GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 15:04:43, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_053376               4255 bp    mRNA    linear   ROD 21-JUN-2021
DEFINITION  Rattus norvegicus kinesin family member 2A (Kif2a), mRNA.
ACCESSION   NM_053376 XM_001065116 XM_001065173 XM_003753516 XM_345150
VERSION     NM_053376.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 4255)
  AUTHORS   Wang J, Chen J, Chen J, Liu X, Yang H, Liu J, He A, Gao X and Xin
            Y.
  TITLE     KIF2 mediates the neuroprotection in cerebral ischaemia injury by
            affecting NF-kappaB pathway
  JOURNAL   Clin Exp Pharmacol Physiol 47 (2), 274-280 (2020)
   PUBMED   31514228
  REMARK    GeneRIF: KIF2 mediates the neuroprotection in cerebral ischaemia
            injury by affecting NF-kappaB pathway.
REFERENCE   2  (bases 1 to 4255)
  AUTHORS   Seira O, Liu J, Assinck P, Ramer M and Tetzlaff W.
  TITLE     KIF2A characterization after spinal cord injury
  JOURNAL   Cell Mol Life Sci 76 (21), 4355-4368 (2019)
   PUBMED   31041455
  REMARK    GeneRIF: KIF2A at the injured axonal tips may contribute to neurite
            outgrowth inhibition after injury, and that its increased
            expression in inhibitory spinal neurons adjacent to the injury site
            might contribute to an intrinsic wiring-control mechanism
            associated with neuropathic pain. Further studies will determine
            whether KIF2A may be a potential target for the development of
            regeneration-promoting or pain-preventing therapies.
REFERENCE   3  (bases 1 to 4255)
  AUTHORS   Watanabe T, Kakeno M, Matsui T, Sugiyama I, Arimura N, Matsuzawa K,
            Shirahige A, Ishidate F, Nishioka T, Taya S, Hoshino M and Kaibuchi
            K.
  TITLE     TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells
            through KIF2A phosphorylation
  JOURNAL   J Cell Biol 210 (5), 737-751 (2015)
   PUBMED   26323690
REFERENCE   4  (bases 1 to 4255)
  AUTHORS   Krahling AM, Alvarez L, Debowski K, Van Q, Gunkel M, Irsen S,
            Al-Amoudi A, Strunker T, Kremmer E, Krause E, Voigt I, Wortge S,
            Waisman A, Weyand I, Seifert R, Kaupp UB and Wachten D.
  TITLE     CRIS-a novel cAMP-binding protein controlling spermiogenesis and
            the development of flagellar bending
  JOURNAL   PLoS Genet 9 (12), e1003960 (2013)
   PUBMED   24339785
REFERENCE   5  (bases 1 to 4255)
  AUTHORS   Sonnen KF, Schermelleh L, Leonhardt H and Nigg EA.
  TITLE     3D-structured illumination microscopy provides novel insight into
            architecture of human centrosomes
  JOURNAL   Biol Open 1 (10), 965-976 (2012)
   PUBMED   23213374
REFERENCE   6  (bases 1 to 4255)
  AUTHORS   Jakobsen L, Vanselow K, Skogs M, Toyoda Y, Lundberg E, Poser I,
            Falkenby LG, Bennetzen M, Westendorf J, Nigg EA, Uhlen M, Hyman AA
            and Andersen JS.
  TITLE     Novel asymmetrically localizing components of human centrosomes
            identified by complementary proteomics methods
  JOURNAL   EMBO J 30 (8), 1520-1535 (2011)
   PUBMED   21399614
REFERENCE   7  (bases 1 to 4255)
  AUTHORS   Ghosh D, Lippert D, Krokhin O, Cortens JP and Wilkins JA.
  TITLE     Defining the membrane proteome of NK cells
  JOURNAL   J Mass Spectrom 45 (1), 1-25 (2010)
   PUBMED   19946888
REFERENCE   8  (bases 1 to 4255)
  AUTHORS   Jang CY, Wong J, Coppinger JA, Seki A, Yates JR 3rd and Fang G.
