ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-17 12:51:01, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_031702 1215 bp mRNA linear ROD 30-APR-2025 DEFINITION Rattus norvegicus claudin 7 (Cldn7), mRNA. ACCESSION NM_031702 XM_006246805 VERSION NM_031702.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1215) AUTHORS Thuma,F., Heiler,S., Schnolzer,M. and Zoller,M. TITLE Palmitoylated claudin7 captured in glycolipid-enriched membrane microdomains promotes metastasis via associated transmembrane and cytosolic molecules JOURNAL Oncotarget 7 (21), 30659-30677 (2016) PUBMED 27120791 REMARK GeneRIF: Pancreatic adenocarcinoma cell line ASMLL-claudin7 (cld7) knockdown (kd) and ASML-cld7 mutated palmitoylation cells show reduced motility and invasiveness. REFERENCE 2 (bases 1 to 1215) AUTHORS Thuma,F. and Zoller,M. TITLE EpCAM-associated claudin-7 supports lymphatic spread and drug resistance in rat pancreatic cancer JOURNAL Int J Cancer 133 (4), 855-866 (2013) PUBMED 23390083 REMARK GeneRIF: cld7 supports tumorigenic features of EpC by provoking EpC cleavage and thereby its cotranscription factor activity REFERENCE 3 (bases 1 to 1215) AUTHORS Poon,C.E., Madawala,R.J., Day,M.L. and Murphy,C.R. TITLE Claudin 7 is reduced in uterine epithelial cells during early pregnancy in the rat JOURNAL Histochem Cell Biol 139 (4), 583-593 (2013) PUBMED 23180307 REMARK GeneRIF: claudin 7 demonstrates a distinct basal and lateral localisation in the uterine luminal and glandular epithelium throughout early pregnancy REFERENCE 4 (bases 1 to 1215) AUTHORS Lu,J., Zhang,S., Nakano,H., Simmons,D.G., Wang,S., Kong,S., Wang,Q., Shen,L., Tu,Z., Wang,W., Wang,B., Wang,H., Wang,Y., van Es,J.H., Clevers,H., Leone,G., Cross,J.C. and Wang,H. TITLE A positive feedback loop involving Gcm1 and Fzd5 directs chorionic branching morphogenesis in the placenta JOURNAL PLoS Biol 11 (4), e1001536 (2013) PUBMED 23610556 REFERENCE 5 (bases 1 to 1215) AUTHORS Guillemot,L., Schneider,Y., Brun,P., Castagliuolo,I., Pizzuti,D., Martines,D., Jond,L., Bongiovanni,M. and Citi,S. TITLE Cingulin is dispensable for epithelial barrier function and tight junction structure, and plays a role in the control of claudin-2 expression and response to duodenal mucosa injury JOURNAL J Cell Sci 125 (Pt 21), 5005-5014 (2012) PUBMED 22946046 REFERENCE 6 (bases 1 to 1215) AUTHORS Tatum,R., Zhang,Y., Lu,Q., Kim,K., Jeansonne,B.G. and Chen,Y.H. TITLE WNK4 phosphorylates ser(206) of claudin-7 and promotes paracellular Cl(-) permeability JOURNAL FEBS Lett 581 (20), 3887-3891 (2007) PUBMED 17651736 REMARK GeneRIF: Wnk4 phosphorylates ser(206) of Cldn7 and promotes paracellular Cl-ion permeability. REFERENCE 7 (bases 1 to 1215) AUTHORS Yovchev,M.I., Grozdanov,P.N., Joseph,B., Gupta,S. and Dabeva,M.D. TITLE Novel hepatic progenitor cell surface markers in the adult rat liver JOURNAL Hepatology 45 (1), 139-149 (2007) PUBMED 17187413 REMARK GeneRIF: We identified novel cell surface markers specific for hepatic progenitor/oval cells. Six are unique for the adult progenitors (CD133, claudin-7, cadherin 22, mucin-1, ros-1, Gabrp). REFERENCE 8 (bases 1 to 1215) AUTHORS Fujita,H., Chiba,H., Yokozaki,H., Sakai,N., Sugimoto,K., Wada,T., Kojima,T., Yamashita,T. and Sawada,N. TITLE Differential expression and subcellular localization of claudin-7, -8, -12, -13, and -15 along the mouse intestine JOURNAL J Histochem Cytochem 54 (8), 933-944 (2006) PUBMED 16651389 REFERENCE 9 (bases 1 to 1215) AUTHORS Ladwein,M., Pape,U.F., Schmidt,D.S., Schnolzer,M., Fiedler,S., Langbein,L., Franke,W.W., Moldenhauer,G. and Zoller,M. TITLE The cell-cell adhesion molecule EpCAM interacts directly with the tight junction protein claudin-7 JOURNAL Exp Cell Res 309 (2), 345-357 (2005) PUBMED 16054130 REMARK GeneRIF: An association between claudin-7 and EpCAM/Tacstd1 is noted in rat and human tumors and in non-transformed tissues of the gastrointestinal tract. REFERENCE 10 (bases 1 to 1215) AUTHORS Morita,K., Furuse,M., Fujimoto,K. and Tsukita,S. TITLE Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands JOURNAL Proc Natl Acad Sci U S A 96 (2), 511-516 (1999) PUBMED 9892664 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000010.1. On or before Dec 5, 2020 this sequence version replaced XM_006246805.3, NM_031702.