GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 18:21:02, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_099986               6276 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana dicer-like 1 (DCL1), mRNA.
ACCESSION   NM_099986
VERSION     NM_099986.4
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 6276)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 6276)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 6276)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 6276)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 6276)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            On Sep 12, 2016 this sequence version replaced NM_099986.3.
FEATURES             Location/Qualifiers
     source          1..6276
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            1..6276
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="Encodes a Dicer homolog. Dicer is a RNA helicase
                     involved in microRNA processing. Mutations in this locus
                     can result in embryo lethality. Embryo shape at seed
                     maturity is globular-elongate. Other mutants convert the
                     floral meristems to an indeterminate state, others yet
                     show defects in ovule development. mRNA is expressed in
                     all shoot tissues. DCL1 is able to produce miRNAs and
                     siRNAs."
                     /db_xref="Araport:AT1G01040"
                     /db_xref="GeneID:839574"
                     /db_xref="TAIR:AT1G01040"
     CDS             399..6128
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EH948322.1,INSD:EH830906.1,INSD:EG522515.1,
                     INSD:BP571785.1,INSD:AI100063.1,INSD:EL120669.1,
                     INSD:EH988836.1,INSD:DR373797.1,INSD:BP629851.1,
                     INSD:AI996152.1,INSD:EH866522.1,INSD:EL096532.1,
                     INSD:EL281260.1,INSD:AV806514.1,INSD:AV815743.1,
                     INSD:ES104193.1,INSD:AV783898.1,INSD:DR380507.1,
                     INSD:BP575972.1,INSD:ES185316.1,INSD:H36434.1,
                     INSD:ES210801.1,INSD:BP563653.1,INSD:EH902174.1,
                     INSD:Z29202.1,INSD:BP789125.1,INSD:BP655894.1,
                     INSD:EL137132.1,INSD:BP568979.1,INSD:BP783219.1,
                     INSD:ES098400.1,INSD:BP787533.1,INSD:EH971167.1,
                     INSD:AV787299.1,INSD:AV781745.1,INSD:EH901232.1,
                     INSD:AV535286.1,INSD:BU636534.1,INSD:ES159107.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:AF187317.1,INSD:AF292940.1"
                     /note="dicer-like 1 (DCL1); CONTAINS InterPro DOMAIN/s:
                     Restriction endonuclease, type I, R subunit/Type III, Res
                     subunit (InterPro:IPR006935), Double-stranded RNA-binding
                     (InterPro:IPR001159), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Ribonuclease III
                     (InterPro:IPR000999), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021), Dicer
                     double-stranded RNA-binding fold (InterPro:IPR005034);
                     BEST Arabidopsis thaliana protein match is: dicer-like 3
                     (TAIR:AT3G43920.2); Has 21958 Blast hits to 17420 proteins
                     in 2982 species: Archae - 328; Bacteria - 11461; Metazoa -
                     3615; Fungi - 1668; Plants - 1373; Viruses - 45; Other
                     Eukaryotes - 3468 (source: NCBI BLink)."
