GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-30 04:06:15, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_031070               3376 bp    mRNA    linear   ROD 29-JUL-2025
DEFINITION  Rattus norvegicus neural EGFL like 2 (Nell2), mRNA.
ACCESSION   NM_031070 XM_346813
VERSION     NM_031070.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3376)
  AUTHORS   Ha,C.M., Kim,D.H., Lee,T.H., Kim,H.R., Choi,J., Kim,Y., Kang,D.,
            Park,J.W., Ojeda,S.R., Jeong,J.K. and Lee,B.J.
  TITLE     Transcriptional Regulatory Role of NELL2 in Preproenkephalin Gene
            Expression
  JOURNAL   Mol Cells 45 (8), 537-549 (2022)
   PUBMED   35950455
  REMARK    GeneRIF: Transcriptional Regulatory Role of NELL2 in
            Preproenkephalin Gene Expression.
REFERENCE   2  (bases 1 to 3376)
  AUTHORS   Niu,W. and Jiang,L.
  TITLE     A seven-gene prognostic model related to immune checkpoint PD-1
            revealing overall survival in patients with lung adenocarcinoma
  JOURNAL   Math Biosci Eng 18 (5), 6136-6154 (2021)
   PUBMED   34517527
REFERENCE   3  (bases 1 to 3376)
  AUTHORS   Kim,H.R., Kim,D.H., An,J.Y., Kang,D., Park,J.W., Hwang,E.M.,
            Seo,E.J., Jang,I.H., Ha,C.M. and Lee,B.J.
  TITLE     NELL2 Function in Axon Development of Hippocampal Neurons
  JOURNAL   Mol Cells 43 (6), 581-589 (2020)
   PUBMED   32597395
  REMARK    GeneRIF: NELL2 Function in Axon Development of Hippocampal Neurons.
REFERENCE   4  (bases 1 to 3376)
  AUTHORS   Jeong,J.K., Kim,J.G., Kim,H.R., Lee,T.H., Park,J.W. and Lee,B.J.
  TITLE     A Role of Central NELL2 in the Regulation of Feeding Behavior in
            Rats
  JOURNAL   Mol Cells 40 (3), 186-194 (2017)
   PUBMED   28301916
  REMARK    GeneRIF: Report shows that neural tissue-enriched multifunctional
            protein, NELL2 is a regulatory component of feeding behavior,
            possibly through a modulation of neuronal activity in the
            hypothalamus.
REFERENCE   5  (bases 1 to 3376)
  AUTHORS   Zhou,S.S. and Li,P.
  TITLE     Effects of NELL2 on the regulation of GnRH expression and puberty
            in female rats
  JOURNAL   Genet Mol Res 13 (3), 6672-6682 (2014)
   PUBMED   25177948
  REMARK    GeneRIF: Data indicate that RNA interference of NEL-like protein 2
            (NELL2) reduced NELL2 and gonadotropin-releasing hormone (GnRH)
            expression at multiple stages of sexual development.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3376)
  AUTHORS   Aihara,K., Kuroda,S., Kanayama,N., Matsuyama,S., Tanizawa,K. and
            Horie,M.
  TITLE     A neuron-specific EGF family protein, NELL2, promotes survival of
            neurons through mitogen-activated protein kinases
  JOURNAL   Brain Res Mol Brain Res 116 (1-2), 86-93 (2003)
   PUBMED   12941464
REFERENCE   7  (bases 1 to 3376)
  AUTHORS   Kim,H., Ha,C.M., Choi,J., Choi,E.J., Jeon,J., Kim,C., Park,S.K.,
            Kang,S.S., Kim,K. and Lee,B.J.
  TITLE     Ontogeny and the possible function of a novel epidermal growth
            factor-like repeat domain-containing protein, NELL2, in the rat
            brain
  JOURNAL   J Neurochem 83 (6), 1389-1400 (2002)
   PUBMED   12472893
  REMARK    GeneRIF: NELL2 may play an important role in the development of the
            CNS as well as maintenance of neural functions, by regulating the
            intracellular machinery involving Ca2+ signaling, synaptic
            transport and/or release of vesicles
REFERENCE   8  (bases 1 to 3376)
  AUTHORS   Kuroda,S. and Tanizawa,K.
