GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:02:46, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_032489               1905 bp    mRNA    linear   PRI 27-SEP-2019
DEFINITION  Homo sapiens acrosin binding protein (ACRBP), mRNA.
ACCESSION   NM_032489
VERSION     NM_032489.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1905)
  AUTHORS   Fu J, Luo B, Guo WW, Zhang QM, Shi L, Hu QP, Chen F, Xiao SW and
            Xie XX.
  TITLE     Down-regulation of cancer/testis antigen OY-TES-1 attenuates
            malignant behaviors of hepatocellular carcinoma cells in vitro
  JOURNAL   Int J Clin Exp Pathol 8 (7), 7786-7797 (2015)
   PUBMED   26339343
  REMARK    GeneRIF: Down regulation of OY-TES-1 increased expression of
            apoptosis-regulated protein caspase-3, and decreased expression of
            cell cycle-regulated protein cyclin E, migration/invasion-regulated
            proteins MMP2 and MMP9.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1905)
  AUTHORS   Hu Q, Fu J, Luo B, Huang M, Guo W, Lin Y, Xie X and Xiao S.
  TITLE     OY-TES-1 may regulate the malignant behavior of liver cancer via
            NANOG, CD9, CCND2 and CDCA3: a bioinformatic analysis combine with
            RNAi and oligonucleotide microarray
  JOURNAL   Oncol. Rep. 33 (4), 1965-1975 (2015)
   PUBMED   25673160
  REMARK    GeneRIF: OY-TES-1 downregulation in liver cancer cells caused 2
            opposite effects on cell proliferation: promotion by upregulating
            CCND2 and CDCA3, and inhibition by CD9 upregulation and NANOG
            downregulation. OY-TES-1 may play multiple roles in liver cancer.
REFERENCE   3  (bases 1 to 1905)
  AUTHORS   Fan,R., Huang,W., Luo,B., Zhang,Q.M., Xiao,S.W. and Xie,X.X.
  TITLE     Cancer testis antigen OY-TES-1: analysis of protein expression in
            ovarian cancer with tissue microarrays
  JOURNAL   Eur. J. Gynaecol. Oncol. 36 (3), 298-303 (2015)
   PUBMED   26189257
  REMARK    GeneRIF: OY-TES-1 was expressed in ovarian cancer (OC) tissues with
            a high proportion, and some of OC tissues presented OY-TES-1
            expression in high level vs OC adjacent tissues.
REFERENCE   4  (bases 1 to 1905)
  AUTHORS   Luo B, Yun X, Fan R, Lin YD, He SJ, Zhang QM, Mo FR, Chen F, Xiao
            SW and Xie XX.
  TITLE     Cancer testis antigen OY-TES-1 expression and serum immunogenicity
            in colorectal cancer: its relationship to clinicopathological
            parameters
  JOURNAL   Int J Clin Exp Pathol 6 (12), 2835-2845 (2013)
   PUBMED   24294369
  REMARK    GeneRIF: OY-TES-1 is frequently expressed in colorectal carcinoma
            and is able to induce humoral immune response spontaneously in CRC
            patients.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1905)
  AUTHORS   Cen YH, Guo WW, Luo B, Lin YD, Zhang QM, Zhou SF, Luo GR, Xiao SW
            and Xie XX.
  TITLE     Knockdown of OY-TES-1 by RNAi causes cell cycle arrest and
            migration decrease in bone marrow-derived mesenchymal stem cells
  JOURNAL   Cell Biol. Int. 36 (10), 917-922 (2012)
   PUBMED   22651134
  REMARK    GeneRIF: The down-regulation of OY-TES-1 expression in bone
            marrow-derived mesenchymal stem cells caused cell growth
            inhibition, cell cycle arrest, apoptosis induction and migration
            ability attenuation.
REFERENCE   6  (bases 1 to 1905)
  AUTHORS   de Mateo S, Castillo J, Estanyol JM, Ballesca JL and Oliva R.
  TITLE     Proteomic characterization of the human sperm nucleus
  JOURNAL   Proteomics 11 (13), 2714-2726 (2011)
   PUBMED   21630459
REFERENCE   7  (bases 1 to 1905)
  AUTHORS   Whitehurst AW, Xie Y, Purinton SC, Cappell KM, Swanik JT, Larson B,
            Girard L, Schorge JO and White MA.
