GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 16:38:21, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_103737               3531 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana Stabilizer of iron transporter SufD /
            Polynucleotidyl transferase (AGO1), mRNA.
ACCESSION   NM_103737
VERSION     NM_103737.4
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 3531)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 3531)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3531)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 3531)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 3531)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            On Sep 12, 2016 this sequence version replaced NM_103737.3.
FEATURES             Location/Qualifiers
     source          1..3531
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            1..3531
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="Encodes an RNA Slicer that selectively recruits
                     microRNAs and siRNAs. There is currently no evidence that
                     AGO1 Slicer is in a high molecular weight RNA-induced
                     silencing complex (RISC). Mutants are defective in
                     post-transcriptional gene silencing and have pleiotropic
                     developmental and morphological defects. Through its
                     action on the regulation of ARF17 expression, the protein
                     regulates genes involved at the cross talk between auxin
                     and light signaling during adventitious root development.
                     AGO1 seems to be targeted for degradation by silencing
                     suppressor F-box-containing proteins from Turnip yellow
                     virus and Cucurbit aphid-borne yellow virus."
                     /db_xref="Araport:AT1G48410"
                     /db_xref="GeneID:841262"
                     /db_xref="TAIR:AT1G48410"
     CDS             183..3329
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EL278924.1,INSD:ES018921.1,INSD:EG482202.1,
                     INSD:EL984280.1,INSD:BE523184.1,INSD:ES014337.1,
                     INSD:ES007162.1,INSD:EL097016.1,INSD:AV534003.1,
                     INSD:AV529834.1,INSD:AV792863.1,INSD:BP802141.1,
                     INSD:EH902668.1,INSD:ES164270.1,INSD:EG444790.1,
                     INSD:BP805355.1,INSD:EL983185.1,INSD:CK121100.1,
                     INSD:BP619936.1,INSD:BP782965.1,INSD:BP599876.1,
                     INSD:ES000015.1,INSD:BP650907.1,INSD:AV560716.1,
                     INSD:BE521779.1,INSD:EL140108.1,INSD:AV825907.1,
                     INSD:ES145208.1,INSD:EL978323.1,INSD:BP778517.1,
                     INSD:EL992465.1,INSD:ES012574.1,INSD:AV442417.1,
                     INSD:BE522317.1,INSD:AV547483.1,INSD:BP795190.1,
                     INSD:AV545970.1,INSD:DR358384.1,INSD:AV547579.1,
                     INSD:EL974997.1,INSD:ES187778.1,INSD:BP618364.1,
                     INSD:BP821084.1,INSD:AV546614.1,INSD:BP637165.1,
                     INSD:BP780450.1,INSD:ES027183.1,INSD:BE526469.1,