  TITLE     DDA3 recruits microtubule depolymerase Kif2a to spindle poles and
            controls spindle dynamics and mitotic chromosome movement
  JOURNAL   J Cell Biol 181 (2), 255-267 (2008)
   PUBMED   18411309
REFERENCE   9  (bases 1 to 4255)
  AUTHORS   Zhu C, Zhao J, Bibikova M, Leverson JD, Bossy-Wetzel E, Fan JB,
            Abraham RT and Jiang W.
  TITLE     Functional analysis of human microtubule-based motor proteins, the
            kinesins and dyneins, in mitosis/cytokinesis using RNA interference
  JOURNAL   Mol Biol Cell 16 (7), 3187-3199 (2005)
   PUBMED   15843429
REFERENCE   10 (bases 1 to 4255)
  AUTHORS   Debernardi S, Fontanella E, De Gregorio L, Pierotti MA and Delia D.
  TITLE     Identification of a novel human kinesin-related gene (HK2) by the
            cDNA differential display technique
  JOURNAL   Genomics 42 (1), 67-73 (1997)
   PUBMED   9177777
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000065.1 and FM092220.1.
            On or before Sep 8, 2012 this sequence version replaced
            XM_001065173.3, XM_001065116.3, XM_003753516.1, XM_345150.5.
            
            Summary: human homolog is a motor protein involved in moving
            proteins along microtubules [RGD, Feb 2006].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-110               JACYVU010000065.1  30936398-30936507   c
            111-205             JACYVU010000065.1  30903434-30903528   c
            206-322             JACYVU010000065.1  30902738-30902854   c
            323-377             JACYVU010000065.1  30899446-30899500   c
            378-500             JACYVU010000065.1  30897151-30897273   c
            501-601             JACYVU010000065.1  30896480-30896580   c
            602-697             JACYVU010000065.1  30894234-30894329   c
            698-752             JACYVU010000065.1  30892776-30892830   c
            753-905             JACYVU010000065.1  30892284-30892436   c
            906-1162            FM092220.1         1-257
            1163-1305           JACYVU010000065.1  30888634-30888776   c
            1306-1510           JACYVU010000065.1  30888298-30888502   c
            1511-1621           JACYVU010000065.1  30887170-30887280   c
            1622-1689           JACYVU010000065.1  30886284-30886351   c
            1690-1840           JACYVU010000065.1  30880415-30880565   c
            1841-1942           JACYVU010000065.1  30878171-30878272   c
            1943-2078           JACYVU010000065.1  30877427-30877562   c
            2079-4255           JACYVU010000065.1  30873268-30875444   c
FEATURES             Location/Qualifiers
     source          1..4255
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="2"
                     /map="2q13"
     gene            1..4255
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="kinesin family member 2A"
                     /db_xref="GeneID:84391"
                     /db_xref="RGD:70974"
     exon            1..110
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     CDS             47..2164
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="kinesin heavy chain member 2; kinesin-2; kinesin
                     heavy chain family, member 2; kinesin heavy chain member
                     2A"
                     /codon_start=1
                     /product="kinesin-like protein KIF2A"
                     /protein_id="NP_445828.1"
                     /db_xref="GeneID:84391"
                     /db_xref="RGD:70974"
                     /translation="