  TITLE     Tumor antigen acrosin binding protein normalizes mitotic spindle
            function to promote cancer cell proliferation
  JOURNAL   Cancer Res. 70 (19), 7652-7661 (2010)
   PUBMED   20876808
  REMARK    GeneRIF: High ACRBP expression correlated with reduced survival
            time and faster relapse among ovarian cancer patients.
REFERENCE   8  (bases 1 to 1905)
  AUTHORS   Okumura H, Noguchi Y, Uenaka A, Aji T, Ono T, Nakagawa K, Aoe M,
            Shimizu N and Nakayama E.
  TITLE     Identification of an HLA-A24-restricted OY-TES-1 epitope recognized
            by cytotoxic T-cells
  JOURNAL   Microbiol. Immunol. 49 (11), 1009-1016 (2005)
   PUBMED   16301813
  REMARK    GeneRIF: We showed identification of HLA-A24-binding OY-TES-1
            peptide, TES(401-409) (KTPFVSPLL) recognized by CD8 T-cells.
REFERENCE   9  (bases 1 to 1905)
  AUTHORS   Ono T, Kurashige T, Harada N, Noguchi Y, Saika T, Niikawa N, Aoe M,
            Nakamura S, Higashi T, Hiraki A, Wada H, Kumon H, Old LJ and
            Nakayama E.
  TITLE     Identification of proacrosin binding protein sp32 precursor as a
            human cancer/testis antigen
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 98 (6), 3282-3287 (2001)
   PUBMED   11248070
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC135892.1.
            On Nov 25, 2018 this sequence version replaced NM_032489.2.
            
            Summary: The protein encoded by this gene is similar to proacrosin
            binding protein sp32 precursor found in mouse, guinea pig, and pig.
            This protein is located in the sperm acrosome and is thought to
            function as a binding protein to proacrosin for packaging and
            condensation of the acrosin zymogen in the acrosomal matrix. This
            protein is a member of the cancer/testis family of antigens and it
            is found to be immunogenic. In normal tissues, this mRNA is
            expressed only in testis, whereas it is detected in a range of
            different tumor types such as bladder, breast, lung, liver, and
            colon. [provided by RefSeq, Jul 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189667.225875.1,
                                           SRR5189667.186649.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000229243.7/ ENSP00000229243.2
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-109               AC135892.1         47407-47515         c
            110-328             AC135892.1         46877-47095         c
            329-423             AC135892.1         46566-46660         c
            424-541             AC135892.1         45303-45420         c
            542-1010            AC135892.1         44220-44688         c
            1011-1143           AC135892.1         43622-43754         c
            1144-1323           AC135892.1         40426-40605         c
            1324-1491           AC135892.1         40143-40310         c
            1492-1575           AC135892.1         39037-39120         c
            1576-1905           AC135892.1         38158-38487         c
FEATURES             Location/Qualifiers
     source          1..1905
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.31"
     gene            1..1905
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /note="acrosin binding protein"
                     /db_xref="GeneID:84519"
                     /db_xref="HGNC:HGNC:17195"
                     /db_xref="MIM:608352"
     exon            1..109
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284377274"
     variation       5
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411811843"
     variation       6
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914567083"
     variation       8
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477290117"
     variation       9
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425903471"
     variation       10
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888634265"
     variation       11
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181520826"
     variation       12
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986166165"
     variation       13
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245086367"
     variation       14
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186591256"
     variation       15
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953274587"
     variation       16
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748807972"
     variation       17
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264499041"
     variation       18
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923211259"
     variation       21
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975882691"
     variation       23
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362569640"
     variation       25
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048592315"
     variation       28
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777321177"
     variation       29
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436542397"
     variation       31
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348741577"
     variation       33
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548223496"
     variation       37
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014634416"
     variation       39
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390776458"
     variation       40
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369051372"
     variation       41
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373155152"
     variation       44
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046372212"
     variation       45
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949440285"
     variation       47
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427503431"
     variation       48
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191943641"
     variation       49
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477839526"
     variation       51
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1565393635"
     variation       51
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244986715"
     variation       52..53
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1483660327"
     variation       53
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780897162"
     variation       58
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274629869"
     variation       60
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203413580"
     variation       61
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350561863"
     variation       62
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116290146"
     variation       63
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:988263912"
     variation       66
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366491274"
     CDS             67..1698
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /note="proacrosin binding protein sp32; cancer/testis
                     antigen 23; cancer/testis antigen OY-TES-1; testicular
                     tissue protein Li 10"
                     /codon_start=1
                     /product="acrosin-binding protein precursor"
                     /protein_id="NP_115878.2"
                     /db_xref="CCDS:CCDS8554.1"
                     /db_xref="GeneID:84519"
                     /db_xref="HGNC:HGNC:17195"
                     /db_xref="MIM:608352"
                     /translation="
MRKPAAGFLPSLLKVLLLPLAPAAAQDSTQASTPGSPLSPTEYERFFALLTPTWKAETTCRLRATHGCRNPTLVQLDQYENHGLVPDGAVCSNLPYASWFESFCQFTHYRCSNHVYYAKRVLCSQPVSILSPNTLKEIEASAEVSPTTMTSPISPHFTVTERQTFQPWPERLSNNVEELLQSSLSLGGQEQAPEHKQEQGVEHRQEPTQEHKQEEGQKQEEQEEEQEEEGKQEEGQGTKEGREAVSQLQTDSEPKFHSESLSSNPSSFAPRVREVESTPMIMENIQELIRSAQEIDEMNEIYDENSYWRNQNPGSLLQLPHTEALLVLCYSIVENTCIITPTAKAWKYMEEEILGFGKSVCDSLGRRHMSTCALCDFCSLKLEQCHSEASLQRQQCDTSHKTPFVSPLLASQSLSIGNQVGSPESGRFYGLDLYGGLHMDFWCARLATKGCEDVRVSGWLQTEFLSFQDGDFPTKICDTDYIQYPNYCSFKSQQCLMRNRNRKVSRMRCLQNETYSALSPGKSEDVVLRWSQEFSTLTLGQFG"
     misc_feature    67..699
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /note="Proacrosin binding protein sp32; Region: PBP_sp32;
                     pfam07222"
                     /db_xref="CDD:284606"
     sig_peptide     67..141
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     142..1695
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /product="acrosin-binding protein"
     variation       67
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011890920"
     variation       72
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463309160"
     variation       75
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922338684"
     variation       78
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324125172"
     variation       80
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936475372"
     variation       81
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143135414"
     variation       82
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200739356"
     variation       87..95
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cttcc"
                     /replace="cttccttcc"
                     /db_xref="dbSNP:772716794"
     variation       91
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307396154"
     variation       92
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427766931"