                     /codon_start=1
                     /product="dicer-like 1"
                     /protein_id="NP_171612.1"
                     /db_xref="Araport:AT1G01040"
                     /db_xref="GeneID:839574"
                     /db_xref="TAIR:AT1G01040"
                     /translation="
MVMEDEPREATIKPSYWLDACEDISCDLIDDLVSEFDPSSVAVNESTDENGVINDFFGGIDHILDSIKNGGGLPNNGVSDTNSQINEVTVTPQVIAKETVKENGLQKNGGKRDEFSKEEGDKDRKRARVCSYQSERSNLSGRGHVNNSREGDRFMNRKRTRNWDEAGNNKKKRECNNYRRDGRDREVRGYWERDKVGSNELVYRSGTWEADHERDVKKVSGGNRECDVKAEENKSKPEERKEKVVEEQARRYQLDVLEQAKAKNTIAFLETGAGKTLIAILLIKSVHKDLMSQNRKMLSVFLVPKVPLVYQQAEVIRNQTCFQVGHYCGEMGQDFWDSRRWQREFESKQVLVMTAQILLNILRHSIIRMETIDLLILDECHHAVKKHPYSLVMSEFYHTTPKDKRPAIFGMTASPVNLKGVSSQVDCAIKIRNLETKLDSTVCTIKDRKELEKHVPMPSEIVVEYDKAATMWSLHETIKQMIAAVEEAAQASSRKSKWQFMGARDAGAKDELRQVYGVSERTESDGAANLIHKLRAINYTLAELGQWCAYKVGQSFLSALQSDERVNFQVDVKFQESYLSEVVSLLQCELLEGAAAEKVAAEVGKPENGNAHDEMEEGELPDDPVVSGGEHVDEVIGAAVADGKVTPKVQSLIKLLLKYQHTADFRAIVFVERVVAALVLPKVFAELPSLSFIRCASMIGHNNSQEMKSSQMQDTISKFRDGHVTLLVATSVAEEGLDIRQCNVVMRFDLAKTVLAYIQSRGRARKPGSDYILMVERGNVSHAAFLRNARNSEETLRKEAIERTDLSHLKDTSRLISIDAVPGTVYKVEATGAMVSLNSAVGLVHFYCSQLPGDRYAILRPEFSMEKHEKPGGHTEYSCRLQLPCNAPFEILEGPVCSSMRLAQQAVCLAACKKLHEMGAFTDMLLPDKGSGQDAEKADQDDEGEPVPGTARHREFYPEGVADVLKGEWVSSGKEVCESSKLFHLYMYNVRCVDFGSSKDPFLSEVSEFAILFGNELDAEVLSMSMDLYVARAMITKASLAFKGSLDITENQLSSLKKFHVRLMSIVLDVDVEPSTTPWDPAKAYLFVPVTDNTSMEPIKGINWELVEKITKTTAWDNPLQRARPDVYLGTNERTLGGDRREYGFGKLRHNIVFGQKSHPTYGIRGAVASFDVVRASGLLPVRDAFEKEVEEDLSKGKLMMADGCMVAEDLIGKIVTAAHSGKRFYVDSICYDMSAETSFPRKEGYLGPLEYNTYADYYKQKYGVDLNCKQQPLIKGRGVSYCKNLLSPRFEQSGESETVLDKTYYVFLPPELCVVHPLSGSLIRGAQRLPSIMRRVESMLLAVQLKNLISYPIPTSKILEALTAASCQETFCYERAELLGDAYLKWVVSRFLFLKYPQKHEGQLTRMRQQMVSNMVLYQFALVKGLQSYIQADRFAPSRWSAPGVPPVFDEDTKDGGSSFFDEEQKPVSEENSDVFEDGEMEDGELEGDLSSYRVLSSKTLADVVEALIGVYYVEGGKIAANHLMKWIGIHVEDDPDEVDGTLKNVNVPESVLKSIDFVGLERALKYEFKEKGLLVEAITHASRPSSGVSCYQRLEFVGDAVLDHLITRHLFFTYTSLPPGRLTDLRAAAVNNENFARVAVKHKLHLYLRHGSSALEKQIREFVKEVQTESSKPGFNSFGLGDCKAPKVLGDIVESIAGAIFLDSGKDTTAAWKVFQPLLQPMVTPETLPMHPVRELQERCQQQAEGLEYKASRSGNTATVEVFIDGVQVGVAQNPQKKMAQKLAARNALAALKEKEIAESKEKHINNGNAGEDQGENENGNKKNGHQPFTRQTLNDICLRKNWPMPSYRCVKEGGPAHAKRFTFGVRVNTSDRGWTDECIGEPMPSVKKAKDSAAVLLLELLNKTFS"
     misc_feature    1146..1766
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="DEAD-like helicases superfamily; Region: DEXDc;
                     smart00487"
                     /db_xref="CDD:214692"
     misc_feature    1185..1643
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="DEAD-like helicases superfamily. A diverse family
                     of proteins involved in ATP-dependent RNA or DNA
                     unwinding. This domain contains the ATP-binding region;
                     Region: DEXDc; cd00046"
                     /db_xref="CDD:238005"
     misc_feature    1212..1226
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:238005"
     misc_feature    1530..1541
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="putative Mg++ binding site [ion binding]; other
                     site"
                     /db_xref="CDD:238005"
     misc_feature    2340..2690
