ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2021-10-17 14:38:01, GGRNA.v2 : RefSeq release 207 (Jul, 2021)
LOCUS NM_133322 4158 bp mRNA linear ROD 03-JUL-2021
DEFINITION Rattus norvegicus potassium voltage-gated channel subfamily Q
member 2 (Kcnq2), mRNA.
ACCESSION NM_133322
VERSION NM_133322.2
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 4158)
AUTHORS Djouhri L, Zeidan A and Abd El-Aleem SA.
TITLE Changes in expression of Kv7.5 and Kv7.2 channels in dorsal root
ganglion neurons in the streptozotocin rat model of painful
diabetic neuropathy
JOURNAL Neurosci Lett 736, 135277 (2020)
PUBMED 32739272
REMARK GeneRIF: Changes in expression of Kv7.5 and Kv7.2 channels in
dorsal root ganglion neurons in the streptozotocin rat model of
painful diabetic neuropathy.
REFERENCE 2 (bases 1 to 4158)
AUTHORS Bian G, Liu J, Guo Y, Yang Y, Li L, Qiao H, Li W, Xu T and Zhang Q.
TITLE Kv7.2 subunit-containing M-type potassium channels in the lateral
habenula are involved in the regulation of working memory in
parkinsonian rats
JOURNAL Neuropharmacology 168, 108012 (2020)
PUBMED 32067988
REMARK GeneRIF: Kv7.2 subunit-containing M-type potassium channels in the
lateral habenula are involved in the regulation of working memory
in parkinsonian rats.
REFERENCE 3 (bases 1 to 4158)
AUTHORS Harada K, Matsuoka H and Inoue M.
TITLE Expression and regulation of M-type K(+) channel in PC12 cells and
rat adrenal medullary cells
JOURNAL Cell Tissue Res 372 (3), 457-468 (2018)
PUBMED 29488002
REMARK GeneRIF: the M channel is not expressed in rat adrenal medulla
cells and this absence of expression may be ascribed to the
suppression by glucocorticoid activity.
Erratum:[Cell Tissue Res. 2018 Mar 19;:. PMID: 29552724]
REFERENCE 4 (bases 1 to 4158)
AUTHORS Ling J, Erol F and Gu JG.
TITLE Role of KCNQ2 channels in orofacial cold sensitivity: KCNQ2
upregulation in trigeminal ganglion neurons after infraorbital
nerve chronic constrictive injury
JOURNAL Neurosci Lett 664, 84-90 (2018)
PUBMED 29133175
REMARK GeneRIF: Our results suggest that KCNQ2 channels are involved in
regulating orofacial cold sensitivity
REFERENCE 5 (bases 1 to 4158)
AUTHORS Valdor M, Wagner A, Rohrs V, Berg J, Fechner H, Schroder W,
Tzschentke TM, Bahrenberg G, Christoph T and Kurreck J.
TITLE RNA interference-based functional knockdown of the voltage-gated
potassium channel Kv7.2 in dorsal root ganglion neurons after in
vitro and in vivo gene transfer by adeno-associated virus vectors
JOURNAL Mol Pain 14, 1744806917749669 (2018)
PUBMED 29212407
REMARK GeneRIF: RNA interference-mediated silencing of KCNQ2 is a suitable
approach to create an ex vivo model for testing the specificity of
novel Kv7.2/Kv7.3 agonists.
REFERENCE 6 (bases 1 to 4158)
AUTHORS Pan Z, Selyanko AA, Hadley JK, Brown DA, Dixon JE and McKinnon D.
TITLE Alternative splicing of KCNQ2 potassium channel transcripts
contributes to the functional diversity of M-currents
JOURNAL J Physiol 531 (Pt 2), 347-358 (2001)
PUBMED 11230508
REFERENCE 7 (bases 1 to 4158)
AUTHORS Jow F and Wang K.
TITLE Cloning and functional expression of rKCNQ2 K(+) channel from rat
brain
JOURNAL Brain Res Mol Brain Res 80 (2), 269-278 (2000)
PUBMED 11038262
REFERENCE 8 (bases 1 to 4158)
AUTHORS Watanabe H, Nagata E, Kosakai A, Nakamura M, Yokoyama M, Tanaka K
and Sasai H.
TITLE Disruption of the epilepsy KCNQ2 gene results in neural
hyperexcitability
JOURNAL J Neurochem 75 (1), 28-33 (2000)
PUBMED 10854243
REFERENCE 9 (bases 1 to 4158)
AUTHORS Schwake M, Pusch M, Kharkovets T and Jentsch TJ.
