GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 16:41:02, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_102867               3841 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana ARGONAUTE 3 (AGO3), partial mRNA.
ACCESSION   NM_102867
VERSION     NM_102867.2
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 3841)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 3841)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3841)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 3841)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 3841)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            On Sep 12, 2016 this sequence version replaced NM_102867.1.
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..3841
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            <1..3841
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /db_xref="Araport:AT1G31290"
                     /db_xref="GeneID:840017"
                     /db_xref="TAIR:AT1G31290"
     CDS             1..3585
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EH966969.1,INSD:CB254213.1,INSD:CB255454.1,
                     INSD:EH864619.1,INSD:CB254238.1,INSD:CB254685.1,
                     INSD:ES183387.1,INSD:EL252698.1,INSD:CB255149.1"
                     /note="ARGONAUTE 3 (AGO3); FUNCTIONS IN: nucleic acid
                     binding; INVOLVED IN: biological_process unknown; LOCATED
                     IN: cellular_component unknown; EXPRESSED IN: 11 plant
                     structures; EXPRESSED DURING: LP.06 six leaves visible,
                     LP.04 four leaves visible, 4 anthesis, C globular stage,
                     petal differentiation and expansion stage; CONTAINS
                     InterPro DOMAIN/s: Domain of unknown function DUF1785
                     (InterPro:IPR014811), Stem cell self-renewal protein Piwi
                     (InterPro:IPR003165), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Polynucleotidyl transferase,
                     ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis
                     thaliana protein match is: Argonaute family protein
                     (TAIR:AT1G31280.1); Has 87664 Blast hits to 32385 proteins
                     in 1910 species: Archae - 110; Bacteria - 26465; Metazoa -
                     27622; Fungi - 6311; Plants - 10699; Viruses - 1201; Other
                     Eukaryotes - 15256 (source: NCBI BLink)."
                     /codon_start=1
                     /product="ARGONAUTE 3"
                     /protein_id="NP_174414.1"
                     /db_xref="Araport:AT1G31290"
                     /db_xref="GeneID:840017"
                     /db_xref="TAIR:AT1G31290"
                     /translation="
