LOCUS       NM_024389               2938 bp    mRNA    linear   ROD 29-JUN-2021
DEFINITION  Rattus norvegicus homeo box A5 (Hoxa5), mRNA.
ACCESSION   NM_024389 XM_003752180
VERSION     NM_024389.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2938)
  AUTHORS   Wang Y, Wang MD, Xia YP, Gao Y, Zhu YY, Chen SC, Mao L, He QW, Yue
            ZY and Hu B.
  TITLE     MicroRNA-130a regulates cerebral ischemia-induced blood-brain
            barrier permeability by targeting Homeobox A5
  JOURNAL   FASEB J 32 (2), 935-944 (2018)
   PUBMED   29070584
  REMARK    GeneRIF: MiR-130a, by inhibiting Homeobox A5 expression, could
            down-regulate occludin, thereby increasing BBB permeability. Our
            results suggested that miR-130a might be implicated in
            ischemia-induced BBB dysfunction and serve as a target for the
            treatment of ischemic stroke
REFERENCE   2  (bases 1 to 2938)
  AUTHORS   Jakob P, Doerries C, Briand S, Mocharla P, Krankel N, Besler C,
            Mueller M, Manes C, Templin C, Baltes C, Rudin M, Adams H, Wolfrum
            M, Noll G, Ruschitzka F, Luscher TF and Landmesser U.
  TITLE     Loss of angiomiR-126 and 130a in angiogenic early outgrowth cells
            from patients with chronic heart failure: role for impaired in vivo
            neovascularization and cardiac repair capacity
  JOURNAL   Circulation 126 (25), 2962-2975 (2012)
   PUBMED   23136161
REFERENCE   3  (bases 1 to 2938)
  AUTHORS   Chen Y and Gorski DH.
  TITLE     Regulation of angiogenesis through a microRNA (miR-130a) that
            down-regulates antiangiogenic homeobox genes GAX and HOXA5
  JOURNAL   Blood 111 (3), 1217-1226 (2008)
   PUBMED   17957028
REFERENCE   4  (bases 1 to 2938)
  AUTHORS   McIntyre DC, Rakshit S, Yallowitz AR, Loken L, Jeannotte L,
            Capecchi MR and Wellik DM.
  TITLE     Hox patterning of the vertebrate rib cage
  JOURNAL   Development 134 (16), 2981-2989 (2007)
   PUBMED   17626057
REFERENCE   5  (bases 1 to 2938)
  AUTHORS   Tabaries S, Lemieux M, Aubin J and Jeannotte L.
  TITLE     Comparative analysis of Hoxa5 allelic series
  JOURNAL   Genesis 45 (4), 218-228 (2007)
   PUBMED   17417799
REFERENCE   6  (bases 1 to 2938)
  AUTHORS   Zhao JJ, Lazzarini RA and Pick L.
  TITLE     Functional dissection of the mouse Hox-a5 gene
  JOURNAL   EMBO J 15 (6), 1313-1322 (1996)
   PUBMED   8635464
REFERENCE   7  (bases 1 to 2938)
  AUTHORS   Pellerin I, Schnabel C, Catron KM and Abate C.
  TITLE     Hox proteins have different affinities for a consensus DNA site
            that correlate with the positions of their genes on the hox cluster
  JOURNAL   Mol Cell Biol 14 (7), 4532-4545 (1994)
   PUBMED   7911971
REFERENCE   8  (bases 1 to 2938)
  AUTHORS   Gorski DH, LePage DF and Walsh K.
  TITLE     Cloning and sequence analysis of homeobox transcription factor
            cDNAs with an inosine-containing probe
  JOURNAL   Biotechniques 16 (5), 856-858 (1994)
   PUBMED   7915120
REFERENCE   9  (bases 1 to 2938)
  AUTHORS   Jeannotte L, Lemieux M, Charron J, Poirier F and Robertson EJ.
  TITLE     Specification of axial identity in the mouse: role of the Hoxa-5
            (Hox1.3) gene
  JOURNAL   Genes Dev 7 (11), 2085-2096 (1993)
   PUBMED   7901120
REFERENCE   10 (bases 1 to 2938)
  AUTHORS   Odenwald WF, Taylor CF, Palmer-Hill FJ, Friedrich V Jr, Tani M and
            Lazzarini RA.
  TITLE     Expression of a homeo domain protein in noncontact-inhibited
            cultured cells and postmitotic neurons
  JOURNAL   Genes Dev 1 (5), 482-496 (1987)
   PUBMED   2890554
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000142.1.
            On Oct 25, 2019 this sequence version replaced XM_003752180.2.
            
            Summary: homeobox transcription factor; may be important for
            pattern specification [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BU758364.1, BQ782052.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760494, SAMN16676788
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2386              JACYVU010000142.1  4537249-4539634     c
            2387-2938           JACYVU010000142.1  4535741-4536292     c
FEATURES             Location/Qualifiers
     source          1..2938
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q24"
     gene            1..2938
                     /gene="Hoxa5"
                     /note="homeo box A5"
                     /db_xref="GeneID:79241"
                     /db_xref="RGD:620609"
     exon            1..2386
                     /gene="Hoxa5"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    1432..1434
                     /gene="Hoxa5"
                     /note="upstream in-frame stop codon"
     CDS             1492..2637
                     /gene="Hoxa5"
                     /note="hox-1.3; homeobox protein Hox-1.3; homeobox protein
                     Hox-A5-like"
                     /codon_start=1
                     /product="homeobox protein Hox-A5"
                     /protein_id="NP_077365.1"
                     /db_xref="GeneID:79241"
                     /db_xref="RGD:620609"
                     /translation="

