GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 17:23:41, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_123748               3668 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana Stabilizer of iron transporter SufD /
            Polynucleotidyl transferase (AGO10), mRNA.
ACCESSION   NM_123748
VERSION     NM_123748.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 3668)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 3668)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3668)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 3668)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            On Sep 12, 2016 this sequence version replaced NM_123748.2.
FEATURES             Location/Qualifiers
     source          1..3668
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..3668
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="Encodes Argonaute10, a member of the EIF2C
                     (elongation initiation factor 2c)/ Argonaute class of
                     proteins. Required to establish the central-peripheral
                     organization of the embryo apex. Along with WUS and CLV
                     genes, controls the relative organization of central zone
                     and peripheral zone cells in meristems. Acts in embryonic
                     provascular tissue potentiating WUSCHEL function during
                     meristem development in the embryo. AGO10 specifically
                     sequesters miR166/165 to regulate shoot apical meristem
                     development."
                     /db_xref="Araport:AT5G43810"
                     /db_xref="GeneID:834403"
                     /db_xref="TAIR:AT5G43810"
     CDS             357..3323
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /inference="Similar to RNA sequence,
                     EST:INSD:ES045799.1,INSD:ES111318.1,INSD:BE526264.1,
                     INSD:CB260762.1,INSD:EL245660.1,INSD:EL315163.1,
                     INSD:CK118552.1,INSD:BE522978.1,INSD:ES154064.1,
                     INSD:ES130508.1,INSD:EH817621.1,INSD:EL169830.1,
                     INSD:BE522977.1,INSD:ES053360.1,INSD:EH969744.1,
                     INSD:BE522316.1,INSD:ES120186.1,INSD:AV555962.1,
                     INSD:AA597737.1,INSD:CD534067.1,INSD:ES170332.1,
                     INSD:ES138854.1,INSD:EL319200.1,INSD:EL287906.1,
                     INSD:CA781259.1,INSD:BE522302.1,INSD:EL179446.1,
                     INSD:BE523248.1,INSD:AV548910.1,INSD:EL320734.1,
                     INSD:ES029932.1"
                     /inference="similar to RNA sequence, mRNA:INSD:AJ223508.1"
                     /note="ZWILLE (ZLL); CONTAINS InterPro DOMAIN/s: Domain of
                     unknown function DUF1785 (InterPro:IPR014811), Stem cell
                     self-renewal protein Piwi (InterPro:IPR003165),
                     Argonaute/Dicer protein, PAZ (InterPro:IPR003100),
                     Polynucleotidyl transferase, ribonuclease H fold
                     (InterPro:IPR012337); BEST Arabidopsis thaliana protein
                     match is: Stabilizer of iron transporter SufD /
