GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 15:06:01, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_053678               1029 bp    mRNA    linear   ROD 21-JUN-2021
DEFINITION  Rattus norvegicus retina and anterior neural fold homeobox (Rax),
            mRNA.
ACCESSION   NM_053678
VERSION     NM_053678.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1029)
  AUTHORS   Rohde K, Klein DC, Moller M and Rath MF.
  TITLE     Rax : developmental and daily expression patterns in the rat pineal
            gland and retina
  JOURNAL   J Neurochem 118 (6), 999-1007 (2011)
   PUBMED   21749377
  REMARK    GeneRIF: These findings are consistent with the evidence that Rax
            is of functional importance in eye development and suggest a role
            of Rax in the developing pineal gland
REFERENCE   2  (bases 1 to 1029)
  AUTHORS   Silva VA, Polesskaya A, Sousa TA, Correa VM, Andre ND, Reis RI,
            Kettelhut IC, Harel-Bellan A and De Lucca FL.
  TITLE     Expression and cellular localization of microRNA-29b and RAX, an
            activator of the RNA-dependent protein kinase (PKR), in the retina
            of streptozotocin-induced diabetic rats
  JOURNAL   Mol Vis 17, 2228-2240 (2011)
   PUBMED   21897745
  REMARK    GeneRIF: RAX expression in the retina of diabetic rats may be
            indirectly regulated by miR-29b.
REFERENCE   3  (bases 1 to 1029)
  AUTHORS   Voronina VA, Kozlov S, Mathers PH and Lewandoski M.
  TITLE     Conditional alleles for activation and inactivation of the mouse Rx
            homeobox gene
  JOURNAL   Genesis 41 (4), 160-164 (2005)
   PUBMED   15789424
REFERENCE   4  (bases 1 to 1029)
  AUTHORS   Zhang L, Mathers PH and Jamrich M.
  TITLE     Function of Rx, but not Pax6, is essential for the formation of
            retinal progenitor cells in mice
  JOURNAL   Genesis 28 (3-4), 135-142 (2000)
   PUBMED   11105055
REFERENCE   5  (bases 1 to 1029)
  AUTHORS   Furukawa T, Mukherjee S, Bao ZZ, Morrow EM and Cepko CL.
  TITLE     rax, Hes1, and notch1 promote the formation of Muller glia by
            postnatal retinal progenitor cells
  JOURNAL   Neuron 26 (2), 383-394 (2000)
   PUBMED   10839357
REFERENCE   6  (bases 1 to 1029)
  AUTHORS   Kimura A, Singh D, Wawrousek EF, Kikuchi M, Nakamura M and
            Shinohara T.
  TITLE     Both PCE-1/RX and OTX/CRX interactions are necessary for
            photoreceptor-specific gene expression
  JOURNAL   J Biol Chem 275 (2), 1152-1160 (2000)
   PUBMED   10625658
REFERENCE   7  (bases 1 to 1029)
  AUTHORS   Harch,C., Chase,H.B. and Gonsalves,N.I.
  TITLE     Studies on an anophthalmic strain of mice. VI. Lens and cup
            interaction
  JOURNAL   Dev Biol 63 (2), 352-357 (1978)
   PUBMED   640224
REFERENCE   8  (bases 1 to 1029)
  AUTHORS   Silver,J.
  TITLE     Abnormal development of the suprachiasmatic nuclei of the
            hypothalamus in a strain of genetically anophthalmic mice
  JOURNAL   J Comp Neurol 176 (4), 589-606 (1977)
   PUBMED   925203
REFERENCE   9  (bases 1 to 1029)
  AUTHORS   BECK,S.L.
  TITLE     The anophthalmic mutant of the mouse. II. An association of
            anophthalmia and polydactyly
  JOURNAL   J Hered 54, 79-83 (1963)
   PUBMED   13970082
REFERENCE   10 (bases 1 to 1029)
  AUTHORS   Chase HB.
  TITLE     Studies on an Anophthalmic Strain of Mice. IV. a Second Major Gene
            for Anophthalmia
  JOURNAL   Genetics 29 (3), 264-269 (1944)
   PUBMED   17247120
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF135839.1.