     variation       99
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758355166"
     variation       102
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149102167"
     variation       103
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423395073"
     variation       109
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363872023"
     exon            110..328
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       111
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322332152"
     variation       112
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050516868"
     variation       115
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753124284"
     variation       116
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76317366"
     variation       117..135
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cctgcc"
                     /replace="cctgcctctggcacctgcc"
                     /db_xref="dbSNP:761201869"
     variation       117
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767834356"
     variation       120
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025154947"
     variation       121
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145112202"
     variation       122
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774944221"
     variation       123
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763551765"
     variation       128
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164633243"
     variation       129
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368916897"
     variation       135..137
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cgc"
                     /replace="cgcgc"
                     /db_xref="dbSNP:776106927"
     variation       135
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761391875"
     variation       136
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200196035"
     variation       140..142
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1318498355"
     variation       140
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189623022"
     variation       143
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11545745"
     variation       145
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201793781"
     variation       148
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775827321"
     variation       150
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768482625"
     variation       153
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202817861"
     variation       156
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764402003"
     variation       158
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489203632"
     variation       164
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923273215"
     variation       168
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265537132"
     variation       174
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243924282"
     variation       175
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357195350"
     variation       180
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235776847"
     variation       181
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746657003"
     variation       183
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228958155"
     variation       185
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775468886"
     variation       186
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316563090"
     variation       187
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1388770713"
     variation       188
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547681353"
     variation       189
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753243999"
     variation       190
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050523562"
     variation       195
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251781607"
     variation       196
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537328321"
     variation       197
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401656481"
     variation       200
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931774794"
     variation       204
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771973803"
     variation       205
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462377398"
     variation       207
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923106658"
     variation       210
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745604390"
     variation       212
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778945771"
     variation       214
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374331481"
     variation       215
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190515108"
     variation       216
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434575640"
     variation       222..223
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1565393434"
     variation       222
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907807595"
     variation       223
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201181204"
     variation       228
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777823615"
     variation       232
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168294941"
     variation       238
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756366387"
     variation       243
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752892968"
     variation       248
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276739488"
     variation       252
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930508082"
     variation       253
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200384019"
     variation       254
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335418681"
     variation       264
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751804265"
     variation       265
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766923238"
     variation       270
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235038099"
     variation       271
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568383765"
     variation       272
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145343092"
     variation       285
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763691389"
     variation       286
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760458702"
     variation       289
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352830150"
     variation       292
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990532603"
     variation       295
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775291443"
     variation       303
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771779784"
     variation       312
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759401934"
     variation       313
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467208888"
     variation       317
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960329346"
     variation       319
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377913404"
     variation       321
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372560335"
     variation       325
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773999362"
     variation       327
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141590474"
     exon            329..423
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       336
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765778558"
     variation       339
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930440159"
     variation       341
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147903154"
     variation       344
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199549378"
     variation       347
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1201963869"
     variation       348
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217093829"
     variation       351
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767252475"
     variation       352
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374945741"
     variation       353
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759082954"
     variation       358
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349125946"
     variation       359
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193028347"
     variation       360
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395928632"
     variation       361
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1455705546"
     variation       362
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286517964"
     variation       363
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767946050"
     variation       366
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1246195162"
     variation       367
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565393308"
     variation       368
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565393303"
     variation       369
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774272288"
     variation       371
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1340206430"
     variation       372..374
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1449943867"