                     Polynucleotidyl transferase (TAIR:AT1G48410.1); Has 1807
                     Blast hits to 1807 proteins in 277 species: Archae - 0;
                     Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
                     Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
                     /codon_start=1
                     /product="Stabilizer of iron transporter SufD /
                     Polynucleotidyl transferase"
                     /protein_id="NP_199194.1"
                     /db_xref="GeneID:834403"
                     /db_xref="TAIR:AT5G43810"
                     /db_xref="Araport:AT5G43810"
                     /translation="
MPIRQMKDSSETHLVIKTQPLKHHNPKTVQNGKIPPPSPSPVTVTTPATVTQSQASSPSPPSKNRSRRRNRGGRKSDQGDVCMRPSSRPRKPPPPSQTTSSAVSVATAGEIVAVNHQMQMGVRKNSNFAPRPGFGTLGTKCIVKANHFLADLPTKDLNQYDVTITPEVSSKSVNRAIIAELVRLYKESDLGRRLPAYDGRKSLYTAGELPFTWKEFSVKIVDEDDGIINGPKRERSYKVAIKFVARANMHHLGEFLAGKRADCPQEAVQILDIVLRELSVKRFCPVGRSFFSPDIKTPQRLGEGLESWCGFYQSIRPTQMGLSLNIDMASAAFIEPLPVIEFVAQLLGKDVLSKPLSDSDRVKIKKGLRGVKVEVTHRANVRRKYRVAGLTTQPTRELMFPVDENCTMKSVIEYFQEMYGFTIQHTHLPCLQVGNQKKASYLPMEACKIVEGQRYTKRLNEKQITALLKVTCQRPRDRENDILRTVQHNAYDQDPYAKEFGMNISEKLASVEARILPAPWLKYHENGKEKDCLPQVGQWNMMNKKMINGMTVSRWACVNFSRSVQENVARGFCNELGQMCEVSGMEFNPEPVIPIYSARPDQVEKALKHVYHTSMNKTKGKELELLLAILPDNNGSLYGDLKRICETELGLISQCCLTKHVFKISKQYLANVSLKINVKMGGRNTVLVDAISCRIPLVSDIPTIIFGADVTHPENGEESSPSIAAVVASQDWPEVTKYAGLVCAQAHRQELIQDLYKTWQDPVRGTVSGGMIRDLLISFRKATGQKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPNYQPPVTFIVVQKRHHTRLFANNHRDKNSTDRSGNILPGTVVDTKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADGIQSLTNNLCYTYARCTRSVSIVPPAYYAHLAAFRARFYLEPEIMQDNGSPGKKNTKTTTVGDVGVKPLPALKENVKRVMFYC"
     misc_feature    747..3320
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    747..1181
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    1212..1361
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    1362..1706
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1509..1511,1554..1556,1587..1589,1599..1601,
                     1653..1655,1674..1676,1680..1682)
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1839..3191
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2268..2270,2280..2282,2316..2327,2334..2336,
                     2358..2360,2367..2369,2379..2381,2391..2393)
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2481..2483,2487..2489,2739..2741,3159..3161)
                     /gene="AGO10"
                     /locus_tag="AT5G43810"
                     /gene_synonym="ARGONAUTE 10; ARGONAUTE PROTEIN 10;
                     MQD19.17; MQD19_17; PINHEAD; PNH; ZLL; ZWILLE"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ggagagagagagaaagaaagcctctttacacgtgatttttaaaagagaccaaaaccccaaaagcaaacctcttttgcatgcgtccttaaaagacataaatttctctcaaaattttctacatcacaaaatcaatctttttctcttcttcttcgtcttcatcatcatcatcatcatcttcctctttctcttcctactgagatattttctccacattgagaggaaagctatcttctctagcgtcactcttcttcttcattggtcggtagaataaggccaaggaagggatcagttttaagttttgtttcattctttttgtagtggagaaaaagagtttttgaaaatccaaacaacaaaaaatgccgattaggcaaatgaaagatagctctgagactcacttagttatcaaaacccaacctttaaagcaccacaatccaaaaaccgttcaaaacggtaaaatccctcctccttctccttctccggtgacggtgactactccggcgacggttactcagagtcaagcttcttcaccttcaccaccgtcaaagaatcgtagccggaggagaaaccgtggtggaagaaaatctgatcaaggagatgtttgtatgagacctagctctcgtcctcgtaaaccgccaccgccaagtcaaaccacttcctccgccgtctccgtcgccaccgccggtgagattgtcgctgtgaatcatcagatgcagatgggtgttcgtaaaaactcaaactttgctccaagacctggatttggaacacttggaactaaatgcattgttaaagctaaccactttctcgctgatttgcctaccaaggatttgaatcagtatgatgttacaattactcctgaagtgtcatcaaagagtgttaacagagctataattgctgagttagttagactttacaaagagtctgatctcgggaggagacttccggcttacgatggccggaaaagtctttacactgctggagaacttccttttacttggaaggagttcagtgttaagattgttgatgaagatgacggtatcatcaatggccctaaaagggagagatcatataaggtggcaatcaagtttgttgcacgggcaaatatgcatcacttaggcgagtttctagctggtaaacgggcagattgtccgcaagaggcggtgcagattcttgatattgtactcagggagttgtcggttaagaggttttgtcccgttggaagatctttcttttcgcctgatattaaaacaccgcagcgactcggtgaagggttagagtcatggtgtgggttttaccagagtattagaccaactcaaatgggtttatcactaaatatcgatatggcttcagctgcattcatcgagcctcttccagtgatagagtttgtagcacagcttcttggaaaggatgtcttgtcgaagccattgtcggattctgatcgcgtcaagattaagaagggtcttagaggagtgaaagtagaggttactcacagagcgaatgtaagaaggaaataccgtgttgcgggtttaacaactcaaccaacaagagagctaatgtttccagtagatgagaactgtactatgaagtcagttattgagtatttccaagagatgtatggattcacgatccagcacacgcatttgccatgtctccaagttggaaaccaaaagaaggcaagctatttgccgatggaggcatgcaaaattgtcgagggacaacggtacacgaaaaggttgaatgagaagcagattactgctctcttgaaagttacatgccaaaggccgagggacagagaaaacgatattttgcggactgtccaacacaacgcatatgatcaagatccatatgcaaaggagtttggcatgaacataagcgaaaagttagcttctgttgaagctcgtattcttccagctccatggcttaagtatcacgagaacgggaaagaaaaagattgtctcccgcaagttggtcagtggaatatgatgaacaagaaaatgatcaacgggatgactgtgagcagatgggcctgtgttaacttctcacgcagcgttcaagaaaacgttgctcgtggattttgtaatgaacttggtcagatgtgtgaagtctcaggcatggagtttaatccagaacccgtgataccaatatatagtgcgaggcccgatcaagtcgagaaagctctaaagcatgtttatcacacttcaatgaacaaaaccaaaggcaaagagttagagcttctgctggcaatattacctgataacaacggttcactttatggtgatcttaagagaatctgtgaaaccgagcttggtttgatatctcaatgttgtctcacaaaacatgtgttcaagattagcaaacagtatctggcaaatgtatcccttaaaatcaacgtaaagatgggaggaaggaacacagttctagtagacgccataagctgtagaataccactggttagcgatataccgacaatcatttttggcgcagacgtgactcacccagagaacggggaagagtcaagcccttcaatcgctgctgttgttgcttctcaagactggcctgaagtgacaaaatatgcgggtttagtttgtgctcaagctcacaggcaagaacttatacaagatttgtataaaacatggcaagatcctgttcgcggtactgttagtggcggtatgatcagggaccttcttatctcatttagaaaagcaacagggcaaaaaccgcttcgaattatcttttatcgtgatggagtaagcgaagggcaattctatcaagttttactctatgagttggatgcaattcgaaaggcttgtgcatcgcttgaaccgaattatcagccaccggtgacattcatagttgtacagaagcgtcaccacactcgtttgtttgctaataatcaccgagacaaaaacagtactgaccgaagcggaaatatcttaccaggtactgtagttgacactaaaatatgtcatccaactgaattcgacttctacctttgtagccatgcgggtattcagggaacaagcaggcctgcacattaccatgttctttgggacgagaacaatttcacagcagatggtattcaatctctgactaacaatctctgttatacctatgcgcggtgcactcggtcggtctctatagttcctccagcgtattatgctcatcttgcagcatttcgagcacgtttctacctggaaccggagataatgcaagacaacggatcaccgggtaaaaagaacacgaaaacaacaactgtcggagacgtaggtgtgaagcctttaccagccttgaaggagaatgtgaagagagtaatgttctactgctaaaaatccaaacattccttaatcagttttaataagtagtttggttgtttgcttgtagttcggctttagatttaccaatgtttttcttatgtaaattttgtcggtttggtttaagcctttaggaattagtgtattagggtttttctaaagttgtactttagctgatgataacgttgatgcagtgactttgttaaaacctcctcttctacagtagtgtttacgtcggttcctcaagctttatttttaaacttacagagtggttagtgtaaatgaaacacttagttctctttgcagtatcgtgggaaaattgtaaatgaaaaacttagccctaaaatttgataaacaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]