            
            Summary: may play a role in glial cell development [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF135839.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06621351 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1029
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="18"
                     /map="18q12.1"
     gene            1..1029
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="retina and anterior neural fold homeobox"
                     /db_xref="GeneID:114213"
                     /db_xref="RGD:620371"
     CDS             1..1029
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="retina and anterior neural fold homeobox protein;
                     retinal homeobox transcription factor Rx/rax"
                     /codon_start=1
                     /product="retinal homeobox protein Rx"
                     /protein_id="NP_446130.1"
                     /db_xref="GeneID:114213"
                     /db_xref="RGD:620371"
                     /translation="
MHLPGCPPAMADGSFSLAGHLLRSPGGSTSRLHSIEAILGFTKEDGILDTFPAERSSRGSKERDPRLGARSACPKAPAGGSESSPPAAPGLVPEFEATRPCYPKEQGEARPSPGLPVGPAAGDSKLSEEEEPPKKKHRRNRTTFTTYQLHELERAFEKSHYPDVYSREELAGKVNLPEVRVQVWFQNRRAKWRRQEKLEVSSMKLQDSPLLSFSRSPPSSALAPLGGPGSGSGPPGSALPLEPWLGPPLPGGGATALQSLPGFGPPGQGLPASYTPPPPFLNSAPLGPGLQQLGPPPAYPCAPAFGDKFSLEEAYPRNSSIAALRLKAKEHIQAIGKPWQAL"
     misc_feature    97..120
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JLT7.1);
                     Region: Octapeptide motif"
     misc_feature    145..423
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JLT7.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(412..426,430..432,481..483,499..501,538..540,
                     544..549,556..561,565..573,577..582)
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(418..420,427..429,547..549,556..561,568..570)
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    421..579
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    625..885
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JLT7.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    946..993
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="OAR domain; Region: OAR; pfam03826"
                     /db_xref="CDD:281777"
     misc_feature    955..996
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JLT7.1);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     misc_feature    973..987
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9JLT7.1);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     exon            1..289
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /inference="alignment:Splign:2.1.0"
     STS             121..945
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /standard_name="Rax"
                     /db_xref="UniSTS:507887"
     STS             146..328
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /standard_name="Rax"
                     /db_xref="UniSTS:527031"
     exon            290..546
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /inference="alignment:Splign:2.1.0"
     exon            547..1029
                     /gene="Rax"
                     /gene_synonym="Rx"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgcacctgccggggtgcccgccagccatggccgacgggagcttctcgctcgctggccacctgctccgcagcccgggcgggagcacgtcgcgtttgcacagcatcgaagccatcctgggctttaccaaggaagacgggatcctagacacctttcctgcagagaggagctccaggggctcgaaggagcgggatcccagactgggtgcgcggtccgcctgccccaaagctccagccggaggctcggagtcttccccaccagcagccccggggctcgtcccggagttcgaagctactcgcccctgctatcccaaggagcaaggagaggcacggccgagccccggactgccggttgggccagcagcgggcgattcgaagctgtcggaggaggaggaacctcccaagaagaaacacaggcgcaaccgcacgaccttcaccacgtatcaactgcacgagctggaacgtgcctttgagaagtcccactaccccgacgtgtacagccgcgaagagttggccggcaaggttaacctacccgaggttcgggtccaggtgtggttccagaaccgtcgagccaagtggagacgccaggagaaactagaagtgtcgtccatgaagctgcaggactcgcccctcctctccttcagccggtccccaccttcctcggcactggctccgttgggcggcccgggcagcggtagcggacctccggggagcgccctgccgctggagccttggctcgggccaccgctgcccggcggaggtgccacagcgctgcagagcctgccaggtttcgggccgccggggcagggtctcccggccagctacacgccgccaccgcccttcctcaactccgcgcccctgggtcccggtctgcagcagctcgggccgccacccgcgtacccgtgcgcgccggccttcggggacaagttctcgctggaagaggcgtacccacgcaacagcagcatcgccgcgctgcgcctgaaggccaaagagcacatccaggccatcggcaagccctggcaagccctctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]