ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-18 22:20:42, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_023951 567 bp mRNA linear ROD 02-APR-2025 DEFINITION Rattus norvegicus SEBOX homeobox (Sebox), mRNA. ACCESSION NM_023951 VERSION NM_023951.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 567) AUTHORS Moreno,D.L., Salazar,Z., Betancourt,M., Casas,E., Ducolomb,Y., Gonzalez,C. and Bonilla,E. TITLE Sebox plays an important role during the early mouse oogenesis in vitro JOURNAL Zygote 22 (1), 64-68 (2014) PUBMED 22805237 REFERENCE 2 (bases 1 to 567) AUTHORS Kim,K.H., Kim,E.Y. and Lee,K.A. TITLE SEBOX is essential for early embryogenesis at the two-cell stage in the mouse JOURNAL Biol Reprod 79 (6), 1192-1201 (2008) PUBMED 18753614 REFERENCE 3 (bases 1 to 567) AUTHORS Cinquanta,M., Rovescalli,A.C., Kozak,C.A. and Nirenberg,M. TITLE Mouse Sebox homeobox gene expression in skin, brain, oocytes, and two-cell embryos JOURNAL Proc Natl Acad Sci U S A 97 (16), 8904-8909 (2000) PUBMED 10922053 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF284338.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA5756307, SAMEA5760400 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..567 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="10" /map="10q25" gene 1..567 /gene="Sebox" /gene_synonym="Og9x" /note="SEBOX homeobox" /db_xref="GeneID:58922" /db_xref="RGD:62077" CDS 1..567 /gene="Sebox" /gene_synonym="Og9x" /note="homeobox OG-9; skin-, embryo-, brain- and oocyte-specific homeobox; OG9 homeobox" /codon_start=1 /product="homeobox protein SEBOX" /protein_id="NP_076441.1" /db_xref="GeneID:58922" /db_xref="RGD:62077" /translation="
MASPVEASPGCASGLGPHRRKRTTFSVGQLLELERVFAARPYPDISTREHLAQITHLPEAKIQVWFQNRRAKRIKDRKPGALNARLELPPNCSLPDTPQLSWDPGTPSHPLHSTSSAQQTSACPPQTSCLAPILGPGQSWSGAKAAAPWGTSEVSGVHSLEQIVPQTSLGNLSDLIYTSAIVTNVDHS"
misc_feature <37..363
/gene="Sebox"
/gene_synonym="Og9x"
/note="Homeodomain-containing transcription factor
[Transcription]; Region: COG5576"
/db_xref="CDD:227863"
misc_feature 55..216
/gene="Sebox"
/gene_synonym="Og9x"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
misc_feature 238..375
/gene="Sebox"
/gene_synonym="Og9x"
/note="propagated from UniProtKB/Swiss-Prot (Q9ERS8.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
exon 1..28
/gene="Sebox"
/gene_synonym="Og9x"
/inference="alignment:Splign:2.1.0"
exon 29..189
/gene="Sebox"
/gene_synonym="Og9x"
/inference="alignment:Splign:2.1.0"
exon 190..567
/gene="Sebox"
/gene_synonym="Og9x"
/inference="alignment:Splign:2.1.0"
ORIGIN
atggccagtcctgtggaggcatctccaggctgtgccagtgggttgggtccccatcggaggaagaggaccacttttagtgttgggcagttgctggagctggaacgggtatttgcagctaggccctatcctgacatcagcacccgtgagcacctggctcagataactcacctgccagaagccaagatccaggtgtggttccagaaccgtcgagccaagagaatcaaggacagaaagccaggagccctaaacgccaggctggagcttcccccaaactgttctcttccagacactccccagctatcttgggaccctggaacaccaagccatcctctacactctaccagttcagctcagcagacttcggcatgcccaccacagacctcctgcctagcccccattttgggtccagggcagagttggtcaggggctaaagctgcagccccatgggggacaagtgaggtgtcaggagttcactctttagagcaaattgttcctcagacttcactgggcaacctgtctgaccttatctatacctcagccatcgtcaccaatgtagaccactcctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]