GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 16:06:20, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_031070               3376 bp    mRNA    linear   ROD 18-MAR-2021
DEFINITION  Rattus norvegicus neural EGFL like 2 (Nell2), mRNA.
ACCESSION   NM_031070 XM_346813
VERSION     NM_031070.3
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3376)
  AUTHORS   Kim HR, Kim DH, An JY, Kang D, Park JW, Hwang EM, Seo EJ, Jang IH,
            Ha CM and Lee BJ.
  TITLE     NELL2 Function in Axon Development of Hippocampal Neurons
  JOURNAL   Mol Cells 43 (6), 581-589 (2020)
   PUBMED   32597395
  REMARK    GeneRIF: NELL2 Function in Axon Development of Hippocampal Neurons.
REFERENCE   2  (bases 1 to 3376)
  AUTHORS   Jeong JK, Kim JG, Kim HR, Lee TH, Park JW and Lee BJ.
  TITLE     A Role of Central NELL2 in the Regulation of Feeding Behavior in
            Rats
  JOURNAL   Mol Cells 40 (3), 186-194 (2017)
   PUBMED   28301916
  REMARK    GeneRIF: Report shows that neural tissue-enriched multifunctional
            protein, NELL2 is a regulatory component of feeding behavior,
            possibly through a modulation of neuronal activity in the
            hypothalamus.
REFERENCE   3  (bases 1 to 3376)
  AUTHORS   Zhou SS and Li P.
  TITLE     Effects of NELL2 on the regulation of GnRH expression and puberty
            in female rats
  JOURNAL   Genet Mol Res 13 (3), 6672-6682 (2014)
   PUBMED   25177948
  REMARK    GeneRIF: Data indicate that RNA interference of NEL-like protein 2
            (NELL2) reduced NELL2 and gonadotropin-releasing hormone (GnRH)
            expression at multiple stages of sexual development.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 3376)
  AUTHORS   Ha CM, Hwang EM, Kim E, Lee DY, Chang S, Lee BJ, Hong SG and Park
            JY.
  TITLE     The molecular mechanism of NELL2 movement and secretion in
            hippocampal progenitor HiB5 cells
  JOURNAL   Mol Cells 36 (6), 527-533 (2013)
   PUBMED   24352699
  REMARK    GeneRIF: Results suggest that the N-terminal region of NELL2
            determines both the pattern of its intracellular expression and
            transport and may affect the cellular activity of cells in a
            paracrine or autocrine manner.
REFERENCE   5  (bases 1 to 3376)
  AUTHORS   Munemasa Y, Chang CS, Kwong JM, Kyung H, Kitaoka Y, Caprioli J and
            Piri N.
  TITLE     The neuronal EGF-related gene Nell2 interacts with Macf1 and
            supports survival of retinal ganglion cells after optic nerve
            injury
  JOURNAL   PLoS One 7 (4), e34810 (2012)
   PUBMED   22496866
  REMARK    GeneRIF: It was shown that Nell2 expression at both mRNA and
            protein levels is localized to retinal ganglion cells. Nell2 had a
            molecular weight of ~ 140 kDa and 90 kDa, corresponding to the
            glycosylated and non-glycosylated form, respectively.
REFERENCE   6  (bases 1 to 3376)
  AUTHORS   Aihara K, Kuroda S, Kanayama N, Matsuyama S, Tanizawa K and Horie
            M.
  TITLE     A neuron-specific EGF family protein, NELL2, promotes survival of
            neurons through mitogen-activated protein kinases
  JOURNAL   Brain Res Mol Brain Res 116 (1-2), 86-93 (2003)
   PUBMED   12941464
REFERENCE   7  (bases 1 to 3376)
  AUTHORS   Kim H, Ha CM, Choi J, Choi EJ, Jeon J, Kim C, Park SK, Kang SS, Kim
            K and Lee BJ.
  TITLE     Ontogeny and the possible function of a novel epidermal growth
            factor-like repeat domain-containing protein, NELL2, in the rat
            brain
  JOURNAL   J Neurochem 83 (6), 1389-1400 (2002)
   PUBMED   12472893
  REMARK    GeneRIF: NELL2 may play an important role in the development of the
            CNS as well as maintenance of neural functions, by regulating the
            intracellular machinery involving Ca2+ signaling, synaptic
            transport and/or release of vesicles
REFERENCE   8  (bases 1 to 3376)
  AUTHORS   Kuroda S and Tanizawa K.
