GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 16:17:56, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_122111               2628 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana PAZ domain-containing protein / piwi
            domain-containing protein (AT5G21030), partial mRNA.
ACCESSION   NM_122111
VERSION     NM_122111.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 2628)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 2628)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2628)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 2628)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            On Sep 12, 2016 this sequence version replaced NM_122111.2.
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..2628
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            <1..2628
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /db_xref="Araport:AT5G21030"
                     /db_xref="GeneID:832227"
                     /db_xref="TAIR:AT5G21030"
     CDS             1..2553
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="PAZ domain-containing protein / piwi
                     domain-containing protein; FUNCTIONS IN: nucleic acid
                     binding; EXPRESSED IN: egg cell; CONTAINS InterPro
                     DOMAIN/s: Domain of unknown function DUF1785
                     (InterPro:IPR014811), Stem cell self-renewal protein Piwi
                     (InterPro:IPR003165), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Polynucleotidyl transferase,
                     ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis
                     thaliana protein match is: Argonaute family protein
                     (TAIR:AT5G21150.1); Has 1838 Blast hits to 1796 proteins
                     in 202 species: Archae - 2; Bacteria - 0; Metazoa - 963;
                     Fungi - 280; Plants - 458; Viruses - 0; Other Eukaryotes -
                     135 (source: NCBI BLink)."
                     /codon_start=1
                     /product="PAZ domain-containing protein / piwi
                     domain-containing protein"
                     /protein_id="NP_197602.2"
                     /db_xref="GeneID:832227"
                     /db_xref="TAIR:AT5G21030"
                     /db_xref="Araport:AT5G21030"
                     /translation="
MDTTLPPPQHMEREPLKSKSSLLPMTRRGNGSKGQKILLLTNHFRVNFRKPNSHNFFHYSVTITYEDGSPLLAKGFGRKILEKVQQTCQADLGCKHFAYDGDKNLYTVGPLPRSSLDFSVVLETAPSRRNADKRLKLPHQSKKFNVAILFAPPEIPMEAIANALQGKKTKHLLDAIRVMDCILSQNAARQGCLLVRQSFFHNDAKYFANIGEGVDCCKGFHSSFRTTQGGLSLNIDVSTAMIVKPGPVVDFLIANQGVNDPFSINWKKAKNTLKNLRVKVLPSNQEYKITGLSGLHCKDQTFTWKKRNQNREFEEVEITVSDYFTRIREIELRYSGGLPCINVGKPNRPTYFPIELCELVSLQRYTKALTKFQRSNLIKESRQNPQQRIGVLTRALKTSNYNDDPMLQECGVRIGSDFTQVEGRVLPTPKLKAGKEQDIYPINGSWNFKNKPATVTRWAVVNFSARCDPQKIIDDLTRCGKMKGINVDSPYHVVFEENPQFKDATGSVRVDKMFQHLQSILGEVPPKFLLCILEKKNSDVYEKSCSMWNCECIVPPQNLNDQYLTNLLLKINAKLGGLNSVLDMELSGTMPLVMRVPTIIIGMDVSHGSPGQSDHIPSIAAVVSSREWPLISKYRACVRTQSPKVEMIDSLFKPVSDKDDQGIMRELLLDFHSSSGKKPNHIIIFRDGVSESQFNQVLNIELDQMMQINHHTKFFQTESPNNVLPGTIIDSNICHQHNNDFYLCAHAGKIGTTRPTHYHVLYDEIGFDTDQLQELVHSLSYVYQRSTTAISLVAPICYAHLAAAQMATAMKFEDMSETSSSHGGITTAGAVPVPPMPKLNTNVASSMFFC"
     misc_feature    1..2550
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    79..549
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    583..732
