LOCUS       NM_024389               2938 bp    mRNA    linear   ROD 29-APR-2025
DEFINITION  Rattus norvegicus homeo box A5 (Hoxa5), mRNA.
ACCESSION   NM_024389 XM_003752180
VERSION     NM_024389.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2938)
  AUTHORS   Kato,H., Ario,T., Kishida,T., Tadano,M., Osawa,S., Maeda,Y.,
            Takakura,H. and Izawa,T.
  TITLE     Homeobox A5 and C10 genes modulate adaptation of brown adipose
            tissue during exercise training in juvenile rats
  JOURNAL   Exp Physiol 106 (2), 463-474 (2021)
   PUBMED   33369800
  REMARK    GeneRIF: Homeobox A5 and C10 genes modulate adaptation of brown
            adipose tissue during exercise training in juvenile rats.
REFERENCE   2  (bases 1 to 2938)
  AUTHORS   Wang,Y., Wang,M.D., Xia,Y.P., Gao,Y., Zhu,Y.Y., Chen,S.C., Mao,L.,
            He,Q.W., Yue,Z.Y. and Hu,B.
  TITLE     MicroRNA-130a regulates cerebral ischemia-induced blood-brain
            barrier permeability by targeting Homeobox A5
  JOURNAL   FASEB J 32 (2), 935-944 (2018)
   PUBMED   29070584
  REMARK    GeneRIF: MiR-130a, by inhibiting Homeobox A5 expression, could
            down-regulate occludin, thereby increasing BBB permeability. Our
            results suggested that miR-130a might be implicated in
            ischemia-induced BBB dysfunction and serve as a target for the
            treatment of ischemic stroke
REFERENCE   3  (bases 1 to 2938)
  AUTHORS   Jakob,P., Doerries,C., Briand,S., Mocharla,P., Krankel,N.,
            Besler,C., Mueller,M., Manes,C., Templin,C., Baltes,C., Rudin,M.,
            Adams,H., Wolfrum,M., Noll,G., Ruschitzka,F., Luscher,T.F. and
            Landmesser,U.
  TITLE     Loss of angiomiR-126 and 130a in angiogenic early outgrowth cells
            from patients with chronic heart failure: role for impaired in vivo
            neovascularization and cardiac repair capacity
  JOURNAL   Circulation 126 (25), 2962-2975 (2012)
   PUBMED   23136161
REFERENCE   4  (bases 1 to 2938)
  AUTHORS   Chen,Y. and Gorski,D.H.
  TITLE     Regulation of angiogenesis through a microRNA (miR-130a) that
            down-regulates antiangiogenic homeobox genes GAX and HOXA5
  JOURNAL   Blood 111 (3), 1217-1226 (2008)
   PUBMED   17957028
REFERENCE   5  (bases 1 to 2938)
  AUTHORS   McIntyre,D.C., Rakshit,S., Yallowitz,A.R., Loken,L., Jeannotte,L.,
            Capecchi,M.R. and Wellik,D.M.
  TITLE     Hox patterning of the vertebrate rib cage
  JOURNAL   Development 134 (16), 2981-2989 (2007)
   PUBMED   17626057
REFERENCE   6  (bases 1 to 2938)
  AUTHORS   Zhao,J.J., Lazzarini,R.A. and Pick,L.
  TITLE     Functional dissection of the mouse Hox-a5 gene
  JOURNAL   EMBO J 15 (6), 1313-1322 (1996)
   PUBMED   8635464
REFERENCE   7  (bases 1 to 2938)
  AUTHORS   Pellerin,I., Schnabel,C., Catron,K.M. and Abate,C.
  TITLE     Hox proteins have different affinities for a consensus DNA site
            that correlate with the positions of their genes on the hox cluster
  JOURNAL   Mol Cell Biol 14 (7), 4532-4545 (1994)
   PUBMED   7911971
REFERENCE   8  (bases 1 to 2938)
  AUTHORS   Gorski,D.H., LePage,D.F. and Walsh,K.