  TITLE     Involvement of epidermal growth factor-like domain of NELL proteins
            in the novel protein-protein interaction with protein kinase C
  JOURNAL   Biochem Biophys Res Commun 265 (3), 752-757 (1999)
   PUBMED   10600492
REFERENCE   9  (bases 1 to 3376)
  AUTHORS   Kuroda,S., Oyasu,M., Kawakami,M., Kanayama,N., Tanizawa,K.,
            Saito,N., Abe,T., Matsuhashi,S. and Ting,K.
  TITLE     Biochemical characterization and expression analysis of neural
            thrombospondin-1-like proteins NELL1 and NELL2
  JOURNAL   Biochem Biophys Res Commun 265 (1), 79-86 (1999)
   PUBMED   10548494
REFERENCE   10 (bases 1 to 3376)
  AUTHORS   Beckmann,G., Hanke,J., Bork,P. and Reich,J.G.
  TITLE     Merging extracellular domains: fold prediction for laminin G-like
            and amino-terminal thrombospondin-like modules based on homology to
            pentraxins
  JOURNAL   J Mol Biol 275 (5), 725-730 (1998)
   PUBMED   9480764
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000007.1.
            
            On Mar 18, 2021 this sequence version replaced NM_031070.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY089719.1, U48245.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760389 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-256               JAXUCZ010000007.1  128541872-128542127 c
            257-342             JAXUCZ010000007.1  128541198-128541283 c
            343-471             JAXUCZ010000007.1  128540665-128540793 c
            472-622             JAXUCZ010000007.1  128473333-128473483 c
            623-796             JAXUCZ010000007.1  128442600-128442773 c
            797-893             JAXUCZ010000007.1  128442405-128442501 c
            894-966             JAXUCZ010000007.1  128440191-128440263 c
            967-1049            JAXUCZ010000007.1  128439936-128440018 c
            1050-1178           JAXUCZ010000007.1  128438955-128439083 c
            1179-1281           JAXUCZ010000007.1  128437285-128437387 c
            1282-1373           JAXUCZ010000007.1  128399684-128399775 c
            1374-1476           JAXUCZ010000007.1  128396324-128396426 c
            1477-1605           JAXUCZ010000007.1  128386874-128387002 c
            1606-1731           JAXUCZ010000007.1  128353465-128353590 c
            1732-1854           JAXUCZ010000007.1  128306889-128307011 c
            1855-1950           JAXUCZ010000007.1  128304154-128304249 c
            1951-2091           JAXUCZ010000007.1  128245333-128245473 c
            2092-2285           JAXUCZ010000007.1  128235375-128235568 c
            2286-2462           JAXUCZ010000007.1  128234152-128234328 c
            2463-2687           JAXUCZ010000007.1  128231985-128232209 c
            2688-3376           JAXUCZ010000007.1  128222333-128223021 c
FEATURES             Location/Qualifiers
     source          1..3376
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q35"
     gene            1..3376
                     /gene="Nell2"
                     /note="neural EGFL like 2"
                     /db_xref="GeneID:81734"
                     /db_xref="RGD:620999"
     exon            1..256
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    135..137
                     /gene="Nell2"
                     /note="upstream in-frame stop codon"
     exon            257..342
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     CDS             279..2738
                     /gene="Nell2"
                     /note="protein kinase C-binding protein NELL2; NEL-like
                     protein 2; rCG50753-like; NEL-like 2"
                     /codon_start=1
                     /product="protein kinase C-binding protein NELL2
                     precursor"
                     /protein_id="NP_112332.2"
                     /db_xref="GeneID:81734"
                     /db_xref="RGD:620999"
                     /translation="
