2025-07-10 17:17:05, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_022528 2065 bp mRNA linear ROD 13-FEB-2025 DEFINITION Rattus norvegicus hypoxia inducible factor 3 subunit alpha (Hif3a), transcript variant 1, mRNA. ACCESSION NM_022528 VERSION NM_022528.3 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2065) AUTHORS Xu,Y., Hu,T., Ding,H., Yuan,Y. and Chen,R. TITLE miR-485-5p alleviates obstructive sleep apnea syndrome with hypertension by inhibiting PI3K/AKT signaling pathway via downregulating HIF3A expression JOURNAL Sleep Breath 27 (1), 109-119 (2023) PUBMED 35132534 REMARK GeneRIF: miR-485-5p alleviates obstructive sleep apnea syndrome with hypertension by inhibiting PI3K/AKT signaling pathway via downregulating HIF3A expression. REFERENCE 2 (bases 1 to 2065) AUTHORS Yang,M., Yan,X., Yuan,F.Z., Ye,J., Du,M.Z., Mao,Z.M., Xu,B.B., Chen,Y.R., Song,Y.F., Fan,B.S. and Yu,J.K. TITLE MicroRNA-210-3p Promotes Chondrogenic Differentiation and Inhibits Adipogenic Differentiation Correlated with HIF-3alpha Signalling in Bone Marrow Mesenchymal Stem Cells JOURNAL Biomed Res Int 2021, 6699910 (2021) PUBMED 33937412 REMARK GeneRIF: MicroRNA-210-3p Promotes Chondrogenic Differentiation and Inhibits Adipogenic Differentiation Correlated with HIF-3alpha Signalling in Bone Marrow Mesenchymal Stem Cells. Publication Status: Online-Only REFERENCE 3 (bases 1 to 2065) AUTHORS Coelho,N.R., Tomkiewicz,C., Correia,M.J., Goncalves-Dias,C., Barouki,R., Pereira,S.A., Coumoul,X. and Monteiro,E.C. TITLE First evidence of aryl hydrocarbon receptor as a druggable target in hypertension induced by chronic intermittent hypoxia JOURNAL Pharmacol Res 159, 104869 (2020) PUBMED 32416216 REFERENCE 4 (bases 1 to 2065) AUTHORS Drevytska,T., Gonchar,E., Okhai,I., Lynnyk,O., Mankovska,I., Klionsky,D. and Dosenko,V. TITLE The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation JOURNAL Life Sci 202, 131-139 (2018) PUBMED 29660430 REMARK GeneRIF: Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against anoxia-reoxygenation injury via the HIF signaling pathway REFERENCE 5 (bases 1 to 2065) AUTHORS Cuomo,F., Coppola,A., Botti,C., Maione,C., Forte,A., Scisciola,L., Liguori,G., Caiafa,I., Ursini,M.V., Galderisi,U., Cipollaro,M., Altucci,L. and Cobellis,G. TITLE Pro-inflammatory cytokines activate hypoxia-inducible factor 3alpha via epigenetic changes in mesenchymal stromal/stem cells JOURNAL Sci Rep 8 (1), 5842 (2018) PUBMED 29643458 REMARK GeneRIF: Study in human mesenchymal stromal/stem cells revealed robust hypermethylation of histone H3 across HIF3A locus driven by pro-inflammatory cytokines. Experiments in a murine model of arteriotomy highlighted the activation of Hif3alpha expression in infiltrated inflammatory cells, suggesting a new role for Hif3alpha in inflammation in vivo. Erratum:[Sci Rep. 2020 Apr 17;10(1):6776. doi: 10.1038/s41598-020-62861-8.. PMID: 32303693] Publication Status: Online-Only REFERENCE 6 (bases 1 to 2065) AUTHORS Li,Q.F. and Dai,A.G. TITLE Differential expression of three hypoxia-inducible factor-alpha subunits in pulmonary arteries of rat with hypoxia-induced hypertension JOURNAL Acta Biochim Biophys Sin (Shanghai) 37 (10), 665-672 (2005) PUBMED 16215633 REMARK GeneRIF: HIF-1alpha, HIF-2alpha and HIF-3alpha may not only confer different target genes, but also play key pathogenetic roles in hypoxic-induced pulmonary hypertension. REFERENCE 7 (bases 1 to 2065) AUTHORS Heidbreder,M., Frohlich,F., Johren,O., Dendorfer,A., Qadri,F. and Dominiak,P. TITLE Hypoxia rapidly activates HIF-3alpha mRNA expression JOURNAL FASEB J 17 (11), 1541-1543 (2003) PUBMED 12824304 REMARK GeneRIF: Hypoxia rapidly activates HIF-3alpha mRNA expression REFERENCE 8 (bases 1 to 2065) AUTHORS Hara,S., Hamada,J., Kobayashi,C., Kondo,Y. and Imura,N. TITLE Expression and characterization of hypoxia-inducible factor (HIF)-3alpha in human kidney: suppression of HIF-mediated gene expression by HIF-3alpha JOURNAL Biochem Biophys Res Commun 287 (4), 808-813 (2001) PUBMED 11573933 REFERENCE 9 (bases 1 to 2065) AUTHORS Kietzmann,T., Cornesse,Y., Brechtel,K., Modaressi,S. and Jungermann,K. TITLE Perivenous expression of the mRNA of the three hypoxia-inducible factor alpha-subunits, HIF1alpha, HIF2alpha and HIF3alpha, in rat liver JOURNAL Biochem J 354 (Pt 3), 531-537 (2001) PUBMED 11237857 REFERENCE 10 (bases 1 to 2065) AUTHORS Gu,Y.Z., Moran,S.M., Hogenesch,J.B., Wartman,L. and Bradfield,C.A. TITLE Molecular characterization and chromosomal localization of a third alpha-class hypoxia inducible factor subunit, HIF3alpha JOURNAL Gene Expr 7 (3), 205-213 (1998) PUBMED 9840812 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000001.1. On Nov 25, 2020 this sequence version replaced NM_022528.2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ277827.