GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:12:42, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_020634               1236 bp    mRNA    linear   PRI 22-AUG-2019
DEFINITION  Homo sapiens growth differentiation factor 3 (GDF3), mRNA.
ACCESSION   NM_020634
VERSION     NM_020634.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1236)
  AUTHORS   Chen J, Li X, Niu Y, Wu Z and Qiu G.
  TITLE     Functional and In Silico Assessment of GDF3 Gene Variants in a
            Chinese Congenital Scoliosis Population
  JOURNAL   Med. Sci. Monit. 24, 2992-3001 (2018)
   PUBMED   29735971
  REMARK    GeneRIF: the 4 of the 5 variants in [i]GDF3[/i] gene contribute
            different pathogenicity in congenital scoliosis, which may provide
            molecular evidence for clinical genetic testing.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1236)
  AUTHORS   Han MH, Park SW, Do HJ, Chung HJ, Song H, Kim JH, Kim NH, Park KH
            and Kim JH.
  TITLE     Growth and Differentiation Factor 3 Is Transcriptionally Regulated
            by OCT4 in Human Embryonic Carcinoma Cells
  JOURNAL   Biol. Pharm. Bull. 39 (11), 1802-1808 (2016)
   PUBMED   27803451
  REMARK    GeneRIF: OCT4 plays a role as a transcriptional activator for GDF3
            transcription in pluripotent human embryonic carcinoma NCCIT cells
            and contributes to the understanding of the molecular networks of
            stem cell regulators in germ cell-derived pluripotency and
            tumorigenesis.
REFERENCE   3  (bases 1 to 1236)
  AUTHORS   Xiao J, Kang G, Wang J, Li T, Chen J, Wang J, Li W and Wang B.
  TITLE     A novel variation of GDF3 in Chinese Han children with a broad
            phenotypic spectrum of non-syndromic CHDs
  JOURNAL   Cardiol Young 25 (7), 1263-1267 (2015)
   PUBMED   25372014
  REMARK    GeneRIF: The results expand the spectrum of mutations associated
            with CHDs and first suggest the potentially disease-related GDF3
            gene variant in the pathogenesis of CHDs.
REFERENCE   4  (bases 1 to 1236)
  AUTHORS   Del-Aguila JL, Beitelshees AL, Cooper-Dehoff RM, Chapman AB, Gums
            JG, Bailey K, Gong Y, Turner ST, Johnson JA and Boerwinkle E.
  TITLE     Genome-wide association analyses suggest NELL1 influences adverse
            metabolic response to HCTZ in African Americans
  JOURNAL   Pharmacogenomics J. 14 (1), 35-40 (2014)
   PUBMED   23400010
REFERENCE   5  (bases 1 to 1236)
  AUTHORS   Park SW, Lim HY, Do HJ, Sung B, Huh SH, Uhm SJ, Song H, Chung HJ,
            Kim JH, Kim NH and Kim JH.
  TITLE     Regulation of human growth and differentiation factor 3 gene
            expression by NANOG in human embryonic carcinoma NCCIT cells
  JOURNAL   FEBS Lett. 586 (19), 3529-3535 (2012)
   PUBMED   22963770
  REMARK    GeneRIF: first evidence that NANOG is a transcriptional activator
            of the expression of the oncogenic growth factor GDF3 in embryonic
            carcinoma cells
REFERENCE   6  (bases 1 to 1236)
  AUTHORS   Hexige S, Guo J, Ma L, Sun Y, Liu X, Ma L, Yan X, Li Z and Yu L.
  TITLE     Expression pattern of growth/differentiation factor 3 in human and
            murine cerebral cortex, hippocampus as well as cerebellum
  JOURNAL   Neurosci. Lett. 389 (2), 83-87 (2005)
   PUBMED   16126341
  REMARK    GeneRIF: Present data suggested that GDF3 might play important
            roles in the central nervous system (CNS), especially in cerebral
            cortex, hippocampus and cerebellum, and it shed new light on
            further research of GDF3 in the central nervous system.
