagctcaggggtatagtaagtcactggaaacggcccactctcacacctgactgcttatccctccatcccgactgcccccagtaaagcattaccagacccactgttgggtgtggctgggcaatgcccctcatccctgggtaacctagctaaagagctgccacaatcttcctccctcttccaggttatgtggatctttccatgggaaccatctttaggtccttctcctggagctgaggaaggagtgaggcctcagggaccaatctggaacttagaattgatccttagactctcttgacttccacctcttaggggaagactcaactcacagccttttctgaaagggtttcttcagcaggttctggctgcctcgtgccaggtactgtagcccagtaggtatgagttgacacttcaaggcctctgctctttcctggtgtggcactggcctccaggctgtggccagcactttaagagaatcaccagataagcagaccagccttagccagggcacctccttgcctgctgcccacttggctctacggattcaggcagggctaaatgacatgacgtcttcaaactgccggctctctctacacgagagcatggcctttgagcctggtcaaggatccttcccaatgaagctggccatccagtcctttatccactagtaggtccctggtctgtggcccctgggtgtttgaggaattgggaacaccttggcctctactctggtgaggaataatccctgtccatcctgtgagtgggcatcttgggccatcagcagctgactttagagggaaacatggtagatataatagagccctcggttgtggccccataatatctggcccagaggtgcctggcattaaatgataacattttggggtgggggccctaaaccctcttgccctcagttttcctggtcactgaggacaagcgctacagagcttgtgcttgggcagagctttatttacttcttccacccttttgaaatgtgtgttctggcaggggtagaggcaacttggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]