     variation       374
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770621624"
     variation       380
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762752986"
     variation       383
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1320637879"
     variation       384
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144674361"
     variation       388
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866074003"
     variation       390
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:939104513"
     variation       393
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405670172"
     variation       395
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371939983"
     variation       400
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769679577"
     variation       405
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384307251"
     variation       406
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139786267"
     variation       408
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978149516"
     variation       409
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781225787"
     variation       416
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208165075"
     variation       420
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445306562"
     exon            424..541
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       424
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022809146"
     variation       430
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301165204"
     variation       432
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35020360"
     variation       434
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370867055"
     variation       436
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749802705"
     variation       437
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778287779"
     variation       440
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754452777"
     variation       444
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191814874"
     variation       448
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:35729062"
     variation       451
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765971089"
     variation       453
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758023830"
     variation       456
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483668542"
     variation       460
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368620092"
     variation       466
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475594815"
     variation       475
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765011108"
     variation       478
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305396335"
     variation       479
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185315732"
     variation       480
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984064832"
     variation       481
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761796073"
     variation       487
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750357050"
     variation       491
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258148980"
     variation       497
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322165637"
     variation       500
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200286554"
     variation       502
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760697193"
     variation       504
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411523791"
     variation       508
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324135778"
     variation       509
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367996082"
     variation       510
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375082444"
     variation       511
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554829355"
     variation       514
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274145042"
     variation       519
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959386028"
     variation       522
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565392885"
     variation       531
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778495838"
     variation       537
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774916783"
     exon            542..1010
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       545
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371598244"
     variation       550
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760419396"
     variation       551
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760545577"
     variation       552
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485882524"
     variation       557
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770243805"
     variation       564
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213471983"
     variation       566
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993051855"
     variation       567
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748684823"
     variation       568
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:572758651"
     variation       571
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:957975604"
     variation       583
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245061559"
     variation       589
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179936782"
     variation       591
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771581950"
     variation       592
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144940565"
     variation       593
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778564719"
     variation       595
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756852191"
     variation       597
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287207301"
     variation       603
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415266287"
     variation       608
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113186788"
     variation       610
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572201529"
     variation       613
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777589762"
     variation       620..622
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:777861585"
     variation       621
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756067193"
     variation       622
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350826382"
     variation       623
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392693"
     variation       629
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752696343"
     variation       630
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558825862"
     variation       634
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260359373"
     variation       637
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1184313946"
     variation       641
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376933199"
     variation       642
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373212885"
     variation       646
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771849510"
     variation       647
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201620539"
     variation       649..707
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cacaagcagga"
                     /replace="cacaagcaggagcaaggagtggagcacaggcaggagccgacacaagaa
                     cacaagcagga"
                     /db_xref="dbSNP:1338948586"
     variation       651
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763204631"
     variation       656
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773515146"
     variation       658
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565392677"
     variation       659
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770180945"
     variation       662
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762024158"
     variation       665
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293520250"
     variation       666
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777125457"
     variation       669
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535928418"
     variation       671
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745402029"
     variation       674
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778368526"
     variation       677
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770525894"
     variation       681
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169633736"
     variation       682
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748960906"
     variation       685
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777238087"
     variation       686
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367723803"
     variation       687
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752397473"
     variation       688
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567038756"
     variation       689
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251036647"
     variation       692
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021299682"
     variation       697
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198548074"
     variation       701
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146403423"
