GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 16:25:23, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_053355               3525 bp    mRNA    linear   ROD 02-JUL-2021
DEFINITION  Rattus norvegicus inhibitor of nuclear factor kappa B kinase
            subunit beta (Ikbkb), mRNA.
ACCESSION   NM_053355
VERSION     NM_053355.3
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3525)
  AUTHORS   Lee S, Shin HJ, Noh C, Kim SI, Ko YK, Lee SY, Lim C, Hong B, Yang
            SY, Kim DW, Lee WH and Kim YH.
  TITLE     IKBKB siRNA-Encapsulated Poly (Lactic-co-Glycolic Acid)
            Nanoparticles Diminish Neuropathic Pain by Inhibiting Microglial
            Activation
  JOURNAL   Int J Mol Sci 22 (11), 5657 (2021)
   PUBMED   34073390
  REMARK    GeneRIF: IKBKB siRNA-Encapsulated Poly (Lactic-co-Glycolic Acid)
            Nanoparticles Diminish Neuropathic Pain by Inhibiting Microglial
            Activation.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3525)
  AUTHORS   Li M, Guo Q, Cai H, Wang H, Ma Z and Zhang X.
  TITLE     miR-218 regulates diabetic nephropathy via targeting IKK-beta and
            modulating NK-kappaB-mediated inflammation
  JOURNAL   J Cell Physiol 235 (4), 3362-3371 (2020)
   PUBMED   31549412
  REMARK    GeneRIF: miR-218 regulates diabetic nephropathy via targeting
            IKK-beta and modulating NK-kappaB-mediated inflammation.
REFERENCE   3  (bases 1 to 3525)
  AUTHORS   Wei SF, Sun JJ, Zhou N, Li XL, Lin Y, Zhang YD, Zhang YR and Wu LY.
  TITLE     Protective effect of RNA interference targeting Ikkbeta on hepatic
            fibrosis in rats
  JOURNAL   J Cell Biochem 120 (11), 18894-18900 (2019)
   PUBMED   31297885
  REMARK    GeneRIF: Protective effect of RNA interference targeting Ikkbeta on
            hepatic fibrosis in rats.
REFERENCE   4  (bases 1 to 3525)
  AUTHORS   Dondelinger Y, Delanghe T, Priem D, Wynosky-Dolfi MA, Sorobetea D,
            Rojas-Rivera D, Giansanti P, Roelandt R, Gropengiesser J,
            Ruckdeschel K, Savvides SN, Heck AJR, Vandenabeele P, Brodsky IE
            and Bertrand MJM.
  TITLE     Serine 25 phosphorylation inhibits RIPK1 kinase-dependent cell
            death in models of infection and inflammation
  JOURNAL   Nat Commun 10 (1), 1729 (2019)
   PUBMED   30988283
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 3525)
  AUTHORS   Cardinez C, Miraghazadeh B, Tanita K, da Silva E, Hoshino A, Okada
            S, Chand R, Asano T, Tsumura M, Yoshida K, Ohnishi H, Kato Z,
            Yamazaki M, Okuno Y, Miyano S, Kojima S, Ogawa S, Andrews TD, Field
            MA, Burgio G, Morio T, Vinuesa CG, Kanegane H and Cook MC.
  TITLE     Gain-of-function IKBKB mutation causes human combined immune
            deficiency
  JOURNAL   J Exp Med 215 (11), 2715-2724 (2018)
   PUBMED   30337470
REFERENCE   6  (bases 1 to 3525)
  AUTHORS   Kupfer R and Scheinman RI.
  TITLE     Measurement of IKK activity in primary rat T cells: rapid
            activation and inactivation
  JOURNAL   J Immunol Methods 266 (1-2), 155-164 (2002)
   PUBMED   12133632
REFERENCE   7  (bases 1 to 3525)
  AUTHORS   Pasparakis M, Courtois G, Hafner M, Schmidt-Supprian M, Nenci A,
            Toksoy A, Krampert M, Goebeler M, Gillitzer R, Israel A, Krieg T,
            Rajewsky K and Haase I.
  TITLE     TNF-mediated inflammatory skin disease in mice with
            epidermis-specific deletion of IKK2
  JOURNAL   Nature 417 (6891), 861-866 (2002)
   PUBMED   12075355
REFERENCE   8  (bases 1 to 3525)
  AUTHORS   Chang NS.