TITLE Surface expression and single channel properties of KCNQ2/KCNQ3,
M-type K+ channels involved in epilepsy
JOURNAL J Biol Chem 275 (18), 13343-13348 (2000)
PUBMED 10788442
REFERENCE 10 (bases 1 to 4158)
AUTHORS Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE and
McKinnon D.
TITLE KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of
the M-channel
JOURNAL Science 282 (5395), 1890-1893 (1998)
PUBMED 9836639
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from
JACYVU010000123.1.
On Nov 26, 2020 this sequence version replaced NM_133322.1.
Summary: potassium channel involved in sympathetic neuronal
excitability [RGD, Feb 2006].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF087453.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
SAMD00132261, SAMD00132262
[ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-411 JACYVU010000123.1 3851063-3851473 c
412-502 JACYVU010000123.1 3831290-3831380 c
503-629 JACYVU010000123.1 3830233-3830359 c
630-805 JACYVU010000123.1 3829726-3829901 c
806-931 JACYVU010000123.1 3828539-3828664 c
932-1042 JACYVU010000123.1 3826182-3826292 c
1043-1138 JACYVU010000123.1 3825547-3825642 c
1139-1233 JACYVU010000123.1 3821640-3821734 c
1234-1263 JACYVU010000123.1 3819987-3820016 c
1264-1332 JACYVU010000123.1 3816948-3817016 c
1333-1362 JACYVU010000123.1 3814124-3814153 c
1363-1586 JACYVU010000123.1 3805282-3805505 c
1587-1695 JACYVU010000123.1 3804498-3804606 c
1696-1827 JACYVU010000123.1 3803885-3804016 c
1828-1951 JACYVU010000123.1 3799299-3799422 c
1952-4158 JACYVU010000123.1 3796520-3798726 c
FEATURES Location/Qualifiers
source 1..4158
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="3"
/map="3q43"
gene 1..4158
/gene="Kcnq2"
/note="potassium voltage-gated channel subfamily Q member
2"
/db_xref="GeneID:170848"
/db_xref="RGD:621504"
exon 1..411
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
misc_feature 98..100
/gene="Kcnq2"
/note="upstream in-frame stop codon"
CDS 116..2674
/gene="Kcnq2"
/note="potassium voltage-gated channel, KQT-like
subfamily, member 2; KQT-like 2; potassium channel subunit
alpha KvLQT2; voltage-gated potassium channel subunit
Kv7.2; potassium channel, voltage-gated KQT-like subfamily
Q, member 2"
/codon_start=1
/product="potassium voltage-gated channel subfamily KQT
member 2"
/protein_id="NP_579856.2"
/db_xref="GeneID:170848"
/db_xref="RGD:621504"
/translation="
MVQKSRNGGVYPGTSGEKKLKVGFVGLDPGAPDSTRDGALLIAGSEAPKRGSVLSKPRTGGAGAGKPPKRNAFYRKLQNFLYNVLERPRGWAFIYHAYVFLLVFSCLVLSVFSTIKEYEKSSEGALYILEIVTIVVFGVEYFVRIWAAGCCCRYRGWRGRLKFARKPFCVIDIMVLIASIAVLAAGSQGNVFATSALRSLRFLQILRMIRMDRRGGTWKLLGSVVYAHSKELVTAWYIGFLCLILASFLVYLAEKGENDHFDTYADALWWGLITLTTIGYGDKYPQTWNGRLLAATFTLIGVSFFALPAGILGSGFALKVQEQHRQKHFEKRRNPAAGLIQSAWRFYATNLSRTDLHSTWQYYERTVTVPMYSSQTQTYGASRLIPPLNQLELLRNLKSKSGLTFRKEPQPEPSPSQKVSLKDRVFSSPRGVAAKGKGSPQAQTVRRSPSADQSLDDSPSKVPKSWSFGDRSRARQAFRIKGAASRQNSEEASLPGEDIVEDNKSCNCEFVTEDLTPGLKVSIRAVCVMRFLVSKRKFKESLRPYDVMDVIEQYSAGHLDMLSRIKSLQSRVDQIVGRGPTITDKDRTKGPAETELPEDPSMMGRLGKVEKQVLSMEKKLDFLVSIYTQRMGIPPAETEAYFGAKEPEPAPPYHSPEDSRDHADKHGCIIKIVRSTSSTGQRNYAAPPVMPPAQCPPSTSWQQSHQRHGTSPVGDHGSLVRIPPPPAHERSLSAYSGGNRASTEFLRLEGTPACRPSEAALRDSDTSISIPSVDHEELERSFSGFSISQSKENLDALASCYAAVAPCAKVRPYIAEGESDTDSDLCTPCGPPPRSATGEGPFGDVAWAGPRK"
misc_feature 269..271
/gene="Kcnq2"
/note="Phosphoserine, by PKA.