     variation       702
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253687330"
     variation       703
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196230263"
     variation       710
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1249884832"
     variation       711..714
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:756181680"
     variation       716..720
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="agaaa"
                     /db_xref="dbSNP:1282734704"
     variation       716
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751729156"
     variation       724
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403572891"
     variation       727
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766563766"
     variation       732
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758605145"
     variation       733..752
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="gaagagga"
                     /replace="gaagaggaacaggaagagga"
                     /db_xref="dbSNP:748268820"
     variation       735
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750670447"
     variation       738
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163483094"
     variation       743
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142341550"
     variation       750
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165744210"
     variation       753
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167055663"
     variation       755
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776929000"
     variation       759
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175161898"
     variation       760
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392610"
     variation       763
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479414365"
     variation       765
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764631874"
     variation       767
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370523310"
     variation       770
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761135961"
     variation       772
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773914526"
     variation       773
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532605296"
     variation       774..777
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="gggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1338769205"
     variation       776
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552836560"
     variation       780
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009457737"
     variation       783
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285031082"
     variation       787
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772952796"
     variation       788
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139969601"
     variation       790
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199906590"
     variation       791
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137907685"
     variation       795
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280693299"
     variation       797
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868859399"
     variation       801
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368867411"
     variation       805
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334309547"
     variation       808
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:781088084"
     variation       809
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146183012"
     variation       815
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779797390"
     variation       816
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758507910"
     variation       818
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207207515"
     variation       821
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253908902"
     variation       822
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1441347385"
     variation       823
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406449111"
     variation       826
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750428930"
     variation       829
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467820542"
     variation       830
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765515031"
     variation       835
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187578410"
     variation       837
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754237042"
     variation       842
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764433687"
     variation       844
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760974794"
     variation       846..852
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="tct"
                     /replace="tctatct"
                     /db_xref="dbSNP:771531113"
     variation       849
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374973107"
     variation       858
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775984791"
     variation       864
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201826722"
     variation       865
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374540594"
     variation       869
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767874427"
     variation       871
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389927095"
     variation       874
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285081601"
     variation       875
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949378767"
     variation       877
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767121328"
     variation       878
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184620287"
     variation       879
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286318136"
     variation       880
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769527950"
     variation       883
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141591366"
     variation       884
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377357185"
     variation       887
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746734487"
     variation       889
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780070584"
     variation       890
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758218739"
     variation       891
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759289727"
     variation       892
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746006654"
     variation       895
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165201726"
     variation       896
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425116392"
     variation       898
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192361841"
     variation       899
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757538911"
     variation       901
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138474024"
     variation       903
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756507200"
     variation       904
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373318820"
     variation       906
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:754970264"
     variation       906
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445745081"
     variation       907
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565392519"
     variation       911
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768119587"
     variation       914
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759931574"
     variation       919
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:925220871"
     variation       921
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774027808"
     variation       922
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750015910"
     variation       929
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763436312"
     variation       931
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:751354966"
     variation       935
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761348118"
     variation       937
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270263535"
     variation       939
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140849766"
     variation       941
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150622342"
     variation       946
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768380704"
     variation       947..949
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:866428819"
     variation       968
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760567001"
     variation       970
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775122644"
     variation       974
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1364655666"
     variation       976..978
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="gag"
                     /db_xref="dbSNP:766170115"
     variation       976
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161457701"
     variation       978
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173292988"
     variation       981
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408384654"
     variation       983
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420544117"
     variation       984..988
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="ct"