MDRGGYRGGRGDGRGRGGGGDRGRGYSGRGDGRGRGGDGDRGYSGRGDGHGRGGGGDRGRGYSGRGDGRGRGGGGDRGRGYSGRGDGHGRGGGGDRGRGYSGRGRGFVQDRDGGWVNPGQSSGGHVRGRGTQLQQPPPQEVPPSSSQAQVSQGVAPGDVGQGGVGDVGRDGVGDVGRDGVGDVGQGGVGDVGQVGVGDVGQGGVGDVGQGGVGDVGRDGVGDVGRDGVGDVGRGGVGDRGQSQSGLSSGHFGRGTQLQQPQPQAVSQSSSQGQVSQSFATGGVGLGAWARKPQLFSDSTVLPSSSSSNVVASHTASGSQVMTPKPSSSDKKEPVKRPDKGGNIKVKGVINLSVNHFRVSFSTESVIRHYDVDIKGENSSKKISRFELAMVKEKLFKDNNDFPNAMTAYDGQKNIFSAVELPTGSFKVDFSETEEIMRGRSYTFIIKQVKELKLLDLQAYIDGRSTFIPRDVLQGMDVVMKEHPSKRMITVGKRFFSTRLEIDFGYGVGAAKGFHHTLKPTVQGLSLCLNSSLLAFRKAISVIEYLKLYFGWRNIRQFKNCRPDDVVQELIGLKVTVDHRKTKQKFIIMGLSKDDTKDIKFDFIDHAGNQPPRKISIVEYFKEKYGRDIDHKDIPCLNLGKKGRENFVPMEFCNLVEGQIFPKEKLYRDSAAWLKELSLVTPQQRLENINKMIKSSDGPRGGDIIGNFGLRVDPNMTTVEGRVLEAPTLKLTDRRGNPIHEKLMSESNQWNLTTKGVTKGSIIKHWAVLDFTASESLKKKMPGYFVNKLIERCKGLGMQMEAPIVCKTSSMETLYDGNALEELLRSVIDEASHNHGGACPTLVLCAMTGKHDGYKTLKWIAETKLGLVTQCFLTISAIKGETVSDQYLANLALKINAKVGGTNVELVDNIFSFFKKEDKVMFIGADVNHPAAHDNMSPSIVAVVGTLNWPEANRYAARVKAQSHRKEEIQGFGETCWELIEAHSQAPEKRPNKIVIFRDGVSDGQFDMVLNVELQNVKDVFAKVGYNPQITVIVAQKRHQTRFFPATTSKDGRAKGNVPSGTVVDTTIIHPFEYDFYLCSQHGAIGTSKPTHYYVLSDEIGFNSNQIQKLIFDLCFTFTRCTKPVALVPPVSYADKAASRGRVYYEASLMKKNSKQSRGASSSSASVASSSSSVTMEDKEIFKVHAGIENFMFFV"
     misc_feature    952..3414
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    1006..1437
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    1678..1989
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:280352"
     misc_feature    order(1753..1755,1798..1800,1846..1848,1858..1860,
                     1912..1914,1933..1935,1939..1941)
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    2107..3432
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2557..2559,2569..2571,2605..2616,2623..2625,
                     2656..2658,2665..2667,2677..2679,2689..2691)
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2773..2775,2779..2781,2992..2994,3400..3402)
                     /gene="AGO3"
                     /locus_tag="AT1G31290"
                     /gene_synonym="ARGONAUTE 3; T19E23.8; T19E23_8"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atggatcgaggtggttaccgaggaggtcgtggtgatggccgtggcagaggcggcggcggagatcgtggtcgtggttacagcggtcgtggtgatggccgtggcagaggcggcgacggagatcgtggttacagcggtcgtggtgatggccatggcagaggcggcggcggagatcgtggtcgtggttacagcggtcgtggtgatggccgtggcagaggcggcggcggagatcgtggtcgtggttacagcggtcgtggtgatggccatggcagaggcggcggcggagatcgtggtcgtggttacagcggtcgtggtcgtggctttgttcaagatagggatggtggttgggtaaatccagggcaaagttcaggtggtcatgttcgtggtcgtgggacgcagttgcaacaacctccgccacaggaagttcctccgtcgtcgtcgcaagctcaagtgagtcaaggcgttgcaccaggagacgtgggtcaaggcggcgtcggagacgtgggtagagacggcgtcggagacgtgggtagagacggcgtcggagacgtgggtcaaggtggcgtcggagacgtgggtcaagtaggcgtcggagacgtgggtcaaggcggcgtcggagacgtgggtcaaggcggcgtcggagacgtgggtagagacggcgtcggagacgtgggtagagacggcgtcggagacgtgggtagaggcggcgtcggagaccgtggacagagtcagtcgggactatcgtcgggtcactttggtcgtgggacgcagttgcaacaacctcagccacaggcggtttctcagtcgtcttcgcagggtcaagtgagtcaatcctttgcaacaggaggcgtgggtttaggcgcgtgggctcgtaagcctcaacttttctctgattcgacggtcttaccttctagttcttcgtctaacgtcgttgcttctcacaccgctagtggttctcaagttatgactccgaaaccatcttcttctgataagaaagaaccagtaaagcgtcctgataaaggtggtaatataaaagtgaaaggcgtaattaatctctccgtcaatcattttagagtgagtttctcaacagaaagtgtcataaggcactacgatgttgatatcaaaggagaaaattcttcaaaaaagatatcaagatttgagctagctatggtcaaagaaaagctgttcaaggacaataatgactttcctaacgccatgacagcgtacgatggtcagaagaacattttcagcgctgttgaattacctacgggatcatttaaagttgatttctcagaaaccgaggagatcatgagaggtagaagctatacgttcatcatcaaacaagtgaaagagctaaagttacttgacttgcaagcctacatagatggacgttccacttttattccgcgtgatgtgttgcaaggaatggatgttgtgatgaaggaacatccttcaaaacgtatgatcactgttggtaaaagattctttagtactcggctagagattgactttggatacggagttggagctgcgaaagggtttcaccacactctcaagcccacagtacaaggtttatcattatgtttgaactcctctttgttggcgttccgcaaagcaatttcagtcatcgaatacctgaagttgtactttgggtggagaaatatacgtcagtttaagaattgtaggcctgatgacgtggtacaagaattgattggtttgaaagtcactgttgatcatcgaaagaccaaacagaaattcatcattatggggttgagtaaggacgacacaaaagatatcaaattcgattttattgatcatgctggaaaccagcctccaaggaaaatatccattgttgagtatttcaaggaaaagtatggaagagacattgatcacaaggatattccttgcttgaatttggggaaaaagggtcgggaaaattttgtacccatggagttctgtaacttagtcgaggggcagatttttccaaaagagaaattgtatagagattcagccgcgtggttaaaggagctttcactagtcactccacaacaaagactggagaatataaataagatgataaagtctagtgatggacctagaggtggagatatcattggaaacttcggattgagagtggatccaaacatgacaacggtggaaggtcgtgtactcgaggctcctacactgaaattgactgatcggagaggcaatcctatccatgagaaactcatgagcgagagcaatcaatggaaccttacgacaaagggagtcacaaagggttcaataatcaagcattgggctgttcttgacttcactgcatccgagagtttgaaaaaaaagatgcctggttactttgtaaataaactcatcgaacgttgtaagggacttgggatgcagatggaggctcctatcgtttgcaaaacatcgagtatggaaacactttatgatggtaatgctcttgaggaattgcttcgatccgtgatagatgaggcttctcataaccatggtggggcttgtccaactcttgttctgtgtgctatgactgggaagcacgatggatacaagactctgaaatggatagccgagaccaaacttggtctagtgactcagtgtttcttgaccatatctgccattaaaggagaaaccgtttctgatcagtacttggcaaatctcgccctcaagataaacgcaaaggttggtggaacgaacgtggagttggtggataatattttctctttcttcaaaaaagaagataaggtcatgttcattggtgctgatgtcaatcatcccgctgctcacgacaatatgagtccatccattgttgctgttgtaggcactcttaactggcctgaagctaaccgctacgcagctagagtcaaagctcagagtcaccgtaaagaagagatacaagggtttggtgaaacttgctgggagcttatcgaagctcattctcaggcccccgagaaacgacctaacaagattgtgatattccgtgatggtgtcagcgatggtcagttcgatatggttctcaatgtggagttacagaatgttaaggacgtttttgccaaggttggctataatccgcagataactgtaattgtggcacagaaacgtcatcaaacccgtttcttccccgccacaactagcaaagatggaagggctaagggcaatgtgccttcaggtacggtcgttgataccacgatcattcacccgtttgagtatgatttctacctctgtagtcaacatggagcgataggtacaagcaaaccaactcattattatgttctttcggacgaaatcgggttcaactcgaatcagattcagaaactcatctttgacttgtgcttcacgtttactcgctgcaccaaaccggtcgctctggttcctccggtttcttatgctgacaaggctgcttctagaggaagggtgtactacgaggcaagcttaatgaagaagaattctaagcagtcgcgtggagcgtcttcgtcttctgcctcggttgcctcttcatcctcttctgtcacaatggaggacaaagagatcttcaaggttcacgcaggcatcgagaactttatgttctttgtctgaaaaaaagtttgatcttaaaatatttatctaaataagaacgtctcattaacgcagttcttactcctttttctgattagaaaggatgtttgtgcgtgaatctaatcgttagatatgcagtttgtttgtttccttttcgttgttggtgtgttgaaaatagtttgtatttggtattgtaatgctctttagagctgaaactatgtcatgttatggtattttattatagttttcagactttggattcaataaatagttcata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]