2025-07-10 16:18:32, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_053584 2726 bp mRNA linear ROD 01-JUN-2024 DEFINITION Rattus norvegicus golgi SNAP receptor complex member 1 (Gosr1), mRNA. ACCESSION NM_053584 XM_579564 VERSION NM_053584.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2726) AUTHORS Kuliyev,E., Gingras,S., Guy,C.S., Howell,S., Vogel,P. and Pelletier,S. TITLE Overlapping Role of SCYL1 and SCYL3 in Maintaining Motor Neuron Viability JOURNAL J Neurosci 38 (10), 2615-2630 (2018) PUBMED 29437892 REFERENCE 2 (bases 1 to 2726) AUTHORS Zhong,W., Zhou,Y., Li,S., Zhou,T., Ma,H., Wei,K., Li,H., Olkkonen,V.M. and Yan,D. TITLE OSBP-related protein 7 interacts with GATE-16 and negatively regulates GS28 protein stability JOURNAL Exp Cell Res 317 (16), 2353-2363 (2011) PUBMED 21669198 REFERENCE 3 (bases 1 to 2726) AUTHORS Ghosh,D., Lippert,D., Krokhin,O., Cortens,J.P. and Wilkins,J.A. TITLE Defining the membrane proteome of NK cells JOURNAL J Mass Spectrom 45 (1), 1-25 (2010) PUBMED 19946888 REFERENCE 4 (bases 1 to 2726) AUTHORS Suga,K., Hattori,H., Saito,A. and Akagawa,K. TITLE RNA interference-mediated silencing of the syntaxin 5 gene induces Golgi fragmentation but capable of transporting vesicles JOURNAL FEBS Lett 579 (20), 4226-4234 (2005) PUBMED 16081076 REFERENCE 5 (bases 1 to 2726) AUTHORS Loh,E., Peter,F., Subramaniam,V.N. and Hong,W. TITLE Mammalian Bet3 functions as a cytosolic factor participating in transport from the ER to the Golgi apparatus JOURNAL J Cell Sci 118 (Pt 6), 1209-1222 (2005) PUBMED 15728249 REFERENCE 6 (bases 1 to 2726) AUTHORS Zhang,T. and Hong,W. TITLE Ykt6 forms a SNARE complex with syntaxin 5, GS28, and Bet1 and participates in a late stage in endoplasmic reticulum-Golgi transport JOURNAL J Biol Chem 276 (29), 27480-27487 (2001) PUBMED 11323436 REFERENCE 7 (bases 1 to 2726) AUTHORS Sagiv,Y., Legesse-Miller,A., Porat,A. and Elazar,Z. TITLE GATE-16, a membrane transport modulator, interacts with NSF and the Golgi v-SNARE GOS-28 JOURNAL EMBO J 19 (7), 1494-1504 (2000) PUBMED 10747018 REFERENCE 8 (bases 1 to 2726) AUTHORS Tang,B.L., Low,D.Y., Lee,S.S., Tan,A.E. and Hong,W. TITLE Molecular cloning and localization of human syntaxin 16, a member of the syntaxin family of SNARE proteins JOURNAL Biochem Biophys Res Commun 242 (3), 673-679 (1998) PUBMED 9464276 REFERENCE 9 (bases 1 to 2726) AUTHORS Hay,J.C., Chao,D.S., Kuo,C.S. and Scheller,R.H. TITLE Protein interactions regulating vesicle transport between the endoplasmic reticulum and Golgi apparatus in mammalian cells JOURNAL Cell 89 (1), 149-158 (1997) PUBMED 9094723 REFERENCE 10 (bases 1 to 2726) AUTHORS Subramaniam,V.N., Peter,F., Philp,R., Wong,S.H. and Hong,W. TITLE GS28, a 28-kilodalton Golgi SNARE that participates in ER-Golgi transport JOURNAL Science 272 (5265), 1161-1163 (1996) PUBMED 8638159 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from U49099.1, CA338781.1, CB789285.1, CB712832.1, CA512572.1 and CB583047.1. On or before Apr 21, 2005 this sequence version replaced XM_579564.1, NM_053584.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC126068.1, FQ235426.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMD00132261, SAMD00132262 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-781 U49099.1 9-789 782-945 CA338781.1 468-631 946-1220 U49099.1 954-1228 1221-1236 U49099.1 1230-1245 1237-1604 U49099.1 1247-1614 1605-1782 CB789285.1 266-443 1783-2048 CB712832.1 175-440 2049-2362 CA512572.1 293-606 2363-2726 CB583047.1 221-584 FEATURES Location/Qualifiers source 1..2726 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="10" /map="10q24" gene 1..2726 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="golgi SNAP receptor complex member 1" /db_xref="GeneID:94189" /db_xref="RGD:71093" exon 1..32 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" CDS 2..754 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="GOS-28; 28 kDa Golgi SNARE protein; 28 kDa cis-Golgi SNARE p28; cis-Golgi p28 (p28)" /codon_start=1 /product="Golgi SNAP receptor complex member 1" /protein_id="NP_446036.1" /db_xref="GeneID:94189" /db_xref="RGD:71093" /translation="
MAAGTSNYWEDLRKQARQLENELDLKLVSFSKLCTSYSHSSARDGGRDRYSSDTTPLLNGSSQDRMFETMAIEIEQLLARLTGVNDKMAEYTHSAGVPSLNAALMHTLQRHRDILQDYTHEFHKTKANFMAIRERENLMGSVRKDIESYKSGSGVNNRRTELFLKEHDHLRNSDRLIEETISIAMATKENMTSQRGMLKSIHSKMNTLANRFPAVNSLIQRINLRKRRDSLILGGVIGICTILLLLYAFH"