                     INSD:ES098990.1,INSD:ES121377.1,INSD:AV548172.1,
                     INSD:BP809751.1,INSD:AV789090.1,INSD:DR231030.1,
                     INSD:ES203260.1,INSD:BP818491.1,INSD:AV532952.1,
                     INSD:AV547340.1,INSD:DR231028.1,INSD:BE520592.1,
                     INSD:ES068711.1,INSD:AV813765.1,INSD:BE520591.1,
                     INSD:BP611041.1,INSD:EL979901.1,INSD:ES135762.1,
                     INSD:EL990266.1,INSD:BP853328.1,INSD:BP863976.1,
                     INSD:EG482203.1,INSD:BP657306.1,INSD:DR275828.1,
                     INSD:EL968153.1,INSD:AV548086.1,INSD:DR378754.1,
                     INSD:EG444787.1,INSD:EL079537.1,INSD:ES159373.1,
                     INSD:AU235788.1,INSD:BP620405.1,INSD:DR231029.1,
                     INSD:BP805710.1,INSD:AV554842.1,INSD:BP823102.1,
                     INSD:BP837553.1,INSD:DR275827.1,INSD:AV546856.1,
                     INSD:ES216018.1,INSD:BP654109.1,INSD:BE524288.1,
                     INSD:ES105762.1,INSD:EL986984.1,INSD:AV441187.1,
                     INSD:AV547477.1,INSD:BP804459.1,INSD:ES037987.1,
                     INSD:AV563657.1,INSD:BP640077.1,INSD:AV529559.1,
                     INSD:AV522776.1,INSD:BP782038.1,INSD:AV528296.1,
                     INSD:EL259775.1,INSD:EL993546.1,INSD:ES155368.1,
                     INSD:EL986594.1,INSD:AI993691.1,INSD:AV523806.1,
                     INSD:ES098152.1,INSD:BP803249.1,INSD:BP806924.1,
                     INSD:ES216225.1,INSD:ES019192.1,INSD:EG527340.1,
                     INSD:AA651494.1,INSD:BE528432.1,INSD:N65911.1,
                     INSD:BP617474.1,INSD:EL981380.1,INSD:BP601377.1,
                     INSD:ES002718.1,INSD:BP658160.1,INSD:BE522318.1,
                     INSD:AV523959.1,INSD:ES034147.1,INSD:BE520537.1,
                     INSD:ES009225.1,INSD:AA720232.1,INSD:BP836412.1,
                     INSD:EG527339.1,INSD:EL977092.1,INSD:BE529510.1,
                     INSD:BP575189.1,INSD:DR236108.1,INSD:EL971994.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:BT000941.1,INSD:U91995.1"
                     /note="ARGONAUTE 1 (AGO1); FUNCTIONS IN: protein binding,
                     endoribonuclease activity, siRNA binding, miRNA binding;
                     INVOLVED IN: in 11 processes; LOCATED IN: cytosol,
                     nucleus, cytoplasm; EXPRESSED IN: 25 plant structures;
                     EXPRESSED DURING: 13 growth stages; CONTAINS InterPro
                     DOMAIN/s: Domain of unknown function DUF1785
                     (InterPro:IPR014811), Stem cell self-renewal protein Piwi
                     (InterPro:IPR003165), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Polynucleotidyl transferase,
                     ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis
                     thaliana protein match is: Stabilizer of iron transporter
                     SufD / Polynucleotidyl transferase (TAIR:AT5G43810.2); Has
                     29249 Blast hits to 15917 proteins in 1190 species: Archae
                     - 22; Bacteria - 5845; Metazoa - 12576; Fungi - 2412;