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA5760383, SAMEA5760389 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-23 JAXUCZ010000001.1 86872083-86872105 c 24-214 JAXUCZ010000001.1 86871770-86871960 c 215-360 JAXUCZ010000001.1 86870256-86870401 c 361-445 JAXUCZ010000001.1 86867879-86867963 c 446-558 JAXUCZ010000001.1 86866999-86867111 c 559-767 JAXUCZ010000001.1 86866431-86866639 c 768-874 JAXUCZ010000001.1 86864244-86864350 c 875-1022 JAXUCZ010000001.1 86863842-86863989 c 1023-1135 JAXUCZ010000001.1 86860356-86860468 c 1136-1326 JAXUCZ010000001.1 86859373-86859563 c 1327-1428 JAXUCZ010000001.1 86857163-86857264 c 1429-1700 JAXUCZ010000001.1 86855165-86855436 c 1701-1812 JAXUCZ010000001.1 86853682-86853793 c 1813-1894 JAXUCZ010000001.1 86852083-86852164 c 1895-2065 JAXUCZ010000001.1 86850554-86850724 c FEATURES Location/Qualifiers source 1..2065 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="1" /map="1q21" gene 1..2065 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="hypoxia inducible factor 3 subunit alpha" /db_xref="GeneID:64345" /db_xref="RGD:70332" exon 1..23 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" CDS 4..1992 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /function="transcription factor" /note="isoform 1 is encoded by transcript variant 1; HIF3-alpha; HIF-3-alpha; HIF3-alpha-1; hypoxia inducible factor 3, alpha subunit; hypoxia inducible factor 3a; Inhibitory PAS (Per/Arnt/Sim) domain protein; hypoxia-inducible factor 3-alpha" /codon_start=1 /product="hypoxia-inducible factor 3-alpha isoform 1" /protein_id="NP_071973.2" /db_xref="GeneID:64345" /db_xref="RGD:70332" /translation="
MDWDQDRSSTELRKEKSRDAARSRRSQETEVLYQLAHTLPFARGVSAHLDKASIMRLTISYLRMHRLCAAGEWNQVGKEGEPLDACYLKALEGFVMVLTAEGDMAYLSENVSKHLGLSQLELIGHSIFDFIHPCDQEELQDALTPRPSLSKKKSEAATGRHFSLRMKSTLTSRGRTLNLKAATWKVLHCSGHMRAYKPPAQTSPAGSPRSEPPLQCLVLICEAIPHPASLEPPLGRGAFLSRHSLDMKFTYCDERIAEVAGYSPDDLIGCSAYEYIHALDSDAVSRSIHTLLSKGQAVTGQYRFLARTGGYLWTQTQATVVSGGRGPQSESIICVHFLISRVEENGVVLSLEQTEQHTRRPPQLGTSSKKGIPGNSLDPPAPRILAFLHPPALSEASLAADPRRFCSPDLRRLMAPILDGPPTAATPSTPQAARRPQSPLPADLPDQLAVGLENAHRLSTARKNKTMETDLDIAQDPDTLDLEMLAPYISMDDDFQLNSSEQLPKVHRRPPRTARRPRARSFHGLSPPIPEATLLPRWGSDPRLNCSSSSKGDPPTAPLTPRTRKRALAQSSEDKGLELLETKPPKRSPRLEPGSVLLPPLSLSFLLQGRQLPGNQPDPRAPLVDSHEPLGLAPSLLSLYQHEETIQPRNHFLPAAGLAQTH"
misc_feature 4..78 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 31..219 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="basic helix-loop-helix-Per-ARNT-Sim (bHLH-PAS) domain found in hypoxia-inducible factor 3-alpha (HIF3a) and similar proteins; Region: bHLH-PAS_HIF3a_PASD7; cd19729" /db_xref="CDD:381572" misc_feature order(40..45,49..57,64..69,73..78,151..156) /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="putative DNA binding site [nucleotide binding]; other site" /db_xref="CDD:381572" misc_feature order(82..87,91..96,103..108,115..120,151..159,166..171, 178..180,187..192,199..201) /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="putative dimer interface [polypeptide binding]; other site" /db_xref="CDD:381572" misc_feature 226..297 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Nuclear localization signal. /evidence=ECO:0000250|UniProtKB:Q0VBL6" misc_feature 265..432 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="PAS domain; Region: PAS; smart00091" /db_xref="CDD:214512" misc_feature 685..819 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Nuclear export signal. /evidence=ECO:0000250|UniProtKB:Q0VBL6" misc_feature 748..1011 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="PAS fold; Region: PAS_3; pfam08447" /db_xref="CDD:430001" misc_feature order(757..759,769..771,787..789,826..837,913..915, 928..930) /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="putative active site [active]" /db_xref="CDD:238075" misc_feature order(817..819,829..831,853..855,862..867,949..951, 