LOCUS       NM_031702               1215 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus claudin 7 (Cldn7), mRNA.
ACCESSION   NM_031702 XM_006246805
VERSION     NM_031702.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1215)
  AUTHORS   Thuma F, Heiler S, Schnolzer M and Zoller M.
  TITLE     Palmitoylated claudin7 captured in glycolipid-enriched membrane
            microdomains promotes metastasis via associated transmembrane and
            cytosolic molecules
  JOURNAL   Oncotarget 7 (21), 30659-30677 (2016)
   PUBMED   27120791
  REMARK    GeneRIF: Pancreatic adenocarcinoma cell line ASMLL-claudin7 (cld7)
            knockdown (kd) and ASML-cld7 mutated palmitoylation cells show
            reduced motility and invasiveness.
REFERENCE   2  (bases 1 to 1215)
  AUTHORS   Thuma F and Zoller M.
  TITLE     EpCAM-associated claudin-7 supports lymphatic spread and drug
            resistance in rat pancreatic cancer
  JOURNAL   Int J Cancer 133 (4), 855-866 (2013)
   PUBMED   23390083
  REMARK    GeneRIF: cld7 supports tumorigenic features of EpC by provoking EpC
            cleavage and thereby its cotranscription factor activity
REFERENCE   3  (bases 1 to 1215)
  AUTHORS   Poon CE, Madawala RJ, Day ML and Murphy CR.
  TITLE     Claudin 7 is reduced in uterine epithelial cells during early
            pregnancy in the rat
  JOURNAL   Histochem Cell Biol 139 (4), 583-593 (2013)
   PUBMED   23180307
  REMARK    GeneRIF: claudin 7 demonstrates a distinct basal and lateral
            localisation in the uterine luminal and glandular epithelium
            throughout early pregnancy
REFERENCE   4  (bases 1 to 1215)
  AUTHORS   Lu J, Zhang S, Nakano H, Simmons DG, Wang S, Kong S, Wang Q, Shen
            L, Tu Z, Wang W, Wang B, Wang H, Wang Y, van Es JH, Clevers H,
            Leone G, Cross JC and Wang H.
  TITLE     A positive feedback loop involving Gcm1 and Fzd5 directs chorionic
            branching morphogenesis in the placenta
  JOURNAL   PLoS Biol 11 (4), e1001536 (2013)
   PUBMED   23610556
REFERENCE   5  (bases 1 to 1215)
  AUTHORS   Guillemot L, Schneider Y, Brun P, Castagliuolo I, Pizzuti D,
            Martines D, Jond L, Bongiovanni M and Citi S.
  TITLE     Cingulin is dispensable for epithelial barrier function and tight
            junction structure, and plays a role in the control of claudin-2
            expression and response to duodenal mucosa injury
  JOURNAL   J Cell Sci 125 (Pt 21), 5005-5014 (2012)
   PUBMED   22946046
REFERENCE   6  (bases 1 to 1215)
  AUTHORS   Tatum R, Zhang Y, Lu Q, Kim K, Jeansonne BG and Chen YH.
  TITLE     WNK4 phosphorylates ser(206) of claudin-7 and promotes paracellular
            Cl(-) permeability
  JOURNAL   FEBS Lett 581 (20), 3887-3891 (2007)
   PUBMED   17651736
  REMARK    GeneRIF: Wnk4 phosphorylates ser(206) of Cldn7 and promotes
            paracellular Cl-ion permeability.
REFERENCE   7  (bases 1 to 1215)
  AUTHORS   Yovchev MI, Grozdanov PN, Joseph B, Gupta S and Dabeva MD.
  TITLE     Novel hepatic progenitor cell surface markers in the adult rat
            liver
  JOURNAL   Hepatology 45 (1), 139-149 (2007)
   PUBMED   17187413
  REMARK    GeneRIF: We identified novel cell surface markers specific for
            hepatic progenitor/oval cells. Six are unique for the adult
            progenitors (CD133, claudin-7, cadherin 22, mucin-1, ros-1, Gabrp).
REFERENCE   8  (bases 1 to 1215)
  AUTHORS   Fujita H, Chiba H, Yokozaki H, Sakai N, Sugimoto K, Wada T, Kojima
            T, Yamashita T and Sawada N.
  TITLE     Differential expression and subcellular localization of claudin-7,
            -8, -12, -13, and -15 along the mouse intestine
  JOURNAL   J Histochem Cytochem 54 (8), 933-944 (2006)
   PUBMED   16651389
REFERENCE   9  (bases 1 to 1215)
  AUTHORS   Ladwein M, Pape UF, Schmidt DS, Schnolzer M, Fiedler S, Langbein L,
            Franke WW, Moldenhauer G and Zoller M.
  TITLE     The cell-cell adhesion molecule EpCAM interacts directly with the
            tight junction protein claudin-7
  JOURNAL   Exp Cell Res 309 (2), 345-357 (2005)
   PUBMED   16054130
  REMARK    GeneRIF: An association between claudin-7 and EpCAM/Tacstd1 is
            noted in rat and human tumors and in non-transformed tissues of the
            gastrointestinal tract.
REFERENCE   10 (bases 1 to 1215)
  AUTHORS   Morita K, Furuse M, Fujimoto K and Tsukita S.
  TITLE     Claudin multigene family encoding four-transmembrane domain protein
            components of tight junction strands
  JOURNAL   Proc Natl Acad Sci U S A 96 (2), 511-516 (1999)
   PUBMED   9892664
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000220.1.
            