                     /replace="ctact"
                     /db_xref="dbSNP:1466466744"
     variation       986
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531732103"
     variation       988
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772083932"
     variation       989
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008402777"
     variation       992
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549412182"
     variation       995
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:542563232"
     variation       996
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779103452"
     variation       997
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370463156"
     variation       1005
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771007368"
     exon            1011..1143
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1013
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747357088"
     variation       1014
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148058585"
     variation       1015
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057123504"
     variation       1016
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758950655"
     variation       1020
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147022968"
     variation       1022
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565392340"
     variation       1023
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903251949"
     variation       1024
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763689381"
     variation       1028
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407639973"
     variation       1029
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175906379"
     variation       1031
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025545898"
     variation       1032
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200428818"
     variation       1034
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1013783217"
     variation       1035
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752303255"
     variation       1036
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203931261"
     variation       1037
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758763792"
     variation       1039
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253747906"
     variation       1041
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217791070"
     variation       1043
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1309750463"
     variation       1045
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317510888"
     variation       1046
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283293868"
     variation       1047
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759275347"
     variation       1055
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774114556"
     variation       1058
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766347409"
     variation       1059
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762873728"
     variation       1060
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380586075"
     variation       1062
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773338294"
     variation       1063
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141443837"
     variation       1072
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3741923"
     variation       1073
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942631993"
     variation       1074
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936618403"
     variation       1081
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426892168"
     variation       1085
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748194272"
     variation       1087
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866331954"
     variation       1090
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188924530"
     variation       1093
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183750702"
     variation       1095
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200946482"
     variation       1099
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431343618"
     variation       1100
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201182033"
     variation       1103
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173221318"
     variation       1106
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1253449278"
     variation       1107
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531475457"
     variation       1108
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780534523"
     variation       1110
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34652723"
     variation       1111
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746360356"
     variation       1114
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214384090"
     variation       1124
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565392273"
     variation       1125
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:918306175"
     variation       1130
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779501607"
     variation       1134
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912506881"
     variation       1135
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163057355"
     variation       1137
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755580617"
     variation       1138
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:987008013"
     variation       1140
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565392253"
     variation       1141
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373641669"
     variation       1142
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297808810"
     variation       1143
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767126238"
     exon            1144..1323
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1144
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750168129"
     variation       1146
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1252409544"
     variation       1152
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372213716"
     variation       1157
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480461484"
     variation       1161
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256230173"
     variation       1162
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761778569"
     variation       1163
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324862088"
     variation       1164
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199911393"
     variation       1165
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764217842"
     variation       1166
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760775318"
     variation       1170
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440166899"
     variation       1171..1172
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:573615966"
     variation       1173
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1555077932"
     variation       1174
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866151180"
     variation       1178
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308181351"
     variation       1184
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149157588"
     variation       1185
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750146719"
     variation       1186
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369836113"
     variation       1200
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470698761"
     variation       1202
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774750000"
     variation       1206
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771412740"
     variation       1210
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565391597"
     variation       1213
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477007236"
     variation       1215
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953143489"
     variation       1216
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767089367"
     variation       1218
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361050192"
     variation       1224
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182337737"
     variation       1226
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749793254"
     variation       1228
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778084989"
     variation       1236
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185677027"
     variation       1239
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768217426"
     variation       1241
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200586817"
     variation       1243
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376661923"
     variation       1244
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779701829"
     variation       1250
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565391574"
     variation       1251
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030521206"
     variation       1254
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145271222"
     variation       1255
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150031699"
     variation       1260