MHAMESRVLLRTFCVILGLEAVWGLGVDPSLQIDVLSELELGESTAGVRQVPGLHNGTKAFLFQDSPRSIKAPIATAERFFQKLRNKHEFTILVTLKQIHLNSGVILSIHHLDHRYLELESSGHRNEIRLHYRSGTHRPHTEVFPYILADAKWHKLSLAFSASHLILHIDCNKIYERVVEMPSTDLPLGTTFWLGQRNNAHGYFKGIMQDVQLLVMPQGFIAQCPDLNRTCPTCNDFHGLVQKIMELQDILSKTSAKLSRAEQRMNRLDQCYCERTCTMKGTTYREFESWTDGCKNCTCLNGTIQCETLVCPAPDCPAKSAPAYVDGKCCKECKSTCQFQGRSYFEGERSTVFSASGMCVLYECKDQTMKLVENAGCPALDCPESHQIALSHSCCKVCKGYDFCSEKHTCMENSVCRNLNDRAVCSCRDGFRALREDNAYCEDIDECAEGRHYCRENTMCVNTPGSFLCICQTGYIRIDDYSCTEHDECLTNQHNCDENALCFNTVGGHNCVCKPGYTGNGTTCKAFCKDGCRNGGACIAANVCACPQGFTGPSCETDIDECSEGFVQCDSRANCINLPGWYHCECRDGYHDNGMFAPGGESCEDIDECGTGRHSCANDTICFNLDGGYDCRCPHGKNCTGDCVHDGKVKHNGQIWVLENDRCSVCSCQTGFVMCRRMVCDCENPTVDLSCCPECDPRLSSQCLHQNGETVYNSGDTWVQDCRQCRCLQGEVDCWPLACPEVECEFSVLPENECCPRCVTDPCQADTIRNDITKTCLDEMNVVRFTGSSWIKHGTECTLCQCKNGHVCCSVDPQCLQEL"
     sig_peptide     279..350
                     /gene="Nell2"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     351..2735
                     /gene="Nell2"
                     /product="Protein kinase C-binding protein NELL2.
                     /id=PRO_0000007668"
                     /note="propagated from UniProtKB/Swiss-Prot (Q62918.2)"
     misc_feature    372..929
                     /gene="Nell2"
                     /note="Thrombospondin N-terminal -like domains; Region:
                     TSPN; smart00210"
                     /db_xref="CDD:214560"
     misc_feature    444..446
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    960..962
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    1107..1277
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:450195"
     misc_feature    1164..1166
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    1179..1181
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    1605..1700
                     /gene="Nell2"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:429571"
     misc_feature    1743..1850
                     /gene="Nell2"
                     /note="EGF domain; Region: EGF_3; pfam12947"
                     /db_xref="CDD:463759"
     misc_feature    1836..1838
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000250|UniProtKB:Q99435; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    1929..1931
                     /gene="Nell2"
                     /note="O-linked (GlcNAc...) threonine.
                     /evidence=ECO:0000250|UniProtKB:Q99435; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    1950..2054
                     /gene="Nell2"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:214542"
     misc_feature    order(1950..1952,1959..1961,2007..2009)
                     /gene="Nell2"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2091..2186
                     /gene="Nell2"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:429571"
     misc_feature    order(2091..2093,2100..2102,2148..2150)
                     /gene="Nell2"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2130..2132
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    2190..2192
                     /gene="Nell2"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
     misc_feature    2205..2363
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:450195"
     misc_feature    2400..2552
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:450195"
     exon            343..471
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            472..622
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            623..796
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            797..893
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            894..966
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            967..1049
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1050..1178
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1179..1281
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1282..1373
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1374..1476
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1477..1605
