2025-06-16 19:21:06, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_123966 1151 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana WUSCHEL related homeobox 8 (WOX8), mRNA. ACCESSION NM_123966 VERSION NM_123966.3 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 1151) AUTHORS Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E., Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K., Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S., Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M., Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R., Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J., Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J., Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L., Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B., Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E., Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A., Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M., See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L., Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R., Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R., Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N., Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B., Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H., Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W., Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M., Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K., Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C., Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P. CONSRTM Kazusa DNA Research Institute; Cold Spring Harbor and Washington University in St Louis Sequencing Consortium; European Union Arabidopsis Genome Sequencing Consortium TITLE Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 823-826 (2000) PUBMED 11130714 REFERENCE 2 (bases 1 to 1151) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1151) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 1151) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003076). On Sep 12, 2016 this sequence version replaced NM_123966.2. FEATURES Location/Qualifiers source 1..1151 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="5" /ecotype="Columbia" gene 1..1151 /gene="WOX8" /locus_tag="AT5G45980" /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B; WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B" /note="Arabidopsis thaliana WOX8 protein. Contains similarity to homeodomain transcription factor. Positively regulates early embryonic growth. Together with CLE8 it forms a signaling module that promotes seed growth and overall seed size." /db_xref="Araport:AT5G45980" /db_xref="GeneID:834638" /db_xref="TAIR:AT5G45980" CDS 36..1013 /gene="WOX8" /locus_tag="AT5G45980" /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B; WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B" /inference="Similar to RNA sequence, EST:INSD:DR750890.1,INSD:AV557790.1,INSD:DR750889.1, INSD:AV556647.1" /inference="similar to RNA sequence, mRNA:INSD:AY251400.1" /note="WUSCHEL related homeobox 8 (WOX8); CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: homeobox-3 (TAIR:AT2G33880.1); Has 568 Blast hits to 538 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink)." /codon_start=1 /product="WUSCHEL related homeobox 8" /protein_id="NP_199410.2" /db_xref="GeneID:834638" /db_xref="TAIR:AT5G45980" /db_xref="Araport:AT5G45980" /translation="
MSSSNKNWPSMFKSKPCNNNHHHQHEIDTPSYMHYSNCNLSSSFSSDRIPDPKPRWNPKPEQIRILESIFNSGTINPPREEIQRIRIRLQEYGQIGDANVFYWFQNRKSRAKHKLRVHHKSPKMSKKDKTVIPSTDADHCFGFVNQETGLYPVQNNELVVTEPAGFLFPVHNDPSAAQSAFGFGDFVVPVVTEEGMAFSTVNNGVNLETNENFDKIPAINLYGGDGNGGGNCFPPLTVPLTINQSQEKRDVGLSGGEDVGDNVYPVRMTVFINEMPIEVVSGLFNVKAAFGNDAVLINSFGQPILTDEFGVTYQPLQNGAIYYLI"
misc_feature 192..377 /gene="WOX8" /locus_tag="AT5G45980" /gene_synonym="MCL19.2; MCL19_2; STIMPY-LIKE; STPL; WOX9B; WUSCHEL related homeobox 8; WUSCHEL related homeobox 9B" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" ORIGIN
ctttagctctcgattatcatcattacaccatcatcatgtcctcctcaaacaaaaattggccaagcatgttcaaatccaaaccttgcaacaataatcatcatcatcaacatgaaatcgatactccatcttacatgcactactctaattgcaacctatcatcttccttttcctcagatcggataccagatcctaaaccgagatggaatcctaaaccggagcagattaggatactcgaatcaatcttcaattccggtactattaacccacctagagaggagattcaaagaatccggatccggcttcaagaatatggtcaaatcggtgacgcaaacgtgttttactggtttcaaaaccggaaatctcgagcaaaacacaagcttcgtgttcatcacaaaagccctaaaatgtcaaagaaggacaagacggttattcctagtactgacgctgatcattgttttggttttgttaaccaagaaaccggattatatccggttcaaaacaatgagttggtggtaaccgaaccggccggttttctatttccggttcataatgatccgagcgctgctcaatcagcgtttggttttggcgattttgttgtaccggtggtaacggaagaagggatggcattctctaccgttaataacggcgttaatttggagactaacgaaaattttgataaaattccggcgatcaatttatacggcggagatggaaatggcggtggaaattgttttcctcctttgactgttccattaaccatcaatcaatctcaagaaaaacgagatgtaggattatccggtggtgaagacgtcggagataatgtttatccggtgagaatgacggtgtttattaacgagatgcctatcgaagtagtgtctggattattcaacgttaaggcagctttcggaaacgatgccgttttgatcaactcgtttggccagcctattcttacagatgaatttggtgttacttatcaacctctccaaaatggcgcaatctattatcttatttagaagatattgaaaagcaaatgttatggtgctatggataaatattaatataataataaaagatttctgcgatttatttagttattaattatataagaatttcatttcttatcttttaaatttatgaacaatttacaggac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]