misc_feature 5..7 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="N-acetylalanine. /evidence=ECO:0000250|UniProtKB:O95249; propagated from UniProtKB/Swiss-Prot (Q62931.1); acetylation site" misc_feature 110..178 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="propagated from UniProtKB/Swiss-Prot (Q62931.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 422..424 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:O95249; propagated from UniProtKB/Swiss-Prot (Q62931.1); phosphorylation site" misc_feature 479..676 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="SNARE motif of GS28; Region: SNARE_GS28; cd15864" /db_xref="CDD:277217" misc_feature order(494..502,506..523,527..532,539..544,548..565, 569..574,578..586,590..607,611..616,620..628,632..637, 641..649,653..658,662..664) /gene="Gosr1" /gene_synonym="GOS28; p28" /note="heterotetramer interface [polypeptide binding]; other site" /db_xref="CDD:277217" misc_feature 581..583 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="zero layer; other site" /db_xref="CDD:277217" misc_feature 689..751 /gene="Gosr1" /gene_synonym="GOS28; p28" /note="propagated from UniProtKB/Swiss-Prot (Q62931.1); transmembrane region" exon 33..153 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 154..241 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 242..349 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 350..441 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 442..516 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 517..546 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 547..629 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" exon 630..2726 /gene="Gosr1" /gene_synonym="GOS28; p28" /inference="alignment:Splign:2.1.0" ORIGIN
gatggcggcgggaaccagcaattactgggaagatcttaggaaacaagctcgacagctggaaaatgaacttgacctgaaactagtttccttcagtaaactgtgtacgagttacagtcacagcagcgcccgggatggaggccgcgataggtatagttctgacacaacacccctattaaatggatcaagccaagacaggatgttcgagacaatggccattgaaattgaacagcttttggcgaggcttacaggagtaaacgacaaaatggcagagtatactcacagtgcaggggtgccctccctgaacgcagccctgatgcacacgctacagcgacacagagacattctgcaggattatacacatgaattccataaaaccaaagcaaactttatggcaatacgggaaagggagaatctcatgggatcagtacgaaaagatattgagtcatataaaagtgggtctggagtaaacaacaggagaactgaactgtttctgaaagaacatgaccaccttcgaaactctgatcgtctgatagaagagacaataagcattgctatggcaacaaaagagaatatgacttcgcagagaggaatgctcaagtccattcacagcaagatgaacactctggccaaccgctttcccgccgtcaacagcctgatacaaaggatcaaccttaggaagcggcgcgactcgctcatccttggaggcgtcattggcatctgcaccatcctgttgctgctgtatgcattccactgagaggtcggccccaggactctgcccaccgcctctgcggcctgctttggaatggggaacctgcaaaggagagagaccgtccggccatgagcctgccagcagatgaattctaaactgcaccgtggctctgacctggtcggcctgagctgaagccacagtttttctgtgctatcttttctaatacatattactctgtttttaattttaaaaacaacaaaaggtttcagttgctgcatctccctaggaggtaagcaagcagaagctgagaacctgggctttagtgactggtgaagccagatgaccagcgggcctcatagctggactcctcacagcaccaggctctacatccaaagatggcctcactttcagccacgagattggatgtgaataaaaataattcttgtccttttatttaacacttgtgatgagaagtcagctgtcctttgctgatactccgtgatccatactctattctgtgtccctaactcttggcagtcaagaaaaattccatttcccacggattctgtaagatgttggtaggccagcttcatgtttgaggcggtctgaaatggaaagtgctatagaaagggtgtctcttttctgtttcagttgtgagccctgggtcaactactgccaccagcacatcagaatggcgggccttacagaggagctggtcattgctttattatttcttcccttgggctgatatttgcttgtattgataaaaatgcatttccagtgatagcccgtcagtgactgtcatcggccctcgaagtcccatatcatgtgaagcttaatactaggaactgaaggagggacttggttctctgtgaggcctgctcgtgagccactgtgagaagacagtgaggggcggctctccagggcttcccatctgtcagtgttgtgcagcctagagcaagggttagcaccgccacctgatgtcacagtactcatgccctgtgcagatctatcccctcctcctctgttaggcttcttcctactcccaggccacaggatgactactgaaggggccggtgactcctacctgtggctatcttactttggacagtgacagaattgtgaatgcttttcaaggttagccatttctcagcatctgtaaatcggtaacttgtcttactcaactagcagatatgttaaagactccaacatgtgtgctcaccaagagagaaggcttccggtccccctggaatgtcctctagcacattgtccacgggcagtgagaggatattagagcgtagcacttcaccattctgtggtgcaggatggtgcctctgggccaacttgatacacttactgcttgctcctggatagactgacacccagtctgagactgactgacaggtttgatattctgctattgaagtgttagtacattctgggtatgaaaggcatttgatatatttttcttaattatggggtttatttttctaaatatgggttaatcggcttgttgactgggcatgccctttaaaggaaattaaatttccctctatggaccttaaagaatcagggaagttcgtttgttaaattctcttttagagagaacagaacttctcttccctgacatttcattatctttgatttttttcaaagggccttgattggcagttgtgcctcagcaggactttatgggactttggttgttatatagtgggcatatataaaatctgaagtatcataaataaagttatttatttaaatatacagccagtcttttctcctggtttgattatgtgcttcgttcactctagctgatgagtgaacgggagctaggacatggccctgccccactgccacagcacagctgctggcagcagacggccgcccaggaggctgcactcagatgaacagtaggattatgttgcttgttttctttttgagagtaaatcagttctttcagggaacgctagctgtagacgctggagacaggagtctgacctcccattgtggtacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]