MRPVSSGWRSSPTERRRRVAGTRPGSARHPSRLHPTPPLLHEFTSRGHQAGFTTGQQKHVIRSRTPYLGAYVGGNRVHVPVISIIHHKLCKGAIDAQTTASHKSSTHIKKQMSSYFVNSFCGRYPNGPDYQLHNYGDHSSVSEQFRDSASMHSGRYGYGYNGMDLSVGRSGSGHFGSGERARSYAAGASAAPAEPRYSQPATSTHSPPPDPLPCSAVAPSPGSDSHHGGKNSLGNSSGASANAGSTHISSREGVGTASAAEEDAPASSEQAGAQSEPSPAPPAQPQIYPWMRKLHISHDNIGGPEGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSMAAAGGAFRP"

     misc_feature    order(2410..2424,2428..2430,2479..2481,2497..2499,
                     2536..2538,2542..2547,2554..2559,2563..2571,2575..2580)
                     /gene="Hoxa5"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(2416..2418,2425..2427,2545..2547,2554..2559,
                     2566..2568)
                     /gene="Hoxa5"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    2419..2580
                     /gene="Hoxa5"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:365835"
     exon            2387..2938
                     /gene="Hoxa5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cacacacacacacacacacacacacacacaggttttctccccaaggctgcccgagccagcttgggaatcccggggtgcacccagaattggtcctgctgctgtgttagcgtctctgcgccctgtgagctacagacgcggggttgttgggggaagaaggagccccaggcagtgccccgtttggtgcctgggtttttccgccttggtccctcgccatcaaatcctaaagggcatcgccaaatcgactctggctactgaaaagaaagggtccacaagctgggccccagccctgtcccggcctctcaggatgcccctaaacaagaagcctgaggaacaaaggggaactcgccccttccccgacagaaccaaatctctctaccggcgcatacccgtcagtgggagagtagcagcctcaacggaggcaagccaacctgggcgcgagaggaacgttacaacctcgggagcgactaggctcctgcaggctcccagctcccgatttcactcccagcctcataagctgaccgccgccacctaaccgctttcaggacccaaagagggggcccaggaccatgagagccgcaagagtcctggcttccaaacgtgccagggactcctgagatgccaggcctctagtagagaaagtctcttctcctctcagctacatttgtgatttactttcgtctatcggagcccaggaaaataactacggtgatactaggcactgccacgaaatgattccattagttcccgcaatttattcccagtggtctaagcgagatcccaatagctctacccacggatcccagcttccaagcagcctcggaggccgttgggtatcagggcccactctctgggttcaccaagaaccctgctacctggggccgggctagtcagaagaaacggaccagggacgaagatcttccaggctggataaataaacaaatgagatagcaaactaatgacacgaaaaacatattttcacggaagaaaaaaatgattctggttatacgagtgtatggaatttgacctcgcctcggagaaacactacacaaaagctgtctttaatagacgcctgtggtttaagagcggcagggacactgtccttcatgcgctcacaaacacagagccataattgtggctgctgctgtgggcaggatttatttcttcaattggctaaatcgtcttcccttcctcgaaggtgatatctgtgttttcaaaattcacagctgctagccgggcgggcaaaccgaccccaacctccacacaaaaataagaggggatacaaagctggggaaataaagttgttgtaaataattctaagtcatcacctccccctaatcctctgtatcctcgccgggtgtgcgatcggcagctgacggcctcacaattggtacatcctaatggaactgcgagggaaatgcaataattttgccataatgggctgtaacctcaattcgaccccggcccttgctgcccgaggtcggaagcggagcgatgcgcccagtctccagcgggtggcgctcgagtccgactgaacggcggcggcgggtggcgggcacgcgcccagggagcgcgcgccacccctctcgcctccacccaactcccccattactgcacgagtttacctctagaggtcatcaggcaggatttacgactggacaacaaaagcacgtgattcgaagtcgtaccccatatttgggtgcctacgtaggagggaaccgagtacatgtcccagtcatttccataattcatcataaattgtgcaagggtgctatagacgcacaaacgaccgcgagccacaaatcaagcacacatatcaaaaaacaaatgagctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttgcataattatggagatcatagttccgtgagcgaacaattcagggactcggcgagcatgcactccggcaggtacggctacggctacaatggcatggatctcagcgtcggccgttcgggttccggccactttggctccggcgagcgcgcccgcagctacgcggctggggccagtgcggcgcccgccgagcccaggtacagccagccggccacgtccacgcactcgccaccgcccgacccgctgccctgctcagcggtggccccctcgcccggcagcgacagccaccacggcgggaaaaactccctgggcaactccagcggcgcctcggccaacgccggcagcacccacatcagcagcagagagggggttggcacggcgtccgcagcggaggaggacgcccctgccagcagcgagcaggcgggcgcccagagcgagccgagcccggcgccgcccgctcaaccccagatctacccctggatgcgcaagctgcacattagtcacgacaacataggtggcccagaaggcaaaagggcccggacggcctacacgcgctaccagaccctggagctggagaaagaattccacttcaaccgctacctgacccgccgaagaaggattgaaatagcacatgccctttgcctctccgagagacaaattaaaatctggttccaaaacaggaggatgaagtggaaaaaggataataagctgaaaagtatgagtatggccgcggcagggggggccttccgcccctgaggttctgagcggccaaagtactgggcagtagtagcgcgcggagcaactctccgtagtgtcagtactaaggtgactttctgaaactccccttgtgttccttctgtgaagaagccctgttctcgttgccctaattcatcttttaatcatgagcctgtttattgccattatagcgcctgtataagtagatcagcttctgttcatctctttgtcctgaatggctttgtcttgaaaaaaaaaatagatgttttaacttatttatatgaagcaagctgtgttacttgaagtaactaaaacaaaaaaa

//