  TITLE     Involvement of epidermal growth factor-like domain of NELL proteins
            in the novel protein-protein interaction with protein kinase C
  JOURNAL   Biochem Biophys Res Commun 265 (3), 752-757 (1999)
   PUBMED   10600492
REFERENCE   9  (bases 1 to 3376)
  AUTHORS   Kuroda S, Oyasu M, Kawakami M, Kanayama N, Tanizawa K, Saito N, Abe
            T, Matsuhashi S and Ting K.
  TITLE     Biochemical characterization and expression analysis of neural
            thrombospondin-1-like proteins NELL1 and NELL2
  JOURNAL   Biochem Biophys Res Commun 265 (1), 79-86 (1999)
   PUBMED   10548494
REFERENCE   10 (bases 1 to 3376)
  AUTHORS   Beckmann G, Hanke J, Bork P and Reich JG.
  TITLE     Merging extracellular domains: fold prediction for laminin G-like
            and amino-terminal thrombospondin-like modules based on homology to
            pentraxins
  JOURNAL   J Mol Biol 275 (5), 725-730 (1998)
   PUBMED   9480764
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000187.1.
            On Mar 18, 2021 this sequence version replaced NM_031070.2.
            
            Summary: homotrimeric glycoprotein that is involved in the growth
            and differentiation of neural cells [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY089719.1, U48245.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00155307, SAMEA5760383
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-256               JACYVU010000187.1  13397147-13397402   c
            257-342             JACYVU010000187.1  13396473-13396558   c
            343-471             JACYVU010000187.1  13395940-13396068   c
            472-622             JACYVU010000187.1  13328600-13328750   c
            623-796             JACYVU010000187.1  13297859-13298032   c
            797-893             JACYVU010000187.1  13297664-13297760   c
            894-966             JACYVU010000187.1  13295450-13295522   c
            967-1049            JACYVU010000187.1  13295195-13295277   c
            1050-1178           JACYVU010000187.1  13294214-13294342   c
            1179-1281           JACYVU010000187.1  13292542-13292644   c
            1282-1373           JACYVU010000187.1  13254941-13255032   c
            1374-1476           JACYVU010000187.1  13251581-13251683   c
            1477-1605           JACYVU010000187.1  13242131-13242259   c
            1606-1731           JACYVU010000187.1  13208718-13208843   c
            1732-1854           JACYVU010000187.1  13162142-13162264   c
            1855-1950           JACYVU010000187.1  13159407-13159502   c
            1951-2091           JACYVU010000187.1  13100588-13100728   c
            2092-2285           JACYVU010000187.1  13090630-13090823   c
            2286-2462           JACYVU010000187.1  13089407-13089583   c
            2463-2687           JACYVU010000187.1  13087240-13087464   c
            2688-3376           JACYVU010000187.1  13077588-13078276   c
FEATURES             Location/Qualifiers
     source          1..3376
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q35"
     gene            1..3376
                     /gene="Nell2"
                     /note="neural EGFL like 2"
                     /db_xref="GeneID:81734"
                     /db_xref="RGD:620999"
     exon            1..256
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    135..137
                     /gene="Nell2"
                     /note="upstream in-frame stop codon"
     exon            257..342
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     CDS             279..2738
                     /gene="Nell2"
                     /note="protein kinase C-binding protein NELL2; NEL-like
                     protein 2; rCG50753-like; NEL-like 2"
                     /codon_start=1
                     /product="protein kinase C-binding protein NELL2
                     precursor"
                     /protein_id="NP_112332.2"