955..957) /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="heme pocket [chemical binding]; other site" /db_xref="CDD:238075" misc_feature 1057..1140 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature <1075..1896 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="large tegument protein UL36; Provisional; Region: PHA03247" /db_xref="CDD:223021" misc_feature 1231..1242 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: LRRLL" misc_feature 1252..1338 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1345..1746 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: ODD" misc_feature 1351..1506 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: NTAD" misc_feature 1378..1443 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1420..1515 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="Hypoxia-inducible factor-1; Region: HIF-1; pfam11413" /db_xref="CDD:463274" misc_feature 1456..1479 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: LAPYISMD" misc_feature 1462..1464 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="4-hydroxyproline. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); hydroxylation site" misc_feature 1501..1788 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /note="propagated from UniProtKB/Swiss-Prot (Q9JHS2.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 24..214 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 215..360 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 361..445 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 446..558 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 559..767 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 768..874 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 875..1022 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1023..1135 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1136..1326 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1327..1428 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1429..1700 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1701..1812 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1813..1894 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" exon 1895..2065 /gene="Hif3a" /gene_synonym="Ipas; Mop7" /inference="alignment:Splign:2.1.0" ORIGIN
cacatggactgggaccaagacaggtcgagcaccgagctgcggaaggagaagtcgcgggatgcggcccgcagcaggcgcagccaggagacggaggtgctgtaccaactggcgcacaccctgccctttgcgcgcggcgtcagcgcgcacctggacaaggcctccatcatgcgcctcacaatcagctacttgcgcatgcaccgcctctgcgctgcaggggagtggaaccaggtgggaaaagagggagaaccactggacgcctgctacctgaaggccctggagggtttcgtcatggtgctcaccgctgagggagacatggcttacctgtcggaaaatgtcagcaagcacctgggcctcagtcagctggagctcattggacacagtatctttgattttatccatccctgtgaccaagaggaactccaggatgccctgaccccgagaccaagcctgtcaaagaagaagtcagaagcagcaacaggacgccacttttccctgcgaatgaagagcacactcaccagcagggggcgcacgctgaacctcaaagcggccacctggaaggtgctgcactgctcaggacatatgagggcctacaagccccctgcacagacttcccccgccgggagccctcgctccgagcctcccctgcaatgcctggtgcttatctgtgaagccatcccccacccagccagtctggagcccccactgggccgaggggcctttctcagtcgccacagcctggacatgaagttcacatactgcgacgagaggattgcagaagttgctggctacagccccgatgacctgattggctgttctgcctatgaatacatccacgctttggactctgatgcagtcagcaggagcatccacactttgctgagcaagggccaggcagtaacagggcagtatcgcttcctggcccggactggaggctatctgtggactcagactcaggctacagtggtgtcaggggggcggggcccccagtcggaaagtatcatctgcgtccacttcctgatcagccgtgtagaagagaacggagtggtgctgtccctggaacaaacggagcaacatactcgcagaccccctcagctgggtacctcctcgaagaagggtatcccaggcaacagtctagaccctcccgctccacggatcctggccttcctgcaccctccagccctgagtgaggcctccctggctgctgaccctcgccgtttttgtagcccagacctgcgccgcctcatggcacccatcctggatggacctcccacagccgctacccccagcaccccgcaagctgcacggagaccccaaagtcctcttccggctgatctcccagatcagttggctgtgggcttggagaatgcacacagactctccactgcccggaaaaacaagaccatggagacagatctagatatagctcaggaccctgacactctggacttggagatgttggctccgtacatctccatggatgatgacttccagctcaactccagcgagcaattgcccaaagtccaccgcagacctcccaggacggcccgcaggcctcgtgctcggagcttccatggcctgtcgcctcccatccctgaggccaccctgctgccccgctgggggagtgatccacgactgaactgttccagctcctccaagggggatccccccacagcccccctgacgcctagaactcggaagagggccttggcccagagctcagaggacaaagggttggagctgctggaaacgaagccccccaagcggtccccaagactagaacctggaagtgtcctgctgcctccgctcagcctgagtttccttctgcaaggtcgacaacttccagggaaccagccggatcccagagccccactcgtggattcgcatgagcccttgggcctagctccctcgctgctctctctctaccagcatgaggaaactatccagcccaggaaccacttcctcccagcagcaggcttggcccagacacactgagtcagccttcctctcagccctcttcttctaccccagaaaggactcagccgcactccacaccagcagcctacac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]