  TITLE     The non-ankyrin C terminus of Ikappa Balpha physically interacts
            with p53 in vivo and dissociates in response to apoptotic stress,
            hypoxia, DNA damage, and transforming growth factor-beta 1-mediated
            growth suppression
  JOURNAL   J Biol Chem 277 (12), 10323-10331 (2002)
   PUBMED   11799106
REFERENCE   9  (bases 1 to 3525)
  AUTHORS   Zhang Y, Sun S, Chen WC, Kaluzhny Y, Chinnappan D, Yu G and Ravid
            K.
  TITLE     Repression of AIM-1 kinase mRNA as part of a program of genes
            regulated by Mpl ligand
  JOURNAL   Biochem Biophys Res Commun 282 (3), 844-849 (2001)
   PUBMED   11401541
REFERENCE   10 (bases 1 to 3525)
  AUTHORS   Nemoto S, DiDonato JA and Lin A.
  TITLE     Coordinate regulation of IkappaB kinases by mitogen-activated
            protein kinase kinase kinase 1 and NF-kappaB-inducing kinase
  JOURNAL   Mol Cell Biol 18 (12), 7336-7343 (1998)
   PUBMED   9819420
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000283.1.
            On Nov 27, 2020 this sequence version replaced NM_053355.2.
            
            Summary: kinase that may be involved in megakaryocyte
            polyploidization [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR8487231.111302.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-83                JACYVU010000283.1  18495577-18495659
            84-210              JACYVU010000283.1  18495931-18496057
            211-305             JACYVU010000283.1  18507242-18507336
            306-423             JACYVU010000283.1  18508705-18508822
            424-493             JACYVU010000283.1  18511444-18511513
            494-582             JACYVU010000283.1  18522123-18522211
            583-672             JACYVU010000283.1  18523199-18523288
            673-797             JACYVU010000283.1  18526734-18526858
            798-905             JACYVU010000283.1  18530417-18530524
            906-1035            JACYVU010000283.1  18533499-18533628
            1036-1230           JACYVU010000283.1  18534493-18534687
            1231-1345           JACYVU010000283.1  18535294-18535408
            1346-1469           JACYVU010000283.1  18537558-18537681
            1470-1621           JACYVU010000283.1  18538250-18538401
            1622-1683           JACYVU010000283.1  18538530-18538591
            1684-1793           JACYVU010000283.1  18539877-18539986
            1794-1843           JACYVU010000283.1  18541183-18541232
            1844-1943           JACYVU010000283.1  18541330-18541429
            1944-2091           JACYVU010000283.1  18541606-18541753
            2092-2219           JACYVU010000283.1  18544208-18544335
            2220-2310           JACYVU010000283.1  18547200-18547290
            2311-3525           JACYVU010000283.1  18548059-18549273
FEATURES             Location/Qualifiers
     source          1..3525
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="16"
                     /map="16q12.5"
     gene            1..3525
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="inhibitor of nuclear factor kappa B kinase subunit
                     beta"
                     /db_xref="GeneID:84351"
                     /db_xref="RGD:621375"
     exon            1..83
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    58..60
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="upstream in-frame stop codon"
     exon            84..210
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     CDS             106..2379
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /EC_number="2.7.11.1"
                     /EC_number="2.7.11.10"
                     /note="IKK-B; NFKBIKB; IKK-beta; I-kappa-B kinase 2;
                     I-kappa-B-kinase beta; nuclear factor NF-kappa-B inhibitor
                     kinase beta; inhibitor of nuclear factor kappa B kinase
                     beta subunit; inhibitor of kappaB kinase beta; inhibitor
                     of kappa light polypeptide gene enhancer in B-cells,
                     kinase beta; serine/threonine protein kinase IKBKB"
                     /codon_start=1
                     /product="inhibitor of nuclear factor kappa-B kinase
                     subunit beta"
                     /protein_id="NP_445807.2"
                     /db_xref="GeneID:84351"
                     /db_xref="RGD:621375"
                     /translation="
