ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-07-01 04:32:37, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_031070 3376 bp mRNA linear ROD 29-MAR-2024
DEFINITION Rattus norvegicus neural EGFL like 2 (Nell2), mRNA.
ACCESSION NM_031070 XM_346813
VERSION NM_031070.3
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 3376)
AUTHORS Ha,C.M., Kim,D.H., Lee,T.H., Kim,H.R., Choi,J., Kim,Y., Kang,D.,
Park,J.W., Ojeda,S.R., Jeong,J.K. and Lee,B.J.
TITLE Transcriptional Regulatory Role of NELL2 in Preproenkephalin Gene
Expression
JOURNAL Mol Cells 45 (8), 537-549 (2022)
PUBMED 35950455
REMARK GeneRIF: Transcriptional Regulatory Role of NELL2 in
Preproenkephalin Gene Expression.
REFERENCE 2 (bases 1 to 3376)
AUTHORS Kim,H.R., Kim,D.H., An,J.Y., Kang,D., Park,J.W., Hwang,E.M.,
Seo,E.J., Jang,I.H., Ha,C.M. and Lee,B.J.
TITLE NELL2 Function in Axon Development of Hippocampal Neurons
JOURNAL Mol Cells 43 (6), 581-589 (2020)
PUBMED 32597395
REMARK GeneRIF: NELL2 Function in Axon Development of Hippocampal Neurons.
REFERENCE 3 (bases 1 to 3376)
AUTHORS Jeong,J.K., Kim,J.G., Kim,H.R., Lee,T.H., Park,J.W. and Lee,B.J.
TITLE A Role of Central NELL2 in the Regulation of Feeding Behavior in
Rats
JOURNAL Mol Cells 40 (3), 186-194 (2017)
PUBMED 28301916
REMARK GeneRIF: Report shows that neural tissue-enriched multifunctional
protein, NELL2 is a regulatory component of feeding behavior,
possibly through a modulation of neuronal activity in the
hypothalamus.
REFERENCE 4 (bases 1 to 3376)
AUTHORS Zhou,S.S. and Li,P.
TITLE Effects of NELL2 on the regulation of GnRH expression and puberty
in female rats
JOURNAL Genet Mol Res 13 (3), 6672-6682 (2014)
PUBMED 25177948
REMARK GeneRIF: Data indicate that RNA interference of NEL-like protein 2
(NELL2) reduced NELL2 and gonadotropin-releasing hormone (GnRH)
expression at multiple stages of sexual development.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 3376)
AUTHORS Ha,C.M., Hwang,E.M., Kim,E., Lee,D.Y., Chang,S., Lee,B.J.,
Hong,S.G. and Park,J.Y.
TITLE The molecular mechanism of NELL2 movement and secretion in
hippocampal progenitor HiB5 cells
JOURNAL Mol Cells 36 (6), 527-533 (2013)
PUBMED 24352699
REMARK GeneRIF: Results suggest that the N-terminal region of NELL2
determines both the pattern of its intracellular expression and
transport and may affect the cellular activity of cells in a
paracrine or autocrine manner.
REFERENCE 6 (bases 1 to 3376)
AUTHORS Aihara,K., Kuroda,S., Kanayama,N., Matsuyama,S., Tanizawa,K. and
Horie,M.
TITLE A neuron-specific EGF family protein, NELL2, promotes survival of
neurons through mitogen-activated protein kinases
JOURNAL Brain Res Mol Brain Res 116 (1-2), 86-93 (2003)
PUBMED 12941464
REFERENCE 7 (bases 1 to 3376)
AUTHORS Kim,H., Ha,C.M., Choi,J., Choi,E.J., Jeon,J., Kim,C., Park,S.K.,
Kang,S.S., Kim,K. and Lee,B.J.
TITLE Ontogeny and the possible function of a novel epidermal growth
factor-like repeat domain-containing protein, NELL2, in the rat
brain
JOURNAL J Neurochem 83 (6), 1389-1400 (2002)
PUBMED 12472893
REMARK GeneRIF: NELL2 may play an important role in the development of the
CNS as well as maintenance of neural functions, by regulating the
intracellular machinery involving Ca2+ signaling, synaptic
transport and/or release of vesicles
REFERENCE 8 (bases 1 to 3376)
AUTHORS Kuroda,S. and Tanizawa,K.
