GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 18:27:05, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_105611               3443 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana Argonaute family protein (AGO7), mRNA.
ACCESSION   NM_105611
VERSION     NM_105611.5
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 3443)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 3443)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3443)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 3443)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 3443)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            On Sep 12, 2016 this sequence version replaced NM_105611.4.
FEATURES             Location/Qualifiers
     source          1..3443
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            1..3443
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="Encodes ARGONAUTE7, a member of the ARGONAUTE
                     family, characterised by the presence of PAZ and PIWI
                     domains. Involved in the regulation of developmental
                     timing. Required for the accumulation of TAS3 ta-siRNAs
                     but not for accumulation of miR171, miR173, miR390 or
                     mi391. Localized in mature rosette leaves and floral
                     buds."
                     /db_xref="Araport:AT1G69440"
                     /db_xref="GeneID:843276"
                     /db_xref="TAIR:AT1G69440"
     CDS             313..3285
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /inference="Similar to RNA sequence,
                     EST:INSD:ES195631.1,INSD:ES164500.1,INSD:ES212862.1,
                     INSD:Z34562.1,INSD:ES008820.1,INSD:Z34563.1"
                     /note="ARGONAUTE7 (AGO7); FUNCTIONS IN: nucleic acid
                     binding; INVOLVED IN: production of ta-siRNAs involved in
                     RNA interference, vegetative phase change, production of
                     lsiRNA involved in RNA interference, regulation of
                     development, heterochronic, gene silencing by miRNA;
                     LOCATED IN: cellular_component unknown; EXPRESSED IN: 18
                     plant structures; EXPRESSED DURING: 11 growth stages;
                     CONTAINS InterPro DOMAIN/s: Domain of unknown function
                     DUF1785 (InterPro:IPR014811), Stem cell self-renewal
                     protein Piwi (InterPro:IPR003165), Argonaute/Dicer
                     protein, PAZ (InterPro:IPR003100), Polynucleotidyl
                     transferase, ribonuclease H fold (InterPro:IPR012337);
                     BEST Arabidopsis thaliana protein match is: Stabilizer of
                     iron transporter SufD / Polynucleotidyl transferase
                     (TAIR:AT1G48410.1); Has 2067 Blast hits to 2008 proteins
                     in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1082;
                     Fungi - 299; Plants - 502; Viruses - 5; Other Eukaryotes -
                     179 (source: NCBI BLink)."
                     /codon_start=1
                     /product="Argonaute family protein"
                     /protein_id="NP_177103.1"
                     /db_xref="Araport:AT1G69440"
                     /db_xref="GeneID:843276"
                     /db_xref="TAIR:AT1G69440"
                     /translation="
MEEKTHHHHHSTNKHIPSSKSRTPLLHKPYHHHVQTNPPPFLLHPSSHQNLNLVASNLPSSYYYYYYCYFYSQFHNSLPPPPPPHLLPLSPPLPPLLPLPPPHSMTRFHKSLPVSQVVERKQQHQQKKKIQVSNNKVSGSIAIEEAALVVAKRPDFGGQDGSVIYLLANHFLVKFDSSQRIYHYNVEISPQPSKEIARMIKQKLVETDRNSFSGVVPAFDGRQNIYSPVEFQGDRLEFFVNLPIPSCKAVMNYGDLREKQPQKKIEKLFRVNMKLVSKFDGKEQRKEGEDWAPLPPEYIHALDVILRENPMEKCTSIGRSFYSSSMGGSKEIGGGAVGLRGFFQSLRHTQQGLALNMDLSITAFHESIGVIAYLQKRLEFLTDLPRNKGRELSLEEKREVEKALKNIRVFVCHRETVQRYRVYGLTEEITENIWFPDREGKYLRLMSYFKDHYGYEIQFKNLPCLQISRARPCYLPMELCMICEGQKFLGKLSDDQAAKIMKMGCQKPNERKAIIDKVMTGSVGPSSGNQTREFNLEVSREMTLLKGRILQPPKLKLDRPRNLKESKVFKGTRIERWALMSIGGSSDQKSTIPKFINELTQKCEHLGVFLSKNTLSSTFFEPSHILNNISLLESKLKEIQRAASNNLQLIICVMEKKHKGYGDLKRISETRIGVVTQCCLYPNITKLSSQFVSNLALKINAKIGGSMTELYNSIPSHIPRLLRPDEPVIFMGADVTHPHPFDDCSPSVAAVVGSINWPEANRYVSRMRSQTHRQEIIQDLDLMVKELLDDFYKAVKKLPNRIIFFRDGVSETQFKKVLQEELQSIKTACSKFQDYNPSITFAVVQKRHHTRLFRCDPDHENIPPGTVVDTVITHPKEFDFYLCSHLGVKGTSRPTHYHILWDENEFTSDELQRLVYNLCYTFVRCTKPISIVPPAYYAHLAAYRGRLYIERSSESNGGSMNPSSVSRVGPPKTIPLPKLSDNVKNLMFYC"
     misc_feature    769..1230