  TITLE     Cloning and sequence analysis of homeobox transcription factor
            cDNAs with an inosine-containing probe
  JOURNAL   Biotechniques 16 (5), 856-858 (1994)
   PUBMED   7915120
REFERENCE   9  (bases 1 to 2938)
  AUTHORS   Jeannotte,L., Lemieux,M., Charron,J., Poirier,F. and Robertson,E.J.
  TITLE     Specification of axial identity in the mouse: role of the Hoxa-5
            (Hox1.3) gene
  JOURNAL   Genes Dev 7 (11), 2085-2096 (1993)
   PUBMED   7901120
REFERENCE   10 (bases 1 to 2938)
  AUTHORS   Odenwald,W.F., Taylor,C.F., Palmer-Hill,F.J., Friedrich,V. Jr.,
            Tani,M. and Lazzarini,R.A.
  TITLE     Expression of a homeo domain protein in noncontact-inhibited
            cultured cells and postmitotic neurons
  JOURNAL   Genes Dev 1 (5), 482-496 (1987)
   PUBMED   2890554
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000004.1.
            
            On Oct 25, 2019 this sequence version replaced XM_003752180.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BU758364.1, BQ782052.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN16676787, SAMN16676788
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2386              JAXUCZ010000004.1  82634466-82636851   c
            2387-2938           JAXUCZ010000004.1  82632958-82633509   c
FEATURES             Location/Qualifiers
     source          1..2938
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q24"
     gene            1..2938
                     /gene="Hoxa5"
                     /note="homeo box A5"
                     /db_xref="GeneID:79241"
                     /db_xref="RGD:620609"
     exon            1..2386
                     /gene="Hoxa5"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    1432..1434
                     /gene="Hoxa5"
                     /note="upstream in-frame stop codon"
     CDS             1492..2637
                     /gene="Hoxa5"
                     /note="hox-1.3; homeobox protein Hox-1.3; homeobox protein
                     Hox-A5-like"
                     /codon_start=1
                     /product="homeobox protein Hox-A5"
                     /protein_id="NP_077365.1"
                     /db_xref="GeneID:79241"
                     /db_xref="RGD:620609"
                     /translation="

MRPVSSGWRSSPTERRRRVAGTRPGSARHPSRLHPTPPLLHEFTSRGHQAGFTTGQQKHVIRSRTPYLGAYVGGNRVHVPVISIIHHKLCKGAIDAQTTASHKSSTHIKKQMSSYFVNSFCGRYPNGPDYQLHNYGDHSSVSEQFRDSASMHSGRYGYGYNGMDLSVGRSGSGHFGSGERARSYAAGASAAPAEPRYSQPATSTHSPPPDPLPCSAVAPSPGSDSHHGGKNSLGNSSGASANAGSTHISSREGVGTASAAEEDAPASSEQAGAQSEPSPAPPAQPQIYPWMRKLHISHDNIGGPEGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSMAAAGGAFRP"

     misc_feature    2410..2580
                     /gene="Hoxa5"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            2387..2938