MSWSPSLPTQTCGAWEMKERLGTGGFGNVIRWHNQVTGEQIAIKQCRQELSPKNRDRWCLEIQIMRRLNHPNVVAARDVPEGMQNLAPNDLPLLAMEYCQGGDLRRYLNQFENCCGLREGAILTLLSDIASALRYLHENRIIHRDLKPENIVLQQGEKRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQQKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHSKVRQKSEVDIVVSEDLNGTVKFSSSLPFPNNLNSVLAERLEKWLQLMLTWQPRQRGVDPQYGPNGCFRALDDILNLKLVHILNMVTGTIHTYPVMEDESLQSLKTRIREDTGILETDQELLQEAGLVLLPDKPATQCISDSKTNEGLTLDMDLVFLFDNSKMSYETQITPRPQPESVSCVLQEPKRNLSFFQMRKVWGQVWHSIQTLKEDCNRLQQGQRAAMMNLLRNNSCLSKMKNAMASTAQQLKAKLDFFKTSIQIDLEKYREQTEFGITSDKLLLAWREMEQAVEQCGRENDVKVLVERMMALQTDIVDLQRSPMGRKQGGTLDDLEEQARELYRRLREKPRDQRTEGDSQDMVRLLLQAIQSFEKKVRVIYSQLSKTVVCKQKALELLPKVEEVVRLMNEDEKTVVRLQEKRQKELWNLLKIACSKVRGPVSGSPDSMNVSRLSHPGHLMSQPSSACDSLPDSDKKSEELVAEAHALCSRLESALQDTVKQQDRSFTTLDWSWLQMEDEERCGLEQACD"
     misc_feature    148..969
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:214567"
     misc_feature    163..1032
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     Inhibitor of Nuclear Factor-KappaB Kinase (IKK) beta;
                     Region: STKc_IKK_beta; cd14038"
                     /db_xref="CDD:270940"
     misc_feature    order(166..180,190..192,229..231,235..237,325..327,
                     391..402,412..414,418..420,538..540,544..546,550..555,
                     559..561,601..603,610..612,655..666)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="active site"
                     /db_xref="CDD:270940"
     misc_feature    order(166..180,190..192,229..231,235..237,325..327,
                     391..402,412..414,538..540,544..546,550..555,559..561,
                     601..603)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270940"
     misc_feature    order(178..180,412..414,418..420,538..540,544..546,
                     550..552,610..612,655..666)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270940"
     misc_feature    order(430..432,436..438,445..450,457..459,760..762,
                     775..777,859..864,868..870,886..897)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="SDD interface [polypeptide binding]; other site"
                     /db_xref="CDD:270940"
     misc_feature    order(466..468,472..477,577..582)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="ULD interface [polypeptide binding]; other site"
                     /db_xref="CDD:270940"
     misc_feature    598..666
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270940"
     misc_feature    634..636
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by TBK1 and PKC/PRKCZ.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    646..648
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by TBK1, PKC/PRKCZ and PDPK1.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    676..678
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Hydroxyproline. /evidence=ECO:0000250; propagated
                     from UniProtKB/Swiss-Prot (Q9QY78.1); hydroxylation site"
     misc_feature    order(790..792,796..801,811..813)
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="tetramer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:270940"
     misc_feature    1477..1542
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9QY78.1);
                     Region: Leucine-zipper"
     misc_feature    2113..2115
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2119..2121
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2128..2130
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2149..2214
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9QY78.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2149..2151
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2170..2172
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2179..2181
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2194..2196
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2218..2220
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2227..2331
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="I-kappa-kinase-beta NEMO binding domain; Region:
                     IKKbetaNEMObind; pfam12179"
                     /db_xref="CDD:288990"
     misc_feature    2302..2304
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     misc_feature    2314..2331
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9QY78.1);
                     Region: NEMO-binding"
     misc_feature    2323..2325
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /note="Phosphoserine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:O14920; propagated from
                     UniProtKB/Swiss-Prot (Q9QY78.1); phosphorylation site"
     exon            211..305
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            306..423
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            424..493
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            494..582
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            583..672
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            673..797