REFERENCE   7  (bases 1 to 1236)
  AUTHORS   Clark HF, Gurney AL, Abaya E, Baker K, Baldwin D, Brush J, Chen J,
            Chow B, Chui C, Crowley C, Currell B, Deuel B, Dowd P, Eaton D,
            Foster J, Grimaldi C, Gu Q, Hass PE, Heldens S, Huang A, Kim HS,
            Klimowski L, Jin Y, Johnson S, Lee J, Lewis L, Liao D, Mark M,
            Robbie E, Sanchez C, Schoenfeld J, Seshagiri S, Simmons L, Singh J,
            Smith V, Stinson J, Vagts A, Vandlen R, Watanabe C, Wieand D, Woods
            K, Xie MH, Yansura D, Yi S, Yu G, Yuan J, Zhang M, Zhang Z, Goddard
            A, Wood WI, Godowski P and Gray A.
  TITLE     The secreted protein discovery initiative (SPDI), a large-scale
            effort to identify novel human secreted and transmembrane proteins:
            a bioinformatics assessment
  JOURNAL   Genome Res. 13 (10), 2265-2270 (2003)
   PUBMED   12975309
  REMARK    Erratum:[Genome Res. 2003 Dec;13(12):2759]
REFERENCE   8  (bases 1 to 1236)
  AUTHORS   Ducy P and Karsenty G.
  TITLE     The family of bone morphogenetic proteins
  JOURNAL   Kidney Int. 57 (6), 2207-2214 (2000)
   PUBMED   10844590
  REMARK    Review article
REFERENCE   9  (bases 1 to 1236)
  AUTHORS   Caricasole AA, van Schaik RH, Zeinstra LM, Wierikx CD, van Gurp RJ,
            van den Pol M, Looijenga LH, Oosterhuis JW, Pera MF, Ward A, de
            Bruijn D, Kramer P, de Jong FH and van den Eijnden-van Raaij AJ.
  TITLE     Human growth-differentiation factor 3 (hGDF3): developmental
            regulation in human teratocarcinoma cell lines and expression in
            primary testicular germ cell tumours
  JOURNAL   Oncogene 16 (1), 95-103 (1998)
   PUBMED   9467948
REFERENCE   10 (bases 1 to 1236)
  AUTHORS   McPherron AC and Lee SJ.
  TITLE     GDF-3 and GDF-9: two new members of the transforming growth
            factor-beta superfamily containing a novel pattern of cysteines
  JOURNAL   J. Biol. Chem. 268 (5), 3444-3449 (1993)
   PUBMED   8429021
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AY358875.1, AF263538.1 and
            AA926805.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 22, 2018 this sequence version replaced NM_020634.2.
            
            Summary: This gene encodes a secreted ligand of the TGF-beta
            (transforming growth factor-beta) superfamily of proteins. Ligands
            of this family bind various TGF-beta receptors leading to
            recruitment and activation of SMAD family transcription factors
            that regulate gene expression. The encoded preproprotein is
            proteolytically processed to generate each subunit of the
            disulfide-linked homodimer. This protein plays a role ocular and
            skeletal development. Mutations in this gene are associated with
            microphthalmia, coloboma, and skeletal abnormalities in human
            patients. [provided by RefSeq, Aug 2016].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY358875.1, BC030959.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968540, SAMEA1968968
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000329913.4/ ENSP00000331745.3
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                AY358875.1         19-29
            12-1235             AF263538.1         1-1224
            1236-1236           AA926805.1         14-14               c
FEATURES             Location/Qualifiers
     source          1..1236
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.31"
     gene            1..1236
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /note="growth differentiation factor 3"
                     /db_xref="GeneID:9573"
                     /db_xref="HGNC:HGNC:4218"
                     /db_xref="MIM:606522"
     exon            1..315
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754059336"
     variation       6
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335063092"
     variation       8
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778063159"
     variation       9..11
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="agt"
                     /db_xref="dbSNP:1565450527"
     variation       11
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756382150"
     variation       12
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753133941"
     variation       14
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565450525"
     variation       16
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767808565"
     variation       20
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184950000"
     variation       21
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442521995"
     variation       22
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747977252"
     variation       23
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774336055"
     variation       24
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201794479"
     variation       26
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761412168"
     variation       27
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200725346"
     variation       28
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201617669"
     variation       30
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202105265"
     variation       31
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239334185"
     variation       32
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283064060"
     variation       37
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374625413"
     variation       38
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478645798"
     variation       39
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749302382"
     variation       41
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768378840"
     variation       45
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339950772"
     CDS             48..1142
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /codon_start=1
                     /product="growth/differentiation factor 3 preproprotein"
                     /protein_id="NP_065685.1"
                     /db_xref="CCDS:CCDS8581.1"
                     /db_xref="GeneID:9573"
                     /db_xref="HGNC:HGNC:4218"
                     /db_xref="MIM:606522"
                     /translation="
MLRFLPDLAFSFLLILALGQAVQFQEYVFLQFLGLDKAPSPQKFQPVPYILKKIFQDREAAATTGVSRDLCYVKELGVRGNVLRFLPDQGFFLYPKKISQASSCLQKLLYFNLSAIKEREQLTLAQLGLDLGPNSYYNLGPELELALFLVQEPHVWGQTTPKPGKMFVLRSVPWPQGAVHFNLLDVAKDWNDNPRKNFGLFLEILVKEDRDSGVNFQPEDTCARLRCSLHASLLVVTLNPDQCHPSRKRRAAIPVPKLSCKNLCHRHQLFINFRDLGWHKWIIAPKGFMANYCHGECPFSLTISLNSSNYAFMQALMHAVDPEIPQAVCIPTKLSPISMLYQDNNDNVILRHYEDMVVDECGCG"
     sig_peptide     48..119
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="{ECO:0000255}; propagated from UniProtKB/Swiss-Prot
                     (Q9NR23.3)"
     misc_feature    <372..707
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /note="TGF-beta propeptide; Region: TGFb_propeptide;
                     pfam00688"
                     /db_xref="CDD:279078"
     misc_feature    381..383
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-linked (GlcNAc...) asparagine. {ECO:0000255};
                     propagated from UniProtKB/Swiss-Prot (Q9NR23.3);
                     glycosylation site"
     mat_peptide     798..1139
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /product="Growth/differentiation factor 3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NR23.3)"
     misc_feature    837..1139
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /note="Transforming growth factor-beta (TGF-beta) family;
                     Region: TGFB; smart00204"
                     /db_xref="CDD:214556"
     misc_feature    963..965
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-linked (GlcNAc...) asparagine. {ECO:0000255};
                     propagated from UniProtKB/Swiss-Prot (Q9NR23.3);
                     glycosylation site"
     variation       48
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332369197"
     variation       51
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446820299"
     variation       54
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402717557"
     variation       55
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760348396"
     variation       62
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775326966"
     variation       63
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771904963"
     variation       64
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745795680"
     variation       65
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164378662"
     variation       71
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778891651"
     variation       76
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998647139"
     variation       80
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904319810"
     variation       84
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772608870"
     variation       93
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375965543"
     variation       95
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749403801"
     variation       96
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992600441"
     variation       97
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415397409"
     variation       100
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777814239"
     variation       102
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943317807"
     variation       103
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910448905"
     variation       104
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144267553"
     variation       107