MATANFGKIQIGIYVEIKRSDGRIHQAMVTSLNEDNESVTVEWIENGDTKGKEIDLESIFSLNPDLVPDEDIEPSPEIPPPSSSSKVNKIVKNRRTVASIKNDPPPRDNRVVGSARARPSQLPEQSSSAQQNGSVSDISPVQAAKKEFGPPSRRKSNCVKEVEKLQEKREKRRLQQQELREKRAQDVDATNPNYEIMCMIRDFRGSLDYRPLTTADPIDEHRICVCVRKRPLNKKETQMKDLDVITIPSKDVVMVHEPKQKVDLTRYLENQTFRFDYAFDDSAPNEMVYRFTARPLVETIFERGMATCFAYGQTGSGKTHTMGGDFSGKNQDCSKGIYALAARDVFLMLKKPNYKKLELQVYATFFEIYSGKVFDLLNRKTKLRVLEDGKQQVQVVGLQEREVKCVEDVLKLIDIGNSCRTSGQTSANAHSSRSHAVFQIILRRKGKLHGKFSLIDLAGNERGADTSSADRQTRLEGAEINKSLLALKECIRALGRNKPHTPFRASKLTQVLRDSFIGENSRTCMIATISPGMASCENTLNTLRYANRVKELTVDPTAAGDVRPIMHHPPSQIDDLETQWGVGSSPQRDDLKLLCEQNEEEVSPQLFTFHEAVSQMVEMEEQVVEDHRAVFQESIRWIEDEKALLEMTEEVDYDVDSYATQLEAILEQKIDILTELRDKVKSFRAALQEEEQASKQINPKRPRAL"
     misc_feature    239..601
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9WV63.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    269..271
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     misc_feature    332..334
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:O00139; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     misc_feature    341..343
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O00139; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     misc_feature    347..349
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:P28740; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); acetylation site"
     misc_feature    446..448
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O00139; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     misc_feature    461..463
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:O00139; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     misc_feature    710..1696
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Kinesin motor domain, KIF2-like group; Region:
                     KISc_KIF2_like; cd01367"
                     /db_xref="CDD:276818"
     misc_feature    1760..1762
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q9WV63.2); phosphorylation site"
     exon            111..205
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            206..322
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            323..377
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            378..500
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            501..601
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            602..697
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            698..752
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            753..915
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            916..1006
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1007..1070
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1071..1162
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1163..1305
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1306..1510
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1511..1621
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1622..1689
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1690..1840
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1841..1942
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            1943..2078
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     exon            2079..4255
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /inference="alignment:Splign:2.1.0"
     STS             2588..2835
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /standard_name="RH140326"
                     /db_xref="UniSTS:222403"
     STS             3801..3992
                     /gene="Kif2a"
                     /gene_synonym="Kif2"
                     /standard_name="RH132232"
                     /db_xref="UniSTS:215515"
ORIGIN      