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            798..905
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            906..1035
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1036..1230
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1231..1345
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1346..1469
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1470..1621
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1622..1683
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1684..1793
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1794..1843
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1844..1943
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            1944..2091
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            2092..2219
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            2220..2310
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
     exon            2311..3525
                     /gene="Ikbkb"
                     /gene_synonym="AIM-1; IKK2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tggcgctgagctggctgcgtggggaccccgagttttcatgtcctcagcgggtgtcgctagcggccccgcggcccccggggcagagttagcagggagggcatcgatatgagctggtcaccttctctcccaacccagacatgtggggcctgggaaatgaaagaacgcctcggaactgggggatttggaaacgtcatccggtggcacaatcaggtgacaggtgaacaaattgccatcaagcaatgccgacaggagctcagccccaagaaccgcgatcgctggtgcctagagatccagatcatgagaaggctgaaccatcccaacgtggtggccgcccgggatgtcccagaggggatgcagaacttggcacccaatgatttgcctctgctggccatggagtactgccaaggaggagacctccggagatacttgaaccagttcgaaaactgctgtggcctccgggaaggagccatcctcaccctgctgagtgacatagcatcggctcttagataccttcatgaaaacagaatcatccaccgggacctgaagccagagaacattgtcctacagcaaggagagaaaagattaatacacaaaattattgatctaggatatgccaaggagctggatcagggcagtctgtgcacgtcatttgtggggaccctgcaatacctggccccagagcttctggagcagcagaagtacaccgtgactgttgactactggagcttcggcaccctggcctttgaatgcatcaccggcttccggccctttctccctaactggcagcctgtgcagtggcactctaaagtccggcagaagagcgaagtggacattgttgttagcgaggacttgaacggaacagtgaagttctcaagttccttacccttccccaataatctcaacagtgtcctggctgagcgtctggagaagtggcttcagctgatgctcacgtggcaacctcggcaaaggggcgtggacccccagtacggtcccaatggctgtttcagggccctcgatgacatcttgaacttaaagctggttcatatcttgaacatggtcacaggcaccattcacacataccctgtgatggaggatgaaagtctgcagagcttaaaaaccagaatccgggaagacacagggatcctggagacagaccaggaactgctgcaggaggcagggctggtgctgctccctgacaagcctgctactcagtgcatctcagacagcaagacaaatgagggcctcacactggacatggatctcgtctttctctttgacaacagtaaaatgtcctatgagactcagatcaccccccgaccccaacctgagagcgtcagctgtgtccttcaggagcccaagcggaacctctccttcttccagatgaggaaagtgtggggccaagtctggcacagcatccaaacgctgaaggaagactgtaaccggctgcagcagggacagcgagctgccatgatgaacctccttcggaataacagctgcctctccaagatgaagaatgccatggcctccacggcgcagcagctcaaggccaagttggacttcttcaaaaccagcatccagattgacctggagaagtacagggagcagacggagtttggcatcacatcggacaaactgctgctggcctggcgggaaatggagcaggccgtggagcagtgtgggcgggagaatgacgtgaaggtcctggtagaacggatgatggcactgcagaccgacattgtggacctacagaggagcccgatgggtcggaagcaggggggcaccttggatgacctagaggaacaagcaagagaactctacagaagactcagggagaagccaagagaccaaaggacagaaggtgacagccaggatatggtacggctgctgctgcaagccatccagagcttcgagaagaaagtgcgggtgatttactctcagctcagtaagaccgtggtttgtaagcagaaggccctggagctgctgcccaaagtagaagaggtggtgaggctcatgaacgaggatgagaagactgtggtccggctccaggagaagcggcagaaggagctctggaacctcctgaagatcgcctgtagcaaagtccgaggtccggtgagtggaagcccagatagcatgaatgtgtctcgacttagtcaccctggtcatctaatgtcccagccttccagtgcctgtgacagcttacctgattcagacaagaaaagtgaagaactggtggccgaagcacacgccctctgctcccggctggaaagcgcgctgcaggacacggtgaagcagcaggaccgaagcttcacgaccctagactggagctggttacagatggaggatgaagaaaggtgtggcctggagcaggcctgtgactgaggtgcccgtgaactggcccgcggctcggcatgtgaggatgctctggtacctccagggggacatcccgctctcctggcagctgcgatccttgcccacagcagcctgtgctggcccagtctacacactggacgtcctccaccacagaagcacaacaatgtcagttacaagcccgtgcggcaacaagactgcagtgctgctacacaaagagcttacgacagacgtctaccttgagtgtttccagacagcagccagcctgtcccctttggactgctgcgggggagggagccctgccctcctcgcctttcagctggggtgtcatctggatccagcttccttagacatttaatcagaagcctgatgattctacgtctttcttcctcttcacttccccctggtaaatgtttctaccttctgtgccggtcgttgtggcaaacggcctttgactaagttgtaatgacggtgataccaagctccctgatgtcccggctcctttaagccacagagcgacttacacagccaggcagaacagaaatgcagctacacatcctgagtcccaaagattacctggagtcaactgtcatggagagaaatggaagatgaaggtcctacaccagcccctcccctgctgagcactgtgtgactctgccacctgtcaggtgtgtgaggacgttgctgcctctcacataagctagcagcgttattaaactggttcgttttataaatagtttctattttttgtaacattactcagatatgtatcctaggctcaagggtgtatttccacagtaatactaccactagtacttctgagctcagagggcaacatcatgggaaatttcgtaagattgaacagcgtatctagatcatgtcatttttacatcacacaaaacttgtgtgtttgcgtgcatatgtgtgtatgaaagcgaagcaggctcagattgtcataaacaggtttatttgattagagaataaagttggaacagagaaatgtcagagcggccaccgcagacacagtatgaagcgtcactggtcacgtgagctcagcggtgctgcatgctttctttcccagagattgatgctgtgcactgggaacctgtttgaaaactccgacaataaagatgctggcttaagctcagcgtaaattca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]