TITLE Involvement of epidermal growth factor-like domain of NELL proteins
in the novel protein-protein interaction with protein kinase C
JOURNAL Biochem Biophys Res Commun 265 (3), 752-757 (1999)
PUBMED 10600492
REFERENCE 9 (bases 1 to 3376)
AUTHORS Kuroda,S., Oyasu,M., Kawakami,M., Kanayama,N., Tanizawa,K.,
Saito,N., Abe,T., Matsuhashi,S. and Ting,K.
TITLE Biochemical characterization and expression analysis of neural
thrombospondin-1-like proteins NELL1 and NELL2
JOURNAL Biochem Biophys Res Commun 265 (1), 79-86 (1999)
PUBMED 10548494
REFERENCE 10 (bases 1 to 3376)
AUTHORS Beckmann,G., Hanke,J., Bork,P. and Reich,J.G.
TITLE Merging extracellular domains: fold prediction for laminin G-like
and amino-terminal thrombospondin-like modules based on homology to
pentraxins
JOURNAL J Mol Biol 275 (5), 725-730 (1998)
PUBMED 9480764
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JAXUCZ010000007.1.
On Mar 18, 2021 this sequence version replaced NM_031070.2.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY089719.1, U48245.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA5760383,
SAMEA5760389 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression,
longest protein
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-256 JAXUCZ010000007.1 128541872-128542127 c
257-342 JAXUCZ010000007.1 128541198-128541283 c
343-471 JAXUCZ010000007.1 128540665-128540793 c
472-622 JAXUCZ010000007.1 128473333-128473483 c
623-796 JAXUCZ010000007.1 128442600-128442773 c
797-893 JAXUCZ010000007.1 128442405-128442501 c
894-966 JAXUCZ010000007.1 128440191-128440263 c
967-1049 JAXUCZ010000007.1 128439936-128440018 c
1050-1178 JAXUCZ010000007.1 128438955-128439083 c
1179-1281 JAXUCZ010000007.1 128437285-128437387 c
1282-1373 JAXUCZ010000007.1 128399684-128399775 c
1374-1476 JAXUCZ010000007.1 128396324-128396426 c
1477-1605 JAXUCZ010000007.1 128386874-128387002 c
1606-1731 JAXUCZ010000007.1 128353465-128353590 c
1732-1854 JAXUCZ010000007.1 128306889-128307011 c
1855-1950 JAXUCZ010000007.1 128304154-128304249 c
1951-2091 JAXUCZ010000007.1 128245333-128245473 c
2092-2285 JAXUCZ010000007.1 128235375-128235568 c
2286-2462 JAXUCZ010000007.1 128234152-128234328 c
2463-2687 JAXUCZ010000007.1 128231985-128232209 c
2688-3376 JAXUCZ010000007.1 128222333-128223021 c
FEATURES Location/Qualifiers
source 1..3376
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="7"
/map="7q35"
gene 1..3376
/gene="Nell2"
/note="neural EGFL like 2"
/db_xref="GeneID:81734"
/db_xref="RGD:620999"
exon 1..256
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
misc_feature 135..137
/gene="Nell2"
/note="upstream in-frame stop codon"
exon 257..342
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
CDS 279..2738
/gene="Nell2"
/note="protein kinase C-binding protein NELL2; NEL-like
protein 2; rCG50753-like; NEL-like 2"
/codon_start=1
/product="protein kinase C-binding protein NELL2
precursor"
/protein_id="NP_112332.2"
/db_xref="GeneID:81734"
/db_xref="RGD:620999"
/translation="
MHAMESRVLLRTFCVILGLEAVWGLGVDPSLQIDVLSELELGESTAGVRQVPGLHNGTKAFLFQDSPRSIKAPIATAERFFQKLRNKHEFTILVTLKQIHLNSGVILSIHHLDHRYLELESSGHRNEIRLHYRSGTHRPHTEVFPYILADAKWHKLSLAFSASHLILHIDCNKIYERVVEMPSTDLPLGTTFWLGQRNNAHGYFKGIMQDVQLLVMPQGFIAQCPDLNRTCPTCNDFHGLVQKIMELQDILSKTSAKLSRAEQRMNRLDQCYCERTCTMKGTTYREFESWTDGCKNCTCLNGTIQCETLVCPAPDCPAKSAPAYVDGKCCKECKSTCQFQGRSYFEGERSTVFSASGMCVLYECKDQTMKLVENAGCPALDCPESHQIALSHSCCKVCKGYDFCSEKHTCMENSVCRNLNDRAVCSCRDGFRALREDNAYCEDIDECAEGRHYCRENTMCVNTPGSFLCICQTGYIRIDDYSCTEHDECLTNQHNCDENALCFNTVGGHNCVCKPGYTGNGTTCKAFCKDGCRNGGACIAANVCACPQGFTGPSCETDIDECSEGFVQCDSRANCINLPGWYHCECRDGYHDNGMFAPGGESCEDIDECGTGRHSCANDTICFNLDGGYDCRCPHGKNCTGDCVHDGKVKHNGQIWVLENDRCSVCSCQTGFVMCRRMVCDCENPTVDLSCCPECDPRLSSQCLHQNGETVYNSGDTWVQDCRQCRCLQGEVDCWPLACPEVECEFSVLPENECCPRCVTDPCQADTIRNDITKTCLDEMNVVRFTGSSWIKHGTECTLCQCKNGHVCCSVDPQCLQEL"
sig_peptide 279..350
/gene="Nell2"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
mat_peptide 351..2735
/gene="Nell2"
/product="Protein kinase C-binding protein NELL2.