            On or before Dec 5, 2020 this sequence version replaced
            XM_006246805.3, NM_031702.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC159404.1, BQ195179.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-622               JACYVU010000220.1  11514831-11515452
            623-787             JACYVU010000220.1  11516240-11516404
            788-872             JACYVU010000220.1  11516516-11516600
            873-1215            JACYVU010000220.1  11516690-11517032
FEATURES             Location/Qualifiers
     source          1..1215
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q24"
     gene            1..1215
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="claudin 7"
                     /db_xref="GeneID:65132"
                     /db_xref="RGD:68432"
     exon            1..622
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    388..390
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="upstream in-frame stop codon"
     CDS             400..1035
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /codon_start=1
                     /product="claudin-7 precursor"
                     /protein_id="NP_113890.1"
                     /db_xref="GeneID:65132"
                     /db_xref="RGD:68432"
                     /translation="

MANSGLQLLGFSMAMLGWVGLIASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALPAATQATRALMIVSLVLGFLAMFVATMGMKCTRCGGDDKVKKARIAMTGGIIFIVAGLAALVACSWIGHQIVTDFYNPLTPMNIKYEFGPAIFIGWAGSALVLLGGALLSCSCPGSESKAAYRAPRSYPKSNSSKEYV"

     sig_peptide     400..471
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    409..912
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; pfam00822"
                     /db_xref="CDD:395662"
     misc_feature    421..483
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
                     transmembrane region"
     misc_feature    643..705
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
                     transmembrane region"
     misc_feature    757..819
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
                     transmembrane region"
     misc_feature    880..942
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
                     transmembrane region"
     misc_feature    1027..1032
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
                     Region: Interactions with TJP1, TJP2 and TJP3.
                     /evidence=ECO:0000250"
     exon            623..787
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /inference="alignment:Splign:2.1.0"
     exon            788..872
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /inference="alignment:Splign:2.1.0"
     exon            873..1215
                     /gene="Cldn7"
                     /gene_synonym="cld-7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgccgacttcaccgcctgctccttcgctgcgcaccgcagcccgggacccaagggcccgcagactttctggggccacgccctaacagcccctccacttcttggggaagtctcagagcacgcctgagggaaccgcctggccttcggggaccgcttttgtctggaaccagtccttcgagcgaagccggttccctcagttgtgagagtgtcgcttcaccggaggggacgatttgtgtttggctcggttaacaagatttttagttacccggtcaaaaaaattttttttctcctctgggtgacttaaatctctatacaaaatttcttgtgtggctgctccccagatttttgttttactatagggtcgccctcccggcgcgtcccatcttttctgagacaaggaaatggctaactcgggcctgcaactactgggcttttcaatggccatgcttggctgggtgggtctgatagcgagcactgctatcccacagtggcagatgagctcctatgcaggcgacaacatcatcacagcccaggccatgtacaaggggctctggatggagtgtgtcacgcagagtaccggcatgatgagctgcaaaatgtacgactcggtgcttgccctgccagcggccacgcaggccactcgagccttaatgattgtgtccttggtgttgggcttcttggccatgtttgtcgccacgatgggcatgaaatgcacacgctgtgggggagatgacaaagtgaagaaggcccgcatagctatgactggaggcattattttcatcgtggcaggtcttgctgctttggtagcatgctcctggattggtcatcagattgtcacagacttttataaccccttgacgcccatgaatattaagtacgagtttggtcctgccatctttatcggctgggcagggtctgctctggtccttctgggaggggccctgctctcttgctcctgccccggcagtgaaagcaaagctgcataccgtgcaccccgctcctaccctaagtccaactcctctaaggaatacgtgtgagctggggaccccagcctgtgggcaaggtgtgaggcaaaggcctcctggtcactccaccgccaaacaccatgtatagttccctgtgggaggggggggagggccgaggggggtgggtgggagaggaagacaaaacatggggagggtgtgcttttgtacagtaataaaattaagttttggaaa

//