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752908581"
     variation       113
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384474719"
     variation       114
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755588787"
     variation       117
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282564187"
     variation       122
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433116456"
     variation       125
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341411029"
     variation       126
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372677651"
     variation       129
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977352073"
     variation       130
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752043502"
     variation       137
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166037433"
     variation       141..145
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="t"
                     /replace="tttct"
                     /db_xref="dbSNP:1160994153"
     variation       142
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767006467"
     variation       145
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412440132"
     variation       149
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478585475"
     variation       150
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756777733"
     variation       152
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753420067"
     variation       153
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745461299"
     variation       154
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760355594"
     variation       158
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376751766"
     variation       159
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565450441"
     variation       160
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767298278"
     variation       161
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144330834"
     variation       162
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565450431"
     variation       167
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770882875"
     variation       168
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216350152"
     variation       170
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:17727707"
     variation       176
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773317311"
     variation       193
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217051203"
     variation       196
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769819487"
     variation       197
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748396785"
     variation       199
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146378324"
     variation       206
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1436355007"
     variation       208
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910081119"
     variation       209
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375720989"
     variation       212
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331488229"
     variation       214
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435010804"
     variation       219
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755337048"
     variation       220
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747399055"
     variation       221
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780667706"
     variation       222
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476673248"
     variation       228
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142236459"
     variation       229
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191605231"
     variation       232
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763647791"
     variation       233
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752330502"
     variation       241
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767175414"
     variation       245
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565450388"
     variation       248
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368170617"
     variation       249
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373943760"
     variation       250
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372020374"
     variation       251
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1241920532"
     variation       252
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769843759"
     variation       253
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056571163"
     variation       255
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748189142"
     variation       256
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776944353"
     variation       257
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1565450369"
     variation       258
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747276140"
     variation       260
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245646792"
     variation       262
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780544740"
     variation       263
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998594652"
     variation       264
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746383540"
     variation       266
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330143414"
     variation       268
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779295521"
     variation       270
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1360483924"
     variation       273
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755595648"
     variation       277
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413628563"
     variation       278
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448664549"
     variation       279..283
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="gtccg"
                     /replace="gtccggtccg"
                     /db_xref="dbSNP:1176907428"
     variation       279
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780787386"
     variation       280
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1180424068"
     variation       282
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440316924"
     variation       283
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376010944"
     variation       284
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180771569"
     variation       285
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381112468"
     variation       287
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021898446"
     variation       288
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751268973"
     variation       294
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161384037"
     variation       297
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867390778"
     variation       298
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766154682"
     variation       300
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288683440"
     variation       305
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007367358"
     variation       311
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762659293"
     variation       313
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376872411"
     exon            316..1236
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /inference="alignment:Splign:2.1.0"
     variation       316
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753885780"
     variation       317
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764266672"
     variation       322
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760842902"
     variation       324
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866866466"
     variation       333
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922754786"
     variation       334
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422154711"
     variation       335
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775800295"
     variation       339
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225515360"
     variation       340
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194658272"
     variation       341
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772208133"
     variation       343
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866471146"
     variation       344
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212151941"
     variation       345
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203138467"
     variation       347
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759910014"
     variation       353
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574345420"
     variation       354
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220264685"
     variation       355
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243371429"
     variation       364
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771380810"
     variation       368
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769740914"
     variation       369
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778254290"
     variation       374
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:763257668"
     variation       376
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768095773"
     variation       384
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148657137"
     variation       385
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779716896"
     variation       390
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391303311"