/id=PRO_0000007668"
/note="propagated from UniProtKB/Swiss-Prot (Q62918.2)"
misc_feature 372..929
/gene="Nell2"
/note="Thrombospondin N-terminal -like domains; Region:
TSPN; smart00210"
/db_xref="CDD:214560"
misc_feature 444..446
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 960..962
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 1107..1277
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
misc_feature 1164..1166
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 1179..1181
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 1605..1700
/gene="Nell2"
/note="Calcium-binding EGF domain; Region: EGF_CA;
pfam07645"
/db_xref="CDD:429571"
misc_feature 1743..1850
/gene="Nell2"
/note="EGF domain; Region: EGF_3; pfam12947"
/db_xref="CDD:463759"
misc_feature 1836..1838
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000250|UniProtKB:Q99435; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 1929..1931
/gene="Nell2"
/note="O-linked (GlcNAc...) threonine.
/evidence=ECO:0000250|UniProtKB:Q99435; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 1950..2054
/gene="Nell2"
/note="Calcium-binding EGF-like domain; Region: EGF_CA;
smart00179"
/db_xref="CDD:214542"
misc_feature order(1950..1952,1959..1961,2007..2009)
/gene="Nell2"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2091..2186
/gene="Nell2"
/note="Calcium-binding EGF domain; Region: EGF_CA;
pfam07645"
/db_xref="CDD:429571"
misc_feature order(2091..2093,2100..2102,2148..2150)
/gene="Nell2"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2130..2132
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 2190..2192
/gene="Nell2"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q62918.2); glycosylation site"
misc_feature 2205..2363
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
misc_feature 2400..2552
/gene="Nell2"
/note="von Willebrand factor type C domain; Region: VWC;
cl17735"
/db_xref="CDD:450195"
exon 343..471
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 472..622
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 623..796
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 797..893
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 894..966
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 967..1049
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1050..1178
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1179..1281
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1282..1373
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1374..1476
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1477..1605
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1606..1731
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1732..1854
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1855..1950
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 1951..2091
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2092..2285
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2286..2462
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2463..2687
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
exon 2688..3376
/gene="Nell2"
/inference="alignment:Splign:2.1.0"
ORIGIN