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    784..3282
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    1261..1410
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    1498..1797
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:280352"
     misc_feature    order(1570..1572,1615..1617,1645..1647,1657..1659,
                     1711..1713,1729..1731,1735..1737)
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1906..3159
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2293..2295,2305..2307,2341..2352,2359..2361,
                     2383..2385,2392..2394,2404..2406,2416..2418)
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2512..2514,2518..2520,2731..2733,3127..3129)
                     /gene="AGO7"
                     /locus_tag="AT1G69440"
                     /gene_synonym="ARGONAUTE7; F10D13.11; F10D13_11; ZIP;
                     ZIPPY"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
catttataggcctattttcttttattattgccaacaattaaagcttatttatgacagcataaataacatcatttcattattttgggggcagaaaaataaaataaaacaaaaggaaggggactttgacctttccctgaccaaaaactcagacaatccctttctgcctcttttatctctctctctcataaacccacactctcttcttcttcttcttcttcttcttcttcttctctctctctttcttctgcttttccaaagctttccaaagccaacaaaggtctctctctgtagctccttttcctctcagcagccatggaagaaaaaactcatcatcatcatcacagtaccaacaaacacatccctagttccaaatcaagaacacctcttctccacaagccttatcatcaccatgttcaaaccaatcctcctccttttcttttgcacccttcttctcaccaaaacctcaatcttgttgcctcaaatcttccttctagctactactactattactactgctacttctactctcaatttcacaactctcttcctcctcctcctcctcctcatcttcttcctctttctcctcctcttcctcctttacttcctcttcctcctcctcactcaatgacccgtttccacaaatctctccctgtttctcaagttgtggagagaaagcagcaacaccaacagaagaagaagatacaagtttctaacaacaaagtgagtggatccatagcaatagaagaagcagcattagtggttgctaaaagaccggactttggtggtcaagatggttctgtcatttatctcctcgccaaccattttcttgtcaagtttgattcgtcacagaggatttaccattacaatgttgagatatctccacagccttcaaaggaaattgctagaatgatcaaacagaagcttgttgagacagatcgtaatagcttctctggtgttgttccggcttttgacggcaggcaaaacatttacagccctgtggagtttcagggagataggcttgagttctttgttaatctccctatcccatcttgcaaggctgtgatgaattacggtgacttgcgtgagaagcaacctcagaagaagattgagaaactgtttagggttaatatgaagcttgtgtccaagtttgatggtaaagaacagagaaaggaaggagaggattgggctcctctgcctccagaatacattcatgctcttgatgttatcttgagagagaatccaatggagaagtgtacatcgatcggaagatcgttttactcgagttctatgggtggatctaaggagattggaggaggagctgttggactcagagggtttttccagagtcttagacatactcagcaaggtttagcacttaacatggatctctcaatcacagctttccatgaaagtattggagtaatagcttacttgcagaagcggctcgagtttcttacggaccttcctaggaacaaaggtagagaattgagtttagaggaaaagagagaagtggagaaagcacttaagaacataagagtctttgtttgccatagagaaacagttcaaaggtatcgagtttatgggttaacagaggaaattacggagaatatatggtttcctgatagagaagggaaatatctaaggcttatgagttacttcaaagatcattatggttatgagattcagttcaagaacttgccgtgtctgcaaatcagtagggcaagaccttgttaccttcctatggagctatgcatgatttgtgaaggtcaaaagtttcttggaaagctatcagatgatcaagctgcaaagatcatgaaaatgggctgccaaaaacctaatgaaaggaaagctattattgataaggttatgacaggatcggtcggtccatcgagcggaaaccaaacaagagaattcaaccttgaggtttcaagagaaatgacattgctgaaaggaagaatacttcagccaccaaagcttaaacttgaccggccaaggaaccttaaagaaagtaaagtttttaaaggaactagaattgagagatgggctttgatgagtattggaggcagctctgatcagaaatctaccattcccaagttcataaacgagcttactcaaaagtgtgagcatttgggagtcttcttaagcaagaacacattaagcagtaccttctttgaaccatcacacatactcaacaacatttcgcttctcgaatcaaaactgaaggagattcaaagagcggcatcgaacaatctccagctgattatttgtgtaatggagaaaaaacataaagggtacggagatctaaagaggatatcagagacaagaattggtgttgtgacacaatgctgcttataccctaacatcactaagctcagttctcagttcgtttcgaacttagctctcaagataaacgccaagatcggtggatccatgaccgagctctacaactcgataccttctcacatccctagactgcttagacccgatgagccggttatcttcatgggagctgatgtaacgcatcctcatccattcgatgattgtagcccttcagtagcggctgtggtagggagcataaactggccagaagctaaccgatacgtctcaagaatgaggtctcagactcataggcaagagatcatacaagatcttgacttgatggtcaaggaacttcttgatgatttttacaaagcggtaaaaaagcttccgaatcgaatcatattcttcagggacggtgttagcgagacacagttcaagaaagttctccaagaagagcttcaatcgataaaaactgcttgttcgaagttccaagattacaatccaagcatcacattcgccgtggttcagaaaagacaccacacaaggctgttccggtgcgatccagaccatgagaacatacctcctggtacagtggttgatacagtgataactcatccgaaagagtttgatttttatctctgtagccatttaggagtgaagggcacgagcaggccaacgcattaccatattctatgggacgagaacgagttcacttcagacgaattgcagagacttgtgtataatttgtgttacactttcgtgaggtgcacgaaacctatatcgattgtgccaccggcttattatgctcaccttgctgcgtacagaggaaggctatacatcgagagatcatctgaatctaatggaggatccatgaatccttcttctgtgtctcgtgttggtcctccaaagacgattcctcttcctaaattaagtgataatgtcaagaatctcatgttttactgctgattctttaatatataaaaaaattgatcttgatactgttatctttataggttccaatgacaaattcatcacatattatcataagtactaccaaagccaattattgaacctagaaagtccaagccagtgagtttttattgtatttttctgtaattcataat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]