                     Plants - 4639; Viruses - 404; Other Eukaryotes - 3351
                     (source: NCBI BLink)."
                     /codon_start=1
                     /product="Stabilizer of iron transporter SufD /
                     Polynucleotidyl transferase"
                     /protein_id="NP_175274.1"
                     /db_xref="Araport:AT1G48410"
                     /db_xref="GeneID:841262"
                     /db_xref="TAIR:AT1G48410"
                     /translation="
MVRKRRTDAPSEGGEGSGSREAGPVSGGGRGSQRGGFQQGGGQHQGGRGYTPQPQQGGRGGRGYGQPPQQQQQYGGPQEYQGRGRGGPPHQGGRGGYGGGRGGGPSSGPPQRQSVPELHQATSPTYQAVSSQPTLSEVSPTQVPEPTVLAQQFEQLSVEQGAPSQAIQPIPSSSKAFKFPMRPGKGQSGKRCIVKANHFFAELPDKDLHHYDVTITPEVTSRGVNRAVMKQLVDNYRDSHLGSRLPAYDGRKSLYTAGPLPFNSKEFRINLLDEEVGAGGQRREREFKVVIKLVARADLHHLGMFLEGKQSDAPQEALQVLDIVLRELPTSRYIPVGRSFYSPDIGKKQSLGDGLESWRGFYQSIRPTQMGLSLNIDMSSTAFIEANPVIQFVCDLLNRDISSRPLSDADRVKIKKALRGVKVEVTHRGNMRRKYRISGLTAVATRELTFPVDERNTQKSVVEYFHETYGFRIQHTQLPCLQVGNSNRPNYLPMEVCKIVEGQRYSKRLNERQITALLKVTCQRPIDREKDILQTVQLNDYAKDNYAQEFGIKISTSLASVEARILPPPWLKYHESGREGTCLPQVGQWNMMNKKMINGGTVNNWICINFSRQVQDNLARTFCQELAQMCYVSGMAFNPEPVLPPVSARPEQVEKVLKTRYHDATSKLSQGKEIDLLIVILPDNNGSLYGDLKRICETELGIVSQCCLTKHVFKMSKQYMANVALKINVKVGGRNTVLVDALSRRIPLVSDRPTIIFGADVTHPHPGEDSSPSIAAVVASQDWPEITKYAGLVCAQAHRQELIQDLFKEWKDPQKGVVTGGMIKELLIAFRRSTGHKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEAGYQPPVTFVVVQKRHHTRLFAQNHNDRHSVDRSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADGLQSLTNNLCYTYARCTRSVSIVPPAYYAHLAAFRARFYMEPETSDSGSMASGSMARGGGMAGRSTRGPNVNAAVRPLPALKENVKRVMFYC"
     misc_feature    417..698
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="Glycine-rich region of argonaut; Region:
                     Gly-rich_Ago1; pfam12764"
                     /db_xref="CDD:289530"
     misc_feature    669..3326
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    726..1157
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    1188..1337
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    1344..1682
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1485..1487,1530..1532,1563..1565,1575..1577,
                     1629..1631,1650..1652,1656..1658)
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1815..3170
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2247..2249,2259..2261,2295..2306,2313..2315,
                     2337..2339,2346..2348,2358..2360,2370..2372)
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2460..2462,2466..2468,2718..2720,3138..3140)
                     /gene="AGO1"
                     /locus_tag="AT1G48410"
                     /gene_synonym="ARGONAUTE 1; AtAGO1; ICU9; T1N15.2;
                     T1N15_2"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atttaaagtgtagcagtaaaatctcatttctttgagttatctcgtttgttcggagttagagagagagagaaagatatagagagaacacagagaggcgagagcgacgtagggttggtgtttcgtacggattttctcggtcaatcttagtttctccggcgagagattgcttttcaggaatcatcatggtgagaaagagaagaacggatgctccatctgaaggaggtgaaggctctgggtctcgtgaagctggtccagtctcaggtggtggacgtggttcacagcgaggtggtttccagcagggaggaggacaacaccaaggtggaaggggttatactcctcaacctcaacagggaggtcgtggtggtcgtggatatgggcaaccaccacaacagcaacaacagtatggaggaccacaagagtaccaaggaagaggaagaggaggacctcctcatcaaggaggtcgaggagggtatggcggtggccgtggaggtggaccttcttctggaccaccgcagagacaatcagttcccgagctgcatcaagctacctcacctacttatcaagcggtgtcttctcagcctacactgtctgaggtgagtcctacccaggtaccagaacctactgttctggctcagcaatttgaacaactctctgttgaacaaggagctcccagtcaggcaatccagcctataccttcttctagcaaggctttcaagtttccaatgaggcctggtaaaggacagagtggaaagcgttgcattgtgaaggctaaccatttctttgctgaactgcctgataaggatttgcaccattatgatgttaccattactccggaagttacatcaaggggtgtcaatcgtgctgtgatgaaacaacttgttgataattatcgtgattctcaccttggaagtcgtcttccagcgtatgatggtcgaaaaagtctttacactgctggtccacttccctttaactccaaggagttcagaatcaatcttcttgacgaagaagtaggggctggaggtcaaagacgagaaagggaatttaaagttgtgatcaagctagttgcacgtgctgatctgcatcacctaggaatgtttttggaggggaaacaatcagatgccccacaggaagctctgcaggttcttgacattgttcttcgtgagctgccgacctctaggtatattccggtgggccggtccttttattcccctgatataggaaaaaaacaatcattgggggatggcttggagagctggcgtggattctaccaaagcattcgtcctacacagatgggcttatcactcaatattgatatgtcatcgacagccttcatagaggcaaaccctgtgattcagtttgtctgtgatttgcttaaccgggatatttcttctcgacctttatctgatgctgatcgtgttaagataaaaaaggctcttagaggtgtcaaagttgaagtgactcatcgaggaaacatgcgccggaagtaccgcatttccggtttgactgctgtggccactcgggaattgacattcccagtagatgaaagaaatactcagaaatctgttgtagaatacttccacgaaacatatggttttcgcattcagcacactcaactaccatgcttgcaagttgggaattctaataggcctaattacttaccaatggaggtatgcaagattgttgaaggccagcggtattccaaaagattgaatgagagacagatcactgctttgctgaaggttacctgtcagcgcccgatagatcgagaaaaagatatcttacagacggtgcaactcaatgattatgctaaagataattatgctcaagagtttggcatcaaaataagtacttctctggcttctgttgaggctcgtatactgcctcctccatggcttaagtaccacgagtctggaagggaagggacttgtctgccacaagttggtcaatggaacatgatgaataagaaaatgatcaatggtggaacggtgaataattggatctgcatcaacttttctaggcaagtgcaggacaatctagcgcgtacattttgtcaggaacttgctcaaatgtgttacgtatctggcatggcatttaatccggaaccagtcctcccaccagtcagtgctcgccctgagcaagtagagaaggtcttgaagactagatatcatgatgccacatcaaaactctcccaaggaaaagaaattgatctgcttattgtcattctgcccgataataatggatcattatacggtgatttgaaacgcatatgtgagactgaactcggcatagtctctcaatgttgcctgacaaagcatgtctttaagatgagcaaacaatacatggctaatgttgcgctgaagattaatgtgaaggttggaggaagaaacacagtgcttgttgatgctctatctaggcggattcctctagtcagtgatcgacccaccattatatttggtgctgatgttacccaccctcaccctggagaggattcaagcccatctattgctgctgttgtggcatctcaggattggcctgaaatcactaaatatgctggattagtttgcgctcaagcgcataggcaggagctcattcaggatctgttcaaagagtggaaggatcctcagaaaggtgtggtgactggtggcatgataaaggagttgctcatagccttccgtagatcaactgggcataaaccactaaggatcatcttctacagggatggagtcagtgagggacaattttaccaagttttgctctatgaacttgatgccatccgcaaggcctgtgcttcgctggaagcaggttatcaaccaccagtgacatttgtggtggtgcagaagcgtcatcacacgaggctgtttgctcagaaccacaatgatcgccattcggtggacagaagtgggaatattttacctggcactgttgtggactctaaaatctgccaccctacagagtttgacttttacctctgtagtcatgctggtattcagggcacttctcgacctgctcattaccacgttctttgggatgagaacaactttactgcagatggacttcaatctctgaccaataacttatgttacacgtatgcaagatgcacacgctcagtttcaattgttccccctgcatattatgcacatctagcagcttttagggctcgattctacatggagccagagacatcagacagtggctcaatggctagtgggagcatggcacgtggaggtggaatggctggtagaagcacacgcgggcctaatgtcaatgctgcagtgaggccactcccagctctgaaagagaatgtgaagcgtgtcatgttctactgctgagttgattcaccctctatctatctttatgacctaaattaatgaagaatatcatgtatgctttctaagacttatcgtgtgtttggatatttcatcactctttctctatgagtatgagatgctttatgactcttgtttgacaactactaaaatttattattcaaaacagactttgatcctttctttaactcgtcttaaatcttta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]