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC159404.1, BQ195179.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760383, SAMEA5760400 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-622 JAXUCZ010000010.1 55188670-55189291 623-787 JAXUCZ010000010.1 55190079-55190243 788-872 JAXUCZ010000010.1 55190355-55190439 873-1215 JAXUCZ010000010.1 55190529-55190871 FEATURES Location/Qualifiers source 1..1215 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="10" /map="10q24" gene 1..1215 /gene="Cldn7" /gene_synonym="cld-7" /note="claudin 7" /db_xref="GeneID:65132" /db_xref="RGD:68432" exon 1..622 /gene="Cldn7" /gene_synonym="cld-7" /inference="alignment:Splign:2.1.0" misc_feature 388..390 /gene="Cldn7" /gene_synonym="cld-7" /note="upstream in-frame stop codon" CDS 400..1035 /gene="Cldn7" /gene_synonym="cld-7" /codon_start=1 /product="claudin-7" /protein_id="NP_113890.1" /db_xref="GeneID:65132" /db_xref="RGD:68432" /translation="
MANSGLQLLGFSMAMLGWVGLIASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALPAATQATRALMIVSLVLGFLAMFVATMGMKCTRCGGDDKVKKARIAMTGGIIFIVAGLAALVACSWIGHQIVTDFYNPLTPMNIKYEFGPAIFIGWAGSALVLLGGALLSCSCPGSESKAAYRAPRSYPKSNSSKEYV"
misc_feature 409..912
/gene="Cldn7"
/gene_synonym="cld-7"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; pfam00822"
/db_xref="CDD:395662"
misc_feature 421..483
/gene="Cldn7"
/gene_synonym="cld-7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
transmembrane region"
misc_feature 643..705
/gene="Cldn7"
/gene_synonym="cld-7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
transmembrane region"
misc_feature 757..819
/gene="Cldn7"
/gene_synonym="cld-7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
transmembrane region"
misc_feature 880..942
/gene="Cldn7"
/gene_synonym="cld-7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
transmembrane region"
misc_feature 1027..1032
/gene="Cldn7"
/gene_synonym="cld-7"
/note="propagated from UniProtKB/Swiss-Prot (Q9Z1L1.2);
Region: Interactions with TJP1, TJP2 and TJP3.
/evidence=ECO:0000250"
exon 623..787
/gene="Cldn7"
/gene_synonym="cld-7"
/inference="alignment:Splign:2.1.0"
exon 788..872
/gene="Cldn7"
/gene_synonym="cld-7"
/inference="alignment:Splign:2.1.0"
exon 873..1215
/gene="Cldn7"
/gene_synonym="cld-7"
/inference="alignment:Splign:2.1.0"
ORIGIN
ctgccgacttcaccgcctgctccttcgctgcgcaccgcagcccgggacccaagggcccgcagactttctggggccacgccctaacagcccctccacttcttggggaagtctcagagcacgcctgagggaaccgcctggccttcggggaccgcttttgtctggaaccagtccttcgagcgaagccggttccctcagttgtgagagtgtcgcttcaccggaggggacgatttgtgtttggctcggttaacaagatttttagttacccggtcaaaaaaattttttttctcctctgggtgacttaaatctctatacaaaatttcttgtgtggctgctccccagatttttgttttactatagggtcgccctcccggcgcgtcccatcttttctgagacaaggaaatggctaactcgggcctgcaactactgggcttttcaatggccatgcttggctgggtgggtctgatagcgagcactgctatcccacagtggcagatgagctcctatgcaggcgacaacatcatcacagcccaggccatgtacaaggggctctggatggagtgtgtcacgcagagtaccggcatgatgagctgcaaaatgtacgactcggtgcttgccctgccagcggccacgcaggccactcgagccttaatgattgtgtccttggtgttgggcttcttggccatgtttgtcgccacgatgggcatgaaatgcacacgctgtgggggagatgacaaagtgaagaaggcccgcatagctatgactggaggcattattttcatcgtggcaggtcttgctgctttggtagcatgctcctggattggtcatcagattgtcacagacttttataaccccttgacgcccatgaatattaagtacgagtttggtcctgccatctttatcggctgggcagggtctgctctggtccttctgggaggggccctgctctcttgctcctgccccggcagtgaaagcaaagctgcataccgtgcaccccgctcctaccctaagtccaactcctctaaggaatacgtgtgagctggggaccccagcctgtgggcaaggtgtgaggcaaaggcctcctggtcactccaccgccaaacaccatgtatagttccctgtgggaggggggggagggccgaggggggtgggtgggagaggaagacaaaacatggggagggtgtgcttttgtacagtaataaaattaagttttggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]