/evidence=ECO:0000250|UniProtKB:O43526; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 389..1087
/gene="Kcnq2"
/note="Ion transport protein; Region: Ion_trans;
pfam00520"
/db_xref="CDD:395416"
misc_feature 389..451
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 482..544
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 614..676
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 707..778
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 809..871
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 944..961
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Selectivity filter. /evidence=ECO:0000250"
misc_feature 989..1051
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
transmembrane region"
misc_feature 1064..1681
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Mediates interaction with calmodulin.
/evidence=ECO:0000250|UniProtKB:O43526"
misc_feature 1325..1522
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 1457..2017
/gene="Kcnq2"
/note="KCNQ voltage-gated potassium channel; Region:
KCNQ_channel; pfam03520"
/db_xref="CDD:397540"
misc_feature 1457..1459
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1463..1465
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1475..1477
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1487..1489
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1493..1495
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q9Z351; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1580..1582
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 1850..1918
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 2042..2101
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 2060..2323
/gene="Kcnq2"
/note="Unstructured region on Potassium channel subunit
alpha KvLQT2; Region: KCNQ2_u3; pfam16642"
/db_xref="CDD:406935"
misc_feature 2078..2080
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 2129..2269
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 2357..2659
/gene="Kcnq2"
/note="Ankyrin-G binding motif of KCNQ2-3; Region:
KCNQC3-Ank-G_bd; pfam11956"
/db_xref="CDD:403240"
misc_feature 2456..2458
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 2462..2464
/gene="Kcnq2"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (O88943.1); phosphorylation site"
misc_feature 2567..2671
/gene="Kcnq2"
/note="propagated from UniProtKB/Swiss-Prot (O88943.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
exon 412..502
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 503..629
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 630..805
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 806..931
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 932..1042
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1043..1138
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1139..1233
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1234..1263
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1264..1332
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1333..1362
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1363..1586
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1587..1695
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1696..1827
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1828..1951
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
exon 1952..4158
/gene="Kcnq2"
/inference="alignment:Splign:2.1.0"
ORIGIN