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375666497"
     variation       1265
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778764004"
     variation       1266
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357499513"
     variation       1268
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757195399"
     variation       1270
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382811428"
     variation       1275
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965532966"
     variation       1279
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368787320"
     variation       1281
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196146617"
     variation       1287
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903170718"
     variation       1290
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373672314"
     variation       1291
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158904878"
     variation       1294
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763868441"
     variation       1310
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172931655"
     variation       1312
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760865391"
     variation       1314
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752805695"
     variation       1315
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577478690"
     variation       1316
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947283301"
     variation       1317
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774640239"
     variation       1320
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185599902"
     variation       1321
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766780265"
     variation       1322
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763161133"
     exon            1324..1491
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1325
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304702138"
     variation       1325
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1405385200"
     variation       1328
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389655620"
     variation       1329
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150050921"
     variation       1332
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321783782"
     variation       1333
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766471960"
     variation       1341
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572932109"
     variation       1344
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773425168"
     variation       1345
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553167752"
     variation       1346
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114920773"
     variation       1349
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200804936"
     variation       1352
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238379687"
     variation       1353
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143853195"
     variation       1354
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140185383"
     variation       1356
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770439662"
     variation       1359..1360
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1289687078"
     variation       1360
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439257415"
     variation       1368
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749150311"
     variation       1369
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777709026"
     variation       1370
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315965097"
     variation       1375
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285063998"
     variation       1380
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210681778"
     variation       1381
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756182832"
     variation       1386
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758246686"
     variation       1397
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366561438"
     variation       1399
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371102886"
     variation       1400
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444631771"
     variation       1408
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781209644"
     variation       1409
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330734716"
     variation       1410
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146172116"
     variation       1413
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015704623"
     variation       1418
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1555077899"
     variation       1422
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751546130"
     variation       1425
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377398646"
     variation       1428
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141160878"
     variation       1429
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148213737"
     variation       1430
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143977947"
     variation       1433
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754343340"
     variation       1440
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149510028"
     variation       1446
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1238463215"
     variation       1452
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565391428"
     variation       1457
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1177651687"
     variation       1459
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378024205"
     variation       1460
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765159500"
     variation       1467
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759104950"
     variation       1471
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773709218"
     variation       1473
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770685822"
     variation       1477
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762502536"
     variation       1480
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376407616"
     variation       1481
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225300655"
     variation       1482
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321225946"
     variation       1484
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761493407"
     variation       1488
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245570127"
     exon            1492..1575
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1496
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1313496612"
     variation       1501
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395577297"
     variation       1508
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377102670"
     variation       1509
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199953393"
     variation       1512
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769522677"
     variation       1524
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360225859"
     variation       1526
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138068731"
     variation       1543
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1417446786"
     variation       1546
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481575375"
     variation       1548
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776537743"
     variation       1553
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1198598645"
     variation       1554
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768703879"
     variation       1564
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746905904"
     variation       1565
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779982883"
     variation       1568
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772048700"
     variation       1570
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745904260"
     variation       1571
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779126758"
     exon            1576..1905
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /inference="alignment:Splign:2.1.0"
     variation       1576
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301078141"
     variation       1579
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168271412"
     variation       1582
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983225540"
     variation       1583
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377230865"
     variation       1587
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926565801"
     variation       1589
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410477991"
     variation       1603..1605
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="gag"
                     /db_xref="dbSNP:749487726"
     variation       1610
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1565390940"
     variation       1611
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:555669427"
     variation       1612
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774380289"
     variation       1614
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771203599"
     variation       1616
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168368064"