tccccgtctgtttcgcccgcccgccgccgccgctccggatgaggtgatggcaacggctaacttcggcaagatccagatcgggatttacgtggaaatcaagcgcagcgatggccgaatacaccaggcaatggtgacatcattaaatgaagataatgaaagtgtcacagtcgagtggatagaaaatggagacacaaaaggaaaagagattgacttggaaagcatcttttcacttaaccctgaccttgtacctgatgaagacattgagccaagtccagaaatacctccaccctcctcatcctcaaaagtaaacaaaattgtaaagaaccgacggactgtggcatctattaagaacgaccctccccccagagataatagagtggttggttcagcacgcgcacggcctagtcaacttcctgagcagtcatcttctgcacaacagaatggtagcgtttcagatatatctccagttcaagctgcaaaaaaggagtttggacctccttcacgtagaaaatctaattgtgtgaaagaagtagaaaaattgcaagaaaaacgagaaaaaagaagattgcaacagcaagaacttagagaaaaaagagcccaggatgtcgatgccacaaatccaaattacgagattatgtgtatgatcagagacttcagagggagcttggactatagacccctcacaacagctgatcctattgatgaacataggatatgtgtttgtgtaagaaaacgaccactcaataaaaaagaaactcagatgaaagatcttgatgtcatcacaatccctagtaaagatgttgtgatggttcatgaacccaaacagaaagtagacttaacaaggtacttagaaaaccagacatttcgttttgattatgcctttgatgactcagctcctaatgaaatggtttacagatttactgccaggccactggtggaaacaatatttgaaaggggcatggctacctgctttgcttatgggcagactggaagtgggaaaactcacactatgggtggtgacttttcaggaaagaaccaggattgctctaagggaatttatgcattagcagctcgagatgtgtttttaatgctgaagaagccaaactataagaaactagaactccaagtatatgcaacattttttgaaatttatagtggaaaggtgtttgacttactaaataggaaaacaaagttaagagtcctagaggatggaaagcagcaggtgcaagtggtagggctgcaggaacgggaggtcaagtgtgtggaagacgtgctgaagctcatcgacatcggcaacagctgcagaacatctggtcagacatctgcaaatgcacactcatctcggagccatgcagtgtttcagatcattcttaggaggaaggggaaactacatggtaaattttctctcatcgacctggctgggaacgaaagaggagctgatacgtccagtgcagacaggcaaaccaggcttgaaggtgctgaaattaataaaagccttttagcactcaaggagtgcatccgagccttaggtagaaataaaccccacactcctttccgagcaagtaaactcactcaggtgttgagagattccttcataggtgagaattctcgcacttgcatgattgccacgatctctccaggaatggcatcctgtgaaaacactcttaatacattaagatatgcaaatagggtgaaagaactgactgtggatccaactgctgctggtgatgtccgtccaataatgcaccatccaccaagccagattgacgacctagagacacagtggggggtggggagttcccctcagagagatgatctgaaacttctttgtgaacaaaatgaagaagaagtttctccacagttgtttactttccacgaagccgtctcccagatggtagagatggaggaacaggttgtggaagaccacagggcagtgttccaggaatccattcgctggatagaagatgaaaaggctctcctagagatgactgaagaagtagactatgatgtagactcatatgctacacagcttgaagctattcttgagcaaaaaatagacattttaactgagttacgagataaagtgaaatcttttcgtgcagcgctacaagaagaagaacaagccagcaagcagattaaccccaagagaccccgagccctctaagttggtatttgctactaaaggatcgctggaatccccaatactgtaacacatggtggtccaactgtaaaggccacttgaacgtttttgaaatcttaagtgtgtggaaaatatcttgtccttcatctgaatgacatttcaattttgtgaaacactcctttgtctacaaaatgcttctagtccaagaggcacaagtaacaattgggattagtgaagtattttgtttcatttacccacatagtgattgcttttcgatatccttgccaattttatttaaaggttgtggaagtaatccagaagtggaaaataggggaaaccacagaatttcctttaactcacatcaattttggtagcaagactgagcagttttgagtcctctgcgtgcatgcatacctcatcagtgatgtacatacttcgcctactcctagggccagttgtggttactcatcctcctgtgccttccctaaggctagcgactgcaggcttctgaaacacagccacgagaagtacattccttgtttgtaactgtaagttcctttattgcgtgtgcattttactgtattgaggcgcgtgtgtgtgtgtgtgactagtcactttggcaggatgagccgtatcagttgaacgggactgcggcctgacagtgggcaagctgctggaccacttcgtcttacgtgtaaagaaatctggaattatgattttaataccatgacatgcgattataactttcttaccactttctctgtaaaaactaaaatataaactagttggtgtataataaaaagtaaagaaattctgagaggacttttatcttaggataatacatatatacatgcagtgtgtgtgcagtggtgttaacaagactcatagtggaatctggtccttagcgatgccgttattgaagttgaagtgtttattagctcaccaaaacgtaacgtactgttaaaggagactggtttctgatgcatgaacatttgtatgtacactgaaagtagtccatagcataagttagatagccaagcatagagtatgtaaccaaccccgggatgtgttgacgacttacaaggcaggtctttccaagctccatctaatacctgggatgtgatggttatttggtgagaatcatatttcacctatagattggtggtaaaataggctactctttaaatggcagcactcatttttatagctgctcgtctaaaaaagaaaactggccaattttcatgtaaatattgtttaaagatatatatatatatgtatatctctaggagttttcccttggttccccctacatagtccagtaggtgaaccaaagaacctcccatggatctcgtgattaactctagggaacctgctgattcagtaggtgaaccaaggggaaatctatgaatagagtcaatgagccagattctttattctcattcacttgtcataaatgagagggtagctgtgaggaatcctaacaccatggtcaaaaagctctgtaaacatgaaatctaaatcaaatgtagattttttcacaatatgcttattaataaatgaaatttatgaaacaaatttagaaataatgtacttcaatataatcacctttgttttggaaggaactcaggttttcttgcagttttatgatatattctatttgtgtttgtttcaaagacaagctgtttaagaaggtaatttttgctgagtacatgcctttaatcccagcaattggaagcaaaggcaggtggatttctgagttcagggccagcctggtgtacatactaagttccaggacggccagctctatgtaccttgtccccagttttgagggtggctgttaatgtagtgggcaataaaggcacaaaattgcttataacttgcaaaatagtttaatgttattggcattggacaggcattgtctttgaaggtcctaatagggatatgttgccttattggctccgtcctgatctgtagtcagtaaacattctgggaggtaagatgagcctcagctttacagagggaagctttagtcagcagaaaactagctgagaaagcctggccaagcagaaacgtctccctaaggtagaagtggtaagagctaactctgcaaagctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]