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1606..1731
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1732..1854
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1855..1950
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1951..2091
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2092..2285
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2286..2462
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2463..2687
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2688..3376
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctcactacccatctccgcctgtctccctagcgtgtccagcttcacctaggagtcctgtgtgctttggctgggttccttttcccgcccgggagggggtgccctgcgcctggggctgccgagcggtgtgagcgtctaagtgagggcttccctcttttgcccgaggcggccgggtgcctttctttgcaacctcgccttctgcggctgggtggtcctttctctcgccgggtttggagacacgctcccgatttcgaggggagggagacgatggactgagacgatgcacgccatggaatcccgggtattactgagaacgttctgcgtgatcctcgggctcgaagcggtttggggacttggtgtggacccctccctacagattgacgtcttatcagagttagaacttggggagtccacagctggagtgcgccaagtcccaggactgcataatgggacgaaagccttcctcttccaagattctcccagaagcataaaagcacccattgctacagctgagcggtttttccagaagctgaggaataaacacgagttcacaattctggtgaccctgaaacagatccacttaaattcgggagtcattctctccatccaccacttggatcacaggtacctggaactggaaagcagcggccaccggaatgagatcagactgcattaccgctctggaactcaccgcccgcacacggaagtgtttccttacattttggctgatgccaagtggcacaagctctccttagccttcagtgcctcccacttaattttacacatcgactgcaacaagatctatgaacgagtggtggaaatgccttctacagacttgcctctgggcaccacattttggttgggacagagaaataacgcacacgggtattttaagggaataatgcaagatgtgcaattacttgtcatgccccaggggttcatcgctcagtgcccggatcttaatcgaacctgtccaacatgcaacgacttccatgggcttgtgcagaaaatcatggagctgcaggacattttatcgaagacgtcagccaagttgtctagagctgaacaacgaatgaacaggctggatcagtgctactgtgagcggacgtgcaccatgaagggaaccacctaccgggagttcgagtcctggacagacggctgcaagaactgcacatgcttgaatgggaccatccagtgcgagactctggtctgccctgctcccgactgcccggctaaatcggctccagcgtacgtggatggcaagtgctgtaaggagtgcaagtccacctgccagttccaggggcggagctactttgagggagaaaggagcacagtcttctcagcttccggaatgtgcgtcttgtatgaatgcaaggatcagaccatgaagcttgttgagaacgccggctgcccggctttagattgccccgagtctcatcagatcgccttgtctcacagctgctgcaaggtttgcaaaggttatgacttctgttctgagaagcatacatgcatggagaactcagtctgcaggaacctgaacgacagggcagtgtgcagctgccgggatggtttccgggccctccgggaggacaatgcctactgtgaagacattgacgagtgtgcagaggggcgccattactgccgtgagaacaccatgtgtgtgaacacaccgggctctttcctgtgtatctgccaaacagggtacatcagaatcgacgattactcgtgtacggaacatgacgagtgcctcacaaaccagcacaattgtgacgagaacgctttgtgctttaacaccgttggaggtcacaactgcgtctgcaagcctggctacactgggaatggaaccacgtgcaaagctttctgcaaagacggctgcagaaacggaggtgcctgcattgctgccaatgtctgtgcttgcccacaaggcttcaccggacccagctgtgagacagacattgatgagtgctctgagggctttgttcagtgtgacagccgtgccaactgcattaacctgcctgggtggtaccactgtgagtgcagagatggctaccatgacaatgggatgtttgcaccaggtggagaatcctgtgaagatattgatgaatgtgggactgggaggcacagctgtgccaatgacaccatttgcttcaacttggacggtggctacgattgccggtgtccccatggaaagaactgcacaggggactgcgtgcacgacgggaaagtcaaacacaacggccagatctgggtgctggagaacgacaggtgctctgtgtgttcctgccagactggatttgttatgtgtcgacggatggtctgtgactgcgaaaaccccacagttgacctctcctgctgccctgagtgcgacccaaggctgagcagccagtgcctgcatcaaaacggggaaaccgtgtacaacagcggtgacacctgggtccaggattgccgtcagtgccgctgcttgcaaggagaagttgactgctggcccctggcttgcccagaggtagagtgtgaatttagtgtccttcctgagaacgagtgctgcccacgctgtgtcaccgatccttgtcaggctgacaccatccgcaatgacatcaccaaaacctgcctggacgagatgaacgtggttcgcttcactgggtcttcctggatcaagcacggcacagagtgcaccctctgccagtgcaagaacggccacgtgtgctgctcagtggacccacagtgcctccaggagctgtgaagttaactgcctcatgggagatacctgttcaaagaatgatttctcatttaaaaagaccaaaaaacaaaaaagaaaaaaagtgatgtgcggccagccaaatgcaactgtgtcaatggctgggcagactgatggcgattacggctctgtagagctttgaggaacatcactgaggaaaccagatggcagttccgcctttactgttcctgggatcaccttacggagaaatggctgtgaatcacaggccttgacatccccagccctggagaagaagcctgagcccatcagctctggggaagtctctccctctctccctccctccgcaggcacaggacatgtcctagctcagactcttcctgaaccagcgaggttcctcactgaagccgtggaatgaaaggcagtgagtgagctatattttcagaatccaagaagctgacacatctgtacagtgcactccgaaccctgaaacaagctattgtaatgataaaatactgcacaggcatggttatgtaacattttctaaccggagaagtcaccccacccccatttcctcgtttactgcacttaatgttatttggtttgaatttgttcagtagaagctcgttcttgtgcaaaataaaataactatttctcttacctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]