     variation       1617
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563442506"
     variation       1619
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777989155"
     variation       1622
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756470203"
     variation       1623..1625
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1457321300"
     variation       1623
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748496890"
     variation       1624
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781602941"
     variation       1625
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755513976"
     variation       1628
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313167653"
     variation       1635
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750023336"
     variation       1640
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206103820"
     variation       1641
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543641819"
     variation       1642
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756765669"
     variation       1651
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142857326"
     variation       1652
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763758076"
     variation       1668
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202127738"
     variation       1672
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1020828593"
     variation       1675
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775333041"
     variation       1676
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375443462"
     variation       1677
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138951455"
     variation       1682
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759463912"
     variation       1690
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210236089"
     variation       1691
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258567335"
     variation       1692
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149312090"
     variation       1693
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368696301"
     variation       1695
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371627956"
     variation       1697
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1169622963"
     variation       1699
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381944000"
     variation       1700
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770039654"
     variation       1702
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748504394"
     variation       1704
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755724643"
     variation       1705
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756855333"
     variation       1707
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397771522"
     variation       1708
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297153827"
     variation       1709
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326250451"
     variation       1713
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431901276"
     variation       1714
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367935466"
     variation       1715..1717
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1256014735"
     variation       1718
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366108892"
     variation       1719
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199279182"
     variation       1721
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374375773"
     variation       1725
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755759374"
     variation       1731
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752499660"
     variation       1734
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767314803"
     variation       1735
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306418677"
     variation       1740
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371900051"
     variation       1741
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340580811"
     variation       1746
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017874129"
     variation       1747
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751530631"
     variation       1748
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1008989760"
     variation       1757
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565390828"
     variation       1776
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:890608124"
     variation       1785
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1398942629"
     variation       1789
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195048126"
     variation       1799
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545210881"
     variation       1800
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929388448"
     variation       1803
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571984630"
     variation       1804
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:899258065"
     variation       1805..1809
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="ct"
                     /replace="ctact"
                     /db_xref="dbSNP:1385206634"
     variation       1806
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157685669"
     variation       1813
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946979972"
     variation       1814
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752305322"
     variation       1819
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392667674"
     variation       1823
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440851261"
     variation       1825
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395578537"
     variation       1838
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867512372"
     variation       1843
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1304758412"
     variation       1844
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900778468"
     variation       1849
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:938046181"
     variation       1851
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045553"
     variation       1852
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982012794"
     variation       1855
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237279191"
     variation       1863
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538314213"
     variation       1864
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575755465"
     variation       1866
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276095033"
     variation       1871
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372540538"
     variation       1873
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437338880"
     variation       1877
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199368237"
     variation       1884
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345163825"
     variation       1887
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:988007817"
     variation       1894
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556293213"
     variation       1895
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138674706"
     variation       1904
                     /gene="ACRBP"
                     /gene_synonym="CT23; OY-TES-1; SP32"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392780796"
ORIGIN      
ctctctgcggcttggcccgttagaggcggcttgtgtccacgggacgcgggcggatcttctccggccatgaggaagccagccgctggcttccttccctcactcctgaaggtgctgctcctgcctctggcacctgccgcagcccaggattcgactcaggcctccactccaggcagccctctctctcctaccgaatacgaacgcttcttcgcactgctgactccaacctggaaggcagagactacctgccgtctccgtgcaacccacggctgccggaatcccacactcgtccagctggaccaatatgaaaaccacggcttagtgcccgatggtgctgtctgctccaacctcccttatgcctcctggtttgagtctttctgccagttcactcactaccgttgctccaaccacgtctactatgccaagagagtcctgtgttcccagccagtctctattctctcacctaacactctcaaggagatagaagcttcagctgaagtctcacccaccacgatgacctcccccatctcaccccacttcacagtgacagaacgccagaccttccagccctggcctgagaggctcagcaacaacgtggaagagctcctacaatcctccttgtccctgggaggccaggagcaagcgccagagcacaagcaggagcaaggagtggagcacaggcaggagccgacacaagaacacaagcaggaagaggggcagaaacaggaagagcaagaagaggaacaggaagaggagggaaagcaggaagaaggacaggggactaaggagggacgggaggctgtgtctcagctgcagacagactcagagcccaagtttcactctgaatctctatcttctaacccttcctcttttgctccccgggtacgagaagtagagtctactcctatgataatggagaacatccaggagctcattcgatcagcccaggaaatagatgaaatgaatgaaatatatgatgagaactcctactggagaaaccaaaaccctggcagcctcctgcagctgccccacacagaggccttgctggtgctgtgctattcgatcgtggagaatacctgcatcataacccccacagccaaggcctggaagtacatggaggaggagatccttggtttcgggaagtcggtctgtgacagccttgggcggcgacacatgtctacctgtgccctctgtgacttctgctccttgaagctggagcagtgccactcagaggccagcctgcagcggcaacaatgcgacacctcccacaagactccctttgtcagccccttgcttgcctcccagagcctgtccatcggcaaccaggtagggtccccagaatcaggccgcttttacgggctggatttgtacggtgggctccacatggacttctggtgtgcccggcttgccacgaaaggctgtgaagatgtccgagtctctgggtggctccagactgagttccttagcttccaggatggggatttccctaccaagatttgtgacacagactatatccagtacccaaactactgttccttcaaaagccagcagtgtctgatgagaaaccgcaatcggaaggtgtcccgcatgagatgtctgcagaatgagacttacagtgcgctgagccctggcaaaagtgaggacgttgtgcttcgatggagccaggagttcagcaccttgactctaggccagttcggatgagctggcgtctattctgcccacaccccagcccaacctgcccacgttctctattgttttgagaccccattgctttcaggctgccccttctgggtctgttactcggcccctactcacatttccttgggttggagcaacagtcccagagagggccacggtgggagctgcgccctccttaaaagatgactttacataaaatgttgatcttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]