     variation       393
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150698698"
     variation       394
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755559313"
     variation       399
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402561130"
     variation       402
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781103234"
     variation       403
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757186246"
     variation       404
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753764679"
     variation       405
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745444458"
     variation       408
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:983725587"
     variation       409
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766549202"
     variation       411
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756217564"
     variation       413
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752755070"
     variation       417
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767679623"
     variation       421
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774698812"
     variation       423
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565448955"
     variation       425
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322983442"
     variation       426
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367760258"
     variation       430
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763318155"
     variation       435
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867050182"
     variation       437
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1380892294"
     variation       442
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374666455"
     variation       448
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773659015"
     variation       454
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160498720"
     variation       461..462
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1235088374"
     variation       461
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249282318"
     variation       464
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331473247"
     variation       465
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376200767"
     variation       467
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438692784"
     variation       473
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748693630"
     variation       474
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350071061"
     variation       475
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236700210"
     variation       481
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751673182"
     variation       485
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281061393"
     variation       486
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771670847"
     variation       491
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252597994"
     variation       495
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745503994"
     variation       496..497
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1565448915"
     variation       500
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370033213"
     variation       501
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778633328"
     variation       505
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375002535"
     variation       507
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377439089"
     variation       510
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749120756"
     variation       514
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442128614"
     variation       517
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239441863"
     variation       521
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178663668"
     variation       523..524
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1565448902"
     variation       526
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199585440"
     variation       527
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141133108"
     variation       528
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148203165"
     variation       533
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250662894"
     variation       535
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767485915"
     variation       537
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553234393"
     variation       538
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255258259"
     variation       539
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1231956592"
     variation       541
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1435710981"
     variation       545
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370123047"
     variation       548
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355831357"
     variation       551
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309918999"
     variation       552
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755086344"
     variation       554
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751671561"
     variation       555
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752562423"
     variation       556
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145849916"
     variation       558
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762214167"
     variation       568
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919959443"
     variation       571
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172215670"
     variation       581
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200893461"
     variation       586
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771418785"
     variation       587
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745398811"
     variation       590
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438476611"
     variation       603
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773829666"
     variation       607
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774332305"
     variation       608
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748993038"
     variation       613
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1565448864"
     variation       614
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185665015"
     variation       617
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442686248"
     variation       623
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288835739"
     variation       624
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255192350"
     variation       626..632
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="cccccgg"
                     /db_xref="dbSNP:1436757929"
     variation       626
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144017935"
     variation       628
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489168799"
     variation       630
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112895783"
     variation       631
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146973734"
     variation       641
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754962446"
     variation       642
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778768975"
     variation       643
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780146775"
     variation       644
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758597222"
     variation       650
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750702346"
     variation       651
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311325872"
     variation       653
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374679722"
     variation       656
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402164361"
     variation       657
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765581872"
     variation       659
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183339590"
     variation       660
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762243949"
     variation       662
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399533347"
     variation       663
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754242314"
     variation       671
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164548351"
     variation       673
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472855602"
     variation       674
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764686808"
     variation       676
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1489115606"
     variation       676
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758931622"
     variation       680
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773970500"
     variation       682
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372790667"
     variation       684
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12819884"
     variation       687
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772999113"
     variation       689
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149033500"
     variation       691
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355735437"
     variation       693
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780949985"
     variation       698
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768605823"
     variation       699
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341513319"
     variation       706
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1397455014"