                     /db_xref="GeneID:81734"
                     /db_xref="RGD:620999"
                     /translation="
MHAMESRVLLRTFCVILGLEAVWGLGVDPSLQIDVLSELELGESTAGVRQVPGLHNGTKAFLFQDSPRSIKAPIATAERFFQKLRNKHEFTILVTLKQIHLNSGVILSIHHLDHRYLELESSGHRNEIRLHYRSGTHRPHTEVFPYILADAKWHKLSLAFSASHLILHIDCNKIYERVVEMPSTDLPLGTTFWLGQRNNAHGYFKGIMQDVQLLVMPQGFIAQCPDLNRTCPTCNDFHGLVQKIMELQDILSKTSAKLSRAEQRMNRLDQCYCERTCTMKGTTYREFESWTDGCKNCTCLNGTIQCETLVCPAPDCPAKSAPAYVDGKCCKECKSTCQFQGRSYFEGERSTVFSASGMCVLYECKDQTMKLVENAGCPALDCPESHQIALSHSCCKVCKGYDFCSEKHTCMENSVCRNLNDRAVCSCRDGFRALREDNAYCEDIDECAEGRHYCRENTMCVNTPGSFLCICQTGYIRIDDYSCTEHDECLTNQHNCDENALCFNTVGGHNCVCKPGYTGNGTTCKAFCKDGCRNGGACIAANVCACPQGFTGPSCETDIDECSEGFVQCDSRANCINLPGWYHCECRDGYHDNGMFAPGGESCEDIDECGTGRHSCANDTICFNLDGGYDCRCPHGKNCTGDCVHDGKVKHNGQIWVLENDRCSVCSCQTGFVMCRRMVCDCENPTVDLSCCPECDPRLSSQCLHQNGETVYNSGDTWVQDCRQCRCLQGEVDCWPLACPEVECEFSVLPENECCPRCVTDPCQADTIRNDITKTCLDEMNVVRFTGSSWIKHGTECTLCQCKNGHVCCSVDPQCLQEL"
     sig_peptide     279..350
                     /gene="Nell2"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    372..929
                     /gene="Nell2"
                     /note="Thrombospondin N-terminal -like domains; Region:
                     TSPN; smart00210"
                     /db_xref="CDD:214560"
     misc_feature    1107..1277
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:302663"
     misc_feature    <1590..1718
                     /gene="Nell2"
                     /note="Von Willebrand factor type A (vWA) domain was
                     originally found in the blood coagulation protein von
                     Willebrand factor (vWF). Typically, the vWA domain is made
                     up of approximately 200 amino acid residues folded into a
                     classic a/b para-rossmann type of...; Region: vWFA;
                     cl00057"
                     /db_xref="CDD:294047"
     misc_feature    1743..1850
                     /gene="Nell2"
                     /note="EGF domain; Region: EGF_3; pfam12947"
                     /db_xref="CDD:289699"
     misc_feature    1950..2054
                     /gene="Nell2"
                     /note="Calcium-binding EGF-like domain; Region: EGF_CA;
                     smart00179"
                     /db_xref="CDD:214542"
     misc_feature    order(1950..1952,1959..1961,2007..2009)
                     /gene="Nell2"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2091..>2186
                     /gene="Nell2"
                     /note="Calcium-binding EGF domain; Region: EGF_CA;
                     pfam07645"
                     /db_xref="CDD:284955"
     misc_feature    order(2091..2093,2100..2102,2148..2150)
                     /gene="Nell2"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2205..2363
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:302663"
     misc_feature    2400..2552
                     /gene="Nell2"
                     /note="von Willebrand factor type C domain; Region: VWC;
                     cl17735"
                     /db_xref="CDD:302663"
     exon            343..471
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            472..622
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            623..796
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            797..893
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            894..966
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            967..1049
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1050..1178
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1179..1281
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1282..1373
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1374..1476
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1477..1605
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1606..1731
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1732..1854