                     /gene="Hoxa5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cacacacacacacacacacacacacacacaggttttctccccaaggctgcccgagccagcttgggaatcccggggtgcacccagaattggtcctgctgctgtgttagcgtctctgcgccctgtgagctacagacgcggggttgttgggggaagaaggagccccaggcagtgccccgtttggtgcctgggtttttccgccttggtccctcgccatcaaatcctaaagggcatcgccaaatcgactctggctactgaaaagaaagggtccacaagctgggccccagccctgtcccggcctctcaggatgcccctaaacaagaagcctgaggaacaaaggggaactcgccccttccccgacagaaccaaatctctctaccggcgcatacccgtcagtgggagagtagcagcctcaacggaggcaagccaacctgggcgcgagaggaacgttacaacctcgggagcgactaggctcctgcaggctcccagctcccgatttcactcccagcctcataagctgaccgccgccacctaaccgctttcaggacccaaagagggggcccaggaccatgagagccgcaagagtcctggcttccaaacgtgccagggactcctgagatgccaggcctctagtagagaaagtctcttctcctctcagctacatttgtgatttactttcgtctatcggagcccaggaaaataactacggtgatactaggcactgccacgaaatgattccattagttcccgcaatttattcccagtggtctaagcgagatcccaatagctctacccacggatcccagcttccaagcagcctcggaggccgttgggtatcagggcccactctctgggttcaccaagaaccctgctacctggggccgggctagtcagaagaaacggaccagggacgaagatcttccaggctggataaataaacaaatgagatagcaaactaatgacacgaaaaacatattttcacggaagaaaaaaatgattctggttatacgagtgtatggaatttgacctcgcctcggagaaacactacacaaaagctgtctttaatagacgcctgtggtttaagagcggcagggacactgtccttcatgcgctcacaaacacagagccataattgtggctgctgctgtgggcaggatttatttcttcaattggctaaatcgtcttcccttcctcgaaggtgatatctgtgttttcaaaattcacagctgctagccgggcgggcaaaccgaccccaacctccacacaaaaataagaggggatacaaagctggggaaataaagttgttgtaaataattctaagtcatcacctccccctaatcctctgtatcctcgccgggtgtgcgatcggcagctgacggcctcacaattggtacatcctaatggaactgcgagggaaatgcaataattttgccataatgggctgtaacctcaattcgaccccggcccttgctgcccgaggtcggaagcggagcgatgcgcccagtctccagcgggtggcgctcgagtccgactgaacggcggcggcgggtggcgggcacgcgcccagggagcgcgcgccacccctctcgcctccacccaactcccccattactgcacgagtttacctctagaggtcatcaggcaggatttacgactggacaacaaaagcacgtgattcgaagtcgtaccccatatttgggtgcctacgtaggagggaaccgagtacatgtcccagtcatttccataattcatcataaattgtgcaagggtgctatagacgcacaaacgaccgcgagccacaaatcaagcacacatatcaaaaaacaaatgagctcttattttgtaaactcattttgcggtcgctatccaaatggcccggactaccagttgcataattatggagatcatagttccgtgagcgaacaattcagggactcggcgagcatgcactccggcaggtacggctacggctacaatggcatggatctcagcgtcggccgttcgggttccggccactttggctccggcgagcgcgcccgcagctacgcggctggggccagtgcggcgcccgccgagcccaggtacagccagccggccacgtccacgcactcgccaccgcccgacccgctgccctgctcagcggtggccccctcgcccggcagcgacagccaccacggcgggaaaaactccctgggcaactccagcggcgcctcggccaacgccggcagcacccacatcagcagcagagagggggttggcacggcgtccgcagcggaggaggacgcccctgccagcagcgagcaggcgggcgcccagagcgagccgagcccggcgccgcccgctcaaccccagatctacccctggatgcgcaagctgcacattagtcacgacaacataggtggcccagaaggcaaaagggcccggacggcctacacgcgctaccagaccctggagctggagaaagaattccacttcaaccgctacctgacccgccgaagaaggattgaaatagcacatgccctttgcctctccgagagacaaattaaaatctggttccaaaacaggaggatgaagtggaaaaaggataataagctgaaaagtatgagtatggccgcggcagggggggccttccgcccctgaggttctgagcggccaaagtactgggcagtagtagcgcgcggagcaactctccgtagtgtcagtactaaggtgactttctgaaactccccttgtgttccttctgtgaagaagccctgttctcgttgccctaattcatcttttaatcatgagcctgtttattgccattatagcgcctgtataagtagatcagcttctgttcatctctttgtcctgaatggctttgtcttgaaaaaaaaaatagatgttttaacttatttatatgaagcaagctgtgttacttgaagtaactaaaacaaaaaaa

//