agccgcagccgcctcggccatgcggctgccggacccggggcctgggctggggcccgcgccaccccctgcgcgccgcccccgctgagcccgcgccggatagggcgccgccggcaccatggtgcagaagtcgcgcaacggtggcgtgtaccccggcaccagcggggaaaaaaagctcaaggtgggcttcgtggggctggaccccggcgcgcccgactccactcgcgacggcgcgctactcatcgcgggctccgaggcccccaagcgcggcagcgttttgagcaagccgcggacgggcggcgcgggagccgggaagcccccaaagcgcaacgccttctaccgcaagctgcagaatttcctatacaacgtgctagagcggccccgcggttgggcgttcatctaccacgcctacgtgtttcttttagtcttctcctgccttgtgctttccgtgttttccaccatcaaggagtatgagaagagttccgagggggccctctacatcttggaaatcgtgaccatcgtggtattcggtgttgagtactttgtgagaatctgggctgcaggctgctgctgccggtatcgaggctggaggggccggctcaagtttgccaggaagccattctgtgtgatcgacatcatggtgctgattgcctccattgctgtgctggctgctggctcccagggcaatgtctttgccacatctgcacttcggagcttgcggttcttacaaatcttacggatgatccgtatggaccggaggggcggcacctggaagctcctgggatcggtggtctacgctcacagcaaggagctggtgactgcgtggtacattggcttcctctgcctcatcctggcctcgtttctggtgtacttggcagaaaagggtgagaatgaccacttcgacacctacgcggatgcactctggtggggtctgatcaccctgacaaccattggctacggggacaagtaccctcagacctggaacgggaggctgttagcagcgacgtttaccctcattggtgtctcattcttcgctcttcctgctggcattttgggatccggctttgccctgaaagtccaagagcagcatcggcaaaaacactttgagaaacggcggaatcctgcggcaggtctgatccagtctgcctggagattctatgctactaacctctcacgcaccgacctgcactccacgtggcagtactacgagcggacagtcactgtccccatgtacagctcacaaactcaaacctatggggcctccagactcattccgcctctgaaccagctggagctgctgaggaatctcaagagcaaatctggactcaccttcaggaaggagccacagccagagccatcaccaagtcagaaggtcagtttgaaagatcgtgtcttctccagcccccgaggcgtggctgccaaggggaaggggtctccccaggcccagacggtccggcggtcccccagtgcggatcagagtctcgatgacagcccaagcaaggtgcccaagagctggagctttggtgaccgcagccgtgcacgccaggctttccgtatcaagggcgctgcatcccggcagaactcagaagaagcaagcctccctggggaggatatcgtggaggacaacaagagctgtaactgcgagtttgtgactgaagatcttacccctggcctcaaagtcagcatcagagctgtgtgtgttatgcggttcttggtatctaagcgaaagttcaaagagagtctgcgcccatatgacgtgatggatgtcatcgaacagtactcggccggacacttggatatgttgtcccgaatcaagagcctgcagtccagagtggaccagattgtggggcggggcccgacaataacggacaaggaccgcaccaaaggcccagcggagacggaactgcccgaagaccccagcatgatgggacgccttgggaaggtggaaaaacaggtcttgtccatggaaaagaagctagacttcctggtgagcatctacacacagagaatgggcatcccaccagcagagacagaggcctatttcggggccaaggagcctgagccggcaccaccctaccacagcccggaggacagccgtgaccatgcagacaagcatggctgtattattaagattgtccgctccaccagctctacgggccagaggaactacgccgcacccccagtcatgccccctgcccagtgtcccccatccacctcgtggcagcagagccaccagcgccacggcacctcccccgtgggagaccatggctcactggtacgcatcccaccaccccctgcgcacgagcgctcactgtctgcctacagtgggggcaacagagccagtaccgagttcttgaggctggagggcaccccagcctgcaggccctctgaggcagccctgcgggatagcgacacgtccatctccatcccttcggtggaccacgaggagctggagcgttcctttagcggtttcagtatctcccagtccaaggagaacctggatgccctggccagctgttatgcagctgtggcgccgtgcgccaaggtcaggccctacattgcagagggtgagtctgacacagactcagacctctgcacaccgtgtgggccacccccacgctctgccactggtgaaggcccctttggagatgtggcttgggcagggcctaggaagtgagtctgggttgggctgctggccccatgccacacccactcttgttcagttttagagctggagttccagggcctttcttaaagtgacagagcggcatagagtagtgtgggttgtgaggatgctcatgggatctcgctctcagggtcaatgtggagtggaaatgaggcagggttccttagcacatacagtaacattttatagaagttcttttccaaccaggagagggtggttgaggccgggccctggaggcccttgggagctccctatggcagcaaagctagccctgcctagtcttcttgggggacatattgccctgtgagtgaggagggacagcgtgatggttagcctctgtgagtgggggtgtggctgggagcaagtccgtgggaggtagtggtgaaatgaaacaggcccgtctactgctgatagccagtcctgaggcccatgggtctctcagtttagtctgggagctcaggggtatagtaagtcactggaaacggcccactctcacacctgactgcttatccctccatcccgactgcccccagtaaagcattaccagacccactgttgggtgtggctgggcaatgcccctcatccctgggtaacctagctaaagagctgccacaatcttcctccctcttccaggttatgtggatctttccatgggaaccatctttaggtccttctcctggagctgaggaaggagtgaggcctcagggaccaatctggaacttagaattgatccttagactctcttgacttccacctcttaggggaagactcaactcacagccttttctgaaagggtttcttcagcaggttctggctgcctcgtgccaggtactgtagcccagtaggtatgagttgacacttcaaggcctctgctctttcctggtgtggcactggcctccaggctgtggccagcactttaagagaatcaccagataagcagaccagccttagccagggcacctccttgcctgctgcccacttggctctacggattcaggcagggctaaatgacatgacgtcttcaaactgccggctctctctacacgagagcatggcctttgagcctggtcaaggatccttcccaatgaagctggccatccagtcctttatccactagtaggtccctggtctgtggcccctgggtgtttgaggaattgggaacaccttggcctctactctggtgaggaataatccctgtccatcctgtgagtgggcatcttgggccatcagcagctgactttagagggaaacatggtagatataatagagccctcggttgtggccccataatatctggcccagaggtgcctggcattaaatgataacattttggggtgggggccctaaaccctcttgccctcagttttcctggtcactgaggacaagcgctacagagcttgtgcttgggcagagctttatttacttcttccacccttttgaaatgtgtgttctggcaggggtagaggcaacttggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]