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1855..1950
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            1951..2091
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2092..2285
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2286..2462
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2463..2687
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
     exon            2688..3376
                     /gene="Nell2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctcactacccatctccgcctgtctccctagcgtgtccagcttcacctaggagtcctgtgtgctttggctgggttccttttcccgcccgggagggggtgccctgcgcctggggctgccgagcggtgtgagcgtctaagtgagggcttccctcttttgcccgaggcggccgggtgcctttctttgcaacctcgccttctgcggctgggtggtcctttctctcgccgggtttggagacacgctcccgatttcgaggggagggagacgatggactgagacgatgcacgccatggaatcccgggtattactgagaacgttctgcgtgatcctcgggctcgaagcggtttggggacttggtgtggacccctccctacagattgacgtcttatcagagttagaacttggggagtccacagctggagtgcgccaagtcccaggactgcataatgggacgaaagccttcctcttccaagattctcccagaagcataaaagcacccattgctacagctgagcggtttttccagaagctgaggaataaacacgagttcacaattctggtgaccctgaaacagatccacttaaattcgggagtcattctctccatccaccacttggatcacaggtacctggaactggaaagcagcggccaccggaatgagatcagactgcattaccgctctggaactcaccgcccgcacacggaagtgtttccttacattttggctgatgccaagtggcacaagctctccttagccttcagtgcctcccacttaattttacacatcgactgcaacaagatctatgaacgagtggtggaaatgccttctacagacttgcctctgggcaccacattttggttgggacagagaaataacgcacacgggtattttaagggaataatgcaagatgtgcaattacttgtcatgccccaggggttcatcgctcagtgcccggatcttaatcgaacctgtccaacatgcaacgacttccatgggcttgtgcagaaaatcatggagctgcaggacattttatcgaagacgtcagccaagttgtctagagctgaacaacgaatgaacaggctggatcagtgctactgtgagcggacgtgcaccatgaagggaaccacctaccgggagttcgagtcctggacagacggctgcaagaactgcacatgcttgaatgggaccatccagtgcgagactctggtctgccctgctcccgactgcccggctaaatcggctccagcgtacgtggatggcaagtgctgtaaggagtgcaagtccacctgccagttccaggggcggagctactttgagggagaaaggagcacagtcttctcagcttccggaatgtgcgtcttgtatgaatgcaaggatcagaccatgaagcttgttgagaacgccggctgcccggctttagattgccccgagtctcatcagatcgccttgtctcacagctgctgcaaggtttgcaaaggttatgacttctgttctgagaagcatacatgcatggagaactcagtctgcaggaacctgaacgacagggcagtgtgcagctgccgggatggtttccgggccctccgggaggacaatgcctactgtgaagacattgacgagtgtgcagaggggcgccattactgccgtgagaacaccatgtgtgtgaacacaccgggctctttcctgtgtatctgccaaacagggtacatcagaatcgacgattactcgtgtacggaacatgacgagtgcctcacaaaccagcacaattgtgacgagaacgctttgtgctttaacaccgttggaggtcacaactgcgtctgcaagcctggctacactgggaatggaaccacgtgcaaagctttctgcaaagacggctgcagaaacggaggtgcctgcattgctgccaatgtctgtgcttgcccacaaggcttcaccggacccagctgtgagacagacattgatgagtgctctgagggctttgttcagtgtgacagccgtgccaactgcattaacctgcctgggtggtaccactgtgagtgcagagatggctaccatgacaatgggatgtttgcaccaggtggagaatcctgtgaagatattgatgaatgtgggactgggaggcacagctgtgccaatgacaccatttgcttcaacttggacggtggctacgattgccggtgtccccatggaaagaactgcacaggggactgcgtgcacgacgggaaagtcaaacacaacggccagatctgggtgctggagaacgacaggtgctctgtgtgttcctgccagactggatttgttatgtgtcgacggatggtctgtgactgcgaaaaccccacagttgacctctcctgctgccctgagtgcgacccaaggctgagcagccagtgcctgcatcaaaacggggaaaccgtgtacaacagcggtgacacctgggtccaggattgccgtcagtgccgctgcttgcaaggagaagttgactgctggcccctggcttgcccagaggtagagtgtgaatttagtgtccttcctgagaacgagtgctgcccacgctgtgtcaccgatccttgtcaggctgacaccatccgcaatgacatcaccaaaacctgcctggacgagatgaacgtggttcgcttcactgggtcttcctggatcaagcacggcacagagtgcaccctctgccagtgcaagaacggccacgtgtgctgctcagtggacccacagtgcctccaggagctgtgaagttaactgcctcatgggagatacctgttcaaagaatgatttctcatttaaaaagaccaaaaaacaaaaaagaaaaaaagtgatgtgcggccagccaaatgcaactgtgtcaatggctgggcagactgatggcgattacggctctgtagagctttgaggaacatcactgaggaaaccagatggcagttccgcctttactgttcctgggatcaccttacggagaaatggctgtgaatcacaggccttgacatccccagccctggagaagaagcctgagcccatcagctctggggaagtctctccctctctccctccctccgcaggcacaggacatgtcctagctcagactcttcctgaaccagcgaggttcctcactgaagccgtggaatgaaaggcagtgagtgagctatattttcagaatccaagaagctgacacatctgtacagtgcactccgaaccctgaaacaagctattgtaatgataaaatactgcacaggcatggttatgtaacattttctaaccggagaagtcaccccacccccatttcctcgtttactgcacttaatgttatttggtttgaatttgttcagtagaagctcgttcttgtgcaaaataaaataactatttctcttacctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]