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    781..1125
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:280352"
     misc_feature    order(859..861,904..906,958..960,970..972,1027..1029,
                     1048..1050,1054..1056)
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1213..2415
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1621..1623,1627..1629,1654..1662,1669..1671,
                     1687..1689,1696..1698,1708..1710,1720..1722)
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1810..1812,1816..1818,2059..2061,2398..2400)
                     /locus_tag="AT5G21030"
                     /gene_synonym="T10F18.3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atggatacgactctaccgcctcctcaacacatggaacgtgaacctttgaagagcaagagtagtcttcttccaatgactcgccgtggcaacggttccaaaggacagaagattcttctgctcactaaccacttcagagtcaacttcagaaaaccaaacagtcataatttcttccattacagcgttactatcacatatgaagatggtagtccacttttagccaaaggttttggcagaaagattcttgaaaaagttcaacagacttgtcaagctgatttgggttgcaaacattttgcttatgatggcgacaagaatctttatactgttggtcctcttcctagatccagtctagacttctctgttgttcttgaaaccgcgccttctaggagaaacgcagacaaaagactaaagcttcctcaccaatccaagaaattcaatgttgcaatcctttttgcgcctccagaaatcccaatggaagctattgcaaatgctcttcaaggaaagaaaactaaacatcttctagatgctatcagagtgatggactgtattttgagccaaaatgcagctagacaaggttgcctcctagttcggcaatctttcttccacaatgacgcaaagtactttgcgaatatcggtgaaggtgtagattgttgcaaaggatttcattcaagcttcagaactactcagggaggcttgtccctcaatattgatgtttcgactgctatgatagtaaaacctggtcctgttgttgattttcttattgcaaatcaaggtgtgaacgatccattctctattaactggaaaaaggctaaaaatactctgaaaaatcttagagttaaagtcctcccttcaaatcaagaatacaagataaccggactaagtggactacactgcaaagatcaaacgtttacttggaagaaaaggaaccaaaacagggaatttgaggaggttgagattacagtgtccgattacttcactaggatccgtgaaatcgaactgcgttactcgggtggcttaccttgtatcaatgttggtaagccaaatcgtcctacctactttcccattgagctctgtgagcttgtatctctacaacgctatactaaagcgctaaccaaattccagaggagtaaccttatcaaagaatcaaggcagaatccacaacaaagaattggtgtgttaaccagagctctcaagactagtaattataatgatgacccaatgttgcaagaatgtggtgttaggattggctctgacttcactcaagtcgaaggccgcgtgttaccaacaccaaagcttaaagctggcaaagaacaagacatctatcctattaatgggagttggaacttcaagaacaagccagccacagttactagatgggctgttgtgaacttctctgctcgctgtgacccgcaaaagattattgatgatttgaccagatgtggaaagatgaaaggaattaacgtagattctccataccatgtcgtctttgaagaaaatcctcagtttaaggatgccactggttctgtaagagttgataagatgtttcaacatttacaatcaatactcggcgaagttcctccaaaattccttctatgcatactcgaaaagaaaaactctgatgtttatgaaaaatcttgttcaatgtggaattgtgaatgtattgttcctcctcaaaacttaaatgatcagtatctcacaaatcttctactaaagataaatgccaagcttggtggattgaattcagttttggatatggagctgtcaggaacaatgcctctggtaatgagagttcctaccatcattattggaatggatgtatctcatggttctcctggacagtctgatcatataccatccattgccgcggttgtgagctccagagagtggccactgatctcaaaatacagggcttgtgtgcgtacacagtcgcctaaagttgaaatgatcgatagcctctttaaacccgtctctgacaaagatgatcaaggtatcatgagagagctcttgcttgactttcactcaagttctggaaagaaaccgaatcacattatcattttcagggatggtgtcagtgaatctcagtttaaccaagttcttaatattgaactggatcagatgatgcaaataaaccaccacacgaagttcttccaaaccgaaagccctaataatgttcttccaggaacaataattgacagcaacatctgtcaccaacacaacaacgatttctatctttgtgctcatgctggaaagattggaactacaaggccaacacattaccatgtgctctacgacgagattggatttgacacagatcaactccaagaacttgtgcattcactatcctatgtctaccagcggagcacaactgccatctctcttgttgcgccgatatgttatgctcatttggcggctgcacagatggcaactgcaatgaagtttgaggacatgtctgagacttcatcgagccacggcgggatcaccacagctggagcagtccctgtgcctcccatgccgaagctgaacaccaacgttgctagttcaatgttcttttgctgaaagaacaaaaataagcacaagtgacttggcttttcttctaatgaacaaaccaaataacaagattgtttctctcgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]