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="Helicase conserved C-terminal domain; Region:
                     Helicase_C; pfam00271"
                     /db_xref="CDD:278689"
     misc_feature    order(2412..2423,2493..2498,2586..2594)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="nucleotide binding region [chemical binding]; other
                     site"
                     /db_xref="CDD:238034"
     misc_feature    2919..3179
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:281376"
     misc_feature    3924..4358
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="PAZ domain, CAF_like subfamily. CAF (for carpel
                     factory) is a plant homolog of Dicer. CAF has been
                     implicated in flower morphogenesis and in early
                     Arabidopsis development and might function through
                     posttranscriptional regulation of specific mRNA...;
                     Region: PAZ_CAF_like; cd02844"
                     /db_xref="CDD:239210"
     misc_feature    order(4074..4076,4161..4163,4173..4175,4227..4229,
                     4317..4319,4323..4325)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239210"
     misc_feature    4467..5006
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(4521..4526,4533..4538,4545..4547,4554..4559,
                     4566..4571,4575..4583,4611..4613,4938..4940,4965..4967)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(4521..4523,4530..4532,4542..4544,4908..4910,
                     4917..4919)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(4530..4532,4908..4910,4917..4919)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    5067..5750
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="dsRNA-specific ribonuclease [Transcription];
                     Region: Rnc; COG0571"
                     /db_xref="CDD:223644"
     misc_feature    5121..5588
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(5178..5183,5190..5195,5202..5204,5211..5216,
                     5223..5228,5232..5240,5268..5270,5505..5507,5538..5540)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(5178..5180,5187..5189,5199..5201,5475..5477,
                     5484..5486)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(5187..5189,5475..5477,5484..5486)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    5598..5750
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="Double-stranded RNA binding motif; Region: DSRM;
                     smart00358"
                     /db_xref="CDD:214634"
     misc_feature    5889..6110
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cl00054"
                     /db_xref="CDD:294045"
     misc_feature    order(5907..5912,6057..6068,6075..6077)
                     /gene="DCL1"
                     /locus_tag="AT1G01040"
                     /gene_synonym="ABNORMAL SUSPENSOR 1; ASU1; ATDCL1; CAF;
                     CARPEL FACTORY; dicer-like 1; DICER-LIKE 1; EMB60; EMB76;
                     EMBRYO DEFECTIVE 60; EMBRYO DEFECTIVE 76; SHORT
                     INTEGUMENTS 1; SIN1; SUS1; SUSPENSOR 1; T25K16.4;
                     T25K16_4"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