gctcactacccatctccgcctgtctccctagcgtgtccagcttcacctaggagtcctgtgtgctttggctgggttccttttcccgcccgggagggggtgccctgcgcctggggctgccgagcggtgtgagcgtctaagtgagggcttccctcttttgcccgaggcggccgggtgcctttctttgcaacctcgccttctgcggctgggtggtcctttctctcgccgggtttggagacacgctcccgatttcgaggggagggagacgatggactgagacgatgcacgccatggaatcccgggtattactgagaacgttctgcgtgatcctcgggctcgaagcggtttggggacttggtgtggacccctccctacagattgacgtcttatcagagttagaacttggggagtccacagctggagtgcgccaagtcccaggactgcataatgggacgaaagccttcctcttccaagattctcccagaagcataaaagcacccattgctacagctgagcggtttttccagaagctgaggaataaacacgagttcacaattctggtgaccctgaaacagatccacttaaattcgggagtcattctctccatccaccacttggatcacaggtacctggaactggaaagcagcggccaccggaatgagatcagactgcattaccgctctggaactcaccgcccgcacacggaagtgtttccttacattttggctgatgccaagtggcacaagctctccttagccttcagtgcctcccacttaattttacacatcgactgcaacaagatctatgaacgagtggtggaaatgccttctacagacttgcctctgggcaccacattttggttgggacagagaaataacgcacacgggtattttaagggaataatgcaagatgtgcaattacttgtcatgccccaggggttcatcgctcagtgcccggatcttaatcgaacctgtccaacatgcaacgacttccatgggcttgtgcagaaaatcatggagctgcaggacattttatcgaagacgtcagccaagttgtctagagctgaacaacgaatgaacaggctggatcagtgctactgtgagcggacgtgcaccatgaagggaaccacctaccgggagttcgagtcctggacagacggctgcaagaactgcacatgcttgaatgggaccatccagtgcgagactctggtctgccctgctcccgactgcccggctaaatcggctccagcgtacgtggatggcaagtgctgtaaggagtgcaagtccacctgccagttccaggggcggagctactttgagggagaaaggagcacagtcttctcagcttccggaatgtgcgtcttgtatgaatgcaaggatcagaccatgaagcttgttgagaacgccggctgcccggctttagattgccccgagtctcatcagatcgccttgtctcacagctgctgcaaggtttgcaaaggttatgacttctgttctgagaagcatacatgcatggagaactcagtctgcaggaacctgaacgacagggcagtgtgcagctgccgggatggtttccgggccctccgggaggacaatgcctactgtgaagacattgacgagtgtgcagaggggcgccattactgccgtgagaacaccatgtgtgtgaacacaccgggctctttcctgtgtatctgccaaacagggtacatcagaatcgacgattactcgtgtacggaacatgacgagtgcctcacaaaccagcacaattgtgacgagaacgctttgtgctttaacaccgttggaggtcacaactgcgtctgcaagcctggctacactgggaatggaaccacgtgcaaagctttctgcaaagacggctgcagaaacggaggtgcctgcattgctgccaatgtctgtgcttgcccacaaggcttcaccggacccagctgtgagacagacattgatgagtgctctgagggctttgttcagtgtgacagccgtgccaactgcattaacctgcctgggtggtaccactgtgagtgcagagatggctaccatgacaatgggatgtttgcaccaggtggagaatcctgtgaagatattgatgaatgtgggactgggaggcacagctgtgccaatgacaccatttgcttcaacttggacggtggctacgattgccggtgtccccatggaaagaactgcacaggggactgcgtgcacgacgggaaagtcaaacacaacggccagatctgggtgctggagaacgacaggtgctctgtgtgttcctgccagactggatttgttatgtgtcgacggatggtctgtgactgcgaaaaccccacagttgacctctcctgctgccctgagtgcgacccaaggctgagcagccagtgcctgcatcaaaacggggaaaccgtgtacaacagcggtgacacctgggtccaggattgccgtcagtgccgctgcttgcaaggagaagttgactgctggcccctggcttgcccagaggtagagtgtgaatttagtgtccttcctgagaacgagtgctgcccacgctgtgtcaccgatccttgtcaggctgacaccatccgcaatgacatcaccaaaacctgcctggacgagatgaacgtggttcgcttcactgggtcttcctggatcaagcacggcacagagtgcaccctctgccagtgcaagaacggccacgtgtgctgctcagtggacccacagtgcctccaggagctgtgaagttaactgcctcatgggagatacctgttcaaagaatgatttctcatttaaaaagaccaaaaaacaaaaaagaaaaaaagtgatgtgcggccagccaaatgcaactgtgtcaatggctgggcagactgatggcgattacggctctgtagagctttgaggaacatcactgaggaaaccagatggcagttccgcctttactgttcctgggatcaccttacggagaaatggctgtgaatcacaggccttgacatccccagccctggagaagaagcctgagcccatcagctctggggaagtctctccctctctccctccctccgcaggcacaggacatgtcctagctcagactcttcctgaaccagcgaggttcctcactgaagccgtggaatgaaaggcagtgagtgagctatattttcagaatccaagaagctgacacatctgtacagtgcactccgaaccctgaaacaagctattgtaatgataaaatactgcacaggcatggttatgtaacattttctaaccggagaagtcaccccacccccatttcctcgtttactgcacttaatgttatttggtttgaatttgttcagtagaagctcgttcttgtgcaaaataaaataactatttctcttacctta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]