ORIGIN      
gtggaaaacagaccagaagagagaggaagacgaagagagaaacagaacagagtagggatcgatagaccgtggaatctcagaatcacaaacactttgcaaaagggttttcaattcctatttatttacaaagaaatcatcaatagtagtggtctctagggttttgcttgctcttcttcgtgacccctttttacctgcaaacaacaacttcaaaattggcgtgtttcgtacggtctatctaaccctaatctgtcacaaaacactcttcttctctcacccctttttctgggtttattcaattctcgtgcttttggttctgttttcttctctggggatttggttttcttgagtgagtttttctcctctttcttatgttcttgatttgattattatatagaattatggtaatggaggatgagcctagagaagccacaataaagccttcttattggctagatgcttgcgaggacatctcttgtgatcttatcgatgatctcgtgtctgaatttgatccttcctctgttgctgtcaatgaatccactgatgaaaacggcgtcatcaatgattttttcggtgggattgatcacattttagatagtatcaagaacggtggaggcttaccaaacaatggcgtttctgataccaattctcaaatcaacgaggttactgtaactcctcaggttattgctaaggagacagtgaaggagaatgggttgcaaaagaatggcggtaagagagacgaattctcgaaagaggaaggagacaaggataggaagagagctagggtttgtagttatcagagtgaaaggagtaacctttcaggtagagggcatgttaataattctagggagggagataggtttatgaataggaaacgtactcgtaattgggacgaggcgggtaacaataagaagaaaagggaatgtaacaattacagaagagatggtagagatagagaagttaggggttattgggagagggataaagttggttccaatgagttggtttataggtcagggacttgggaagctgatcatgaaagagatgttaagaaagtgagtggtggaaaccgcgaatgcgatgtcaaggcagaggagaacaagagtaagcctgaagaacgtaaagagaaggttgtggaagagcaagcaaggcgataccagttggatgttcttgaacaagctaaagcgaaaaacacgattgctttccttgagaccggtgctggaaagacacttatcgcgattcttcttattaaaagtgttcataaggatctgatgagccagaacagaaaaatgctctcggtgttcttggttcccaaagtgcctttggtttatcagcaagcagaagtgatccgtaatcaaacttgttttcaagttggacattattgtggtgagatgggacaggacttttgggattctcgaaggtggcaacgagagtttgagtctaagcaggttctagttatgacagcacaaattctgttgaatatactgagacacagtatcattagaatggaaacaattgatcttcttattctcgacgagtgtcaccacgctgtcaagaaacatccatactctttagtgatgtcagagttttaccatacaactcctaaagataaaagacctgccatctttggaatgactgcttcgcctgttaatttaaagggtgtttcaagccaagtagattgtgcgataaagatacgtaacctcgagaccaagttggattctacggtttgtactataaaagatcgaaaagaattagagaaacatgtgcctatgccttcagagatagtcgtcgagtatgacaaagctgctactatgtggtctcttcatgagacaataaagcaaatgattgcagctgttgaagaagcggcacaagcaagttcaaggaaaagcaagtggcaatttatgggggctagggatgctggagcaaaggatgaattgagacaggtttatggcgtctctgaaagaacggagagcgatggtgctgccaatttgattcataaacttagagctatcaattatactcttgctgaattgggtcaatggtgtgcttacaaggtgggacaatcattcttgtctgctttgcaaagtgatgagagggtgaatttccaagtcgacgtgaagtttcaagaatcatacctcagtgaggtggtgtcactcttgcaatgtgagcttctggaaggcgctgctgctgaaaaagtcgcggcggaagttggcaaaccagaaaatggtaatgcacatgacgagatggaggagggagagctccctgatgatcctgtggtctcgggaggggagcacgttgatgaagtaataggcgccgcagtggctgatgggaaagttactccaaaagtacaatcattgatcaaactactcctcaaatatcagcacacagctgattttcgagctattgttttcgttgagagggtggttgctgctttggttcttcctaaggtttttgcggagctgccttcgcttagttttatacggtgtgccagcatgattggacacaataacagccaggagatgaaatcatctcaaatgcaggatacaatttccaaattccgagatgggcatgtgacactgttagttgccacaagcgttgctgaggaaggacttgatattaggcaatgtaacgttgttatgcgtttcgaccttgcaaagacggtgctggcatacattcagtctcgtggccgggcaagaaagcctggatcagactacatactcatggttgagagaggaaatgtatctcacgcagcgttcctaaggaatgctaggaacagtgaggagacacttcgaaaagaagcaatagaaaggactgatcttagtcatctcaaagatacatcgagattaatctcaattgatgctgtgcctggtacagtttataaggtggaggcaactggtgccatggttagcttgaattccgcggttggtcttgtacatttctactgctctcagcttcctggtgacaggtatgcaatccttcgtcctgagtttagcatggagaagcatgaaaagcctgggggccacacggaatattcatgtaggcttcagcttccttgcaatgcaccgtttgaaatacttgagggtcctgtttgcagttcaatgcgtcttgcacaacaggctgtatgtttagctgcttgcaagaaactgcatgagatgggtgcatttaccgatatgctattaccggacaaaggaagtggtcaagacgctgagaaggctgaccaagatgatgaaggtgagcctgttcctggaactgctagacatagagagttctatcctgaaggtgtggcggatgtacttaagggagaatgggtttcatctggaaaggaagtttgtgagagctcaaagctattccatttatacatgtataatgtcagatgtgtagattttggctcttcaaaagatccattcctaagcgaagtttcagagttcgcgattctttttggcaatgagctggatgcagaggtattatcgatgtctatggatctttatgttgctcgggccatgatcactaaagcatctcttgctttcaagggatcacttgatattacagaaaaccagctatcatctctaaaaaagtttcatgtgaggttaatgagtatcgtgttggatgttgatgttgaaccctccacgacaccatgggatcctgcaaaggcctacctgtttgtccctgttactgacaatacgtctatggaacccataaaagggatcaactgggaattggttgaaaagattacgaaaaccacagcgtgggacaaccctcttcagagagctcgtcccgatgtatatctcgggactaatgagagaactcttggtggggacagaagggaatatgggtttggtaaacttcgtcacaacattgtatttgggcagaaatctcacccaacttatggtattagaggagctgttgcatccttcgatgttgtgagagcttctggattgttacctgtgagagatgcttttgagaaggaagtagaagaggatttatcaaaaggaaaattgatgatggctgatgggtgcatggttgcagaagatcttattgggaaaatagtgacagccgcacattccgggaagcggttttacgtagattcaatttgttatgacatgagtgcagaaacatctttccctaggaaagagggatatcttggtcccctagagtacaacacgtacgctgactattacaagcaaaagtatggagttgatttgaactgtaagcaacaacctttgattaaaggacgtggtgtttcgtattgcaagaaccttctttctcctcggtttgaacagtcaggtgaatctgagacagtccttgataagacatattacgtgtttcttccacctgaactatgcgttgtgcatccgctttcgggttcacttatccgaggtgctcagaggttaccctctataatgagaagagttgagagcatgttactcgctgttcaactcaaaaatttgattagttatcctattcccacatcaaagattcttgaagccttgactgccgcctcgtgccaggaaacgttctgctacgagagagctgagcttttaggagatgcgtatctaaaatgggttgttagtcgttttctgtttctcaagtatcctcaaaagcacgagggtcagcttacaaggatgaggcaacaaatggttagtaatatggttctttatcagtttgctctggttaaagggcttcagtcatatatccaggcggatcgattcgccccgtctaggtggtctgctcctggtgtgcctccggttttcgacgaggacacaaaagatggaggatcttcgtttttcgatgaagagcaaaaacctgtttccgaggaaaacagcgatgtgtttgaagatggggagatggaggatggtgaactagagggtgatttgagttcgtaccgagttttatctagcaaaacgttagctgatgttgttgaggctttgattggtgtttattacgtcgaagggggtaagattgcagctaatcatttgatgaaatggattgggattcacgtggaggatgatcctgatgaagtcgatggaacattgaaaaatgttaatgttccagagagtgtgctcaagagcatcgactttgttggtcttgagagagctcttaaatatgagtttaaagagaaaggtcttcttgttgaagctataacacatgcttcaagaccatcttcaggtgtttcgtgttaccagagattggaatttgttggtgacgcggtcttggatcatctcatcacaagacatctatttttcacatacacaagccttcctcctggtcggttaacagatcttcgagctgcagcggttaacaacgagaattttgctcgcgttgcggttaaacataaactccacttgtaccttcgtcacggttcaagcgccctcgaaaaacagattcgggaatttgtgaaggaggttcaaaccgagtcatcgaaaccggggtttaactcttttggtttgggagactgcaaagcaccaaaagttcttggagacattgttgaatctattgcaggtgctatttttcttgatagtggaaaagatacaactgctgcttggaaggtttttcaacctttgcttcagcccatggtgacaccagagacacttccaatgcatccggtgcgagagctacaagagcggtgccagcaacaagcagaagggttagaatacaaagcgagtaggagtggtaacacagcgactgtggaagttttcatcgacggtgttcaagttggagtagcgcaaaacccgcagaagaaaatggctcaaaagctagctgcgaggaacgcacttgcagctttgaaagagaaagaaatagcagaatcaaaggagaagcatatcaacaacggtaatgcgggagaggatcaaggcgagaatgagaatgggaacaagaagaatgggcatcagccgtttacgagacaaacgttgaatgatatttgtttgaggaagaattggccaatgccttcttacagatgtgtgaaagaaggaggaccggctcatgcaaagagatttacgtttggggtaagagttaatacgagcgatagaggatggaccgatgagtgtattggcgagccaatgccgagtgttaagaaagctaaggattcagctgcggttcttctacttgagcttttaaataaaactttttcttgattcttttactctcttcaacgagatgtagtcattacattttaaaccttaaaaccatagtggttgtagtgttttaattgatctgttgttattcgagtttaattggtttatagaactcttcaaacaaattaaaccaaaaatttcaatgcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]