     variation       708
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748834598"
     variation       709
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278006336"
     variation       710
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145601141"
     variation       714
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413735924"
     variation       728
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777121834"
     variation       730
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780093783"
     variation       731
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758541074"
     variation       735
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750578270"
     variation       736
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779122666"
     variation       739
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162334087"
     variation       743
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478637864"
     variation       746
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757517038"
     variation       747
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049872479"
     variation       749
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474321025"
     variation       750
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324125983"
     variation       754
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964227223"
     variation       756
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934067367"
     variation       759
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754263899"
     variation       763
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764408748"
     variation       764
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192886112"
     variation       765
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761226379"
     variation       767
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337955330"
     variation       769
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271418881"
     variation       770
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753318345"
     variation       776
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318930363"
     variation       780
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257694470"
     variation       786
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765916852"
     variation       787
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150170520"
     variation       796
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772947792"
     variation       798
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764970795"
     variation       807
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761410871"
     variation       809
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184707369"
     variation       810
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776464295"
     variation       816
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373667885"
     variation       817
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400521324"
     variation       833
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746944156"
     variation       834
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1407945287"
     variation       836
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427071129"
     variation       839
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775410550"
     variation       841
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453762883"
     variation       842
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251191216"
     variation       843
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140926412"
     variation       844
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188391724"
     variation       847
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232452745"
     variation       848
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375877721"
     variation       849
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200736960"
     variation       853
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755438714"
     variation       857
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174006194"
     variation       863
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279864813"
     variation       864
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565448737"
     variation       865
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749525121"
     variation       867
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387906946"
     variation       868
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312136124"
     variation       870
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470277131"
     variation       877
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770848532"
     variation       884
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377010583"
     variation       889..890
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:773639222"
     variation       892
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753193988"
     variation       896
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768190600"
     variation       900
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757954351"
     variation       906
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176582388"
     variation       908
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433889449"
     variation       912
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749915057"
     variation       915
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160393098"
     variation       920
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764677731"
     variation       923
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146197089"
     variation       927
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175697361"
     variation       929
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776153306"
     variation       930
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763945162"
     variation       931
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045128714"
     variation       933
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760520873"
     variation       934
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775383579"
     variation       937
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772035749"
     variation       941
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745834613"
     variation       953
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316983030"
     variation       957
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774437736"
     variation       960
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770926140"
     variation       961
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:387906945"
     variation       964
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221236809"
     variation       973
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777919038"
     variation       976
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281809695"
     variation       977
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762094481"
     variation       978
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960039065"
     variation       979
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369640821"
     variation       985
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565448695"
     variation       987
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748566172"
     variation       990
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299948158"
     variation       993
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1420308640"
     variation       1004
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781716089"
     variation       1005..1008
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="gttg"
                     /db_xref="dbSNP:1334891664"
     variation       1005
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755496462"
     variation       1013
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425660441"
     variation       1015
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414716772"
     variation       1021
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566697767"
     variation       1023
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474421360"
     variation       1025
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207027801"
     variation       1026
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894362392"
     variation       1029
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2302516"
     variation       1030
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938495929"
     variation       1031
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778565308"
     variation       1046
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764004567"
     variation       1053
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485854651"
     variation       1056
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394607089"
     variation       1060
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968641196"
     variation       1067
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377296873"
     variation       1072
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:769932792"
     variation       1074
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259505995"
     variation       1077
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212984628"
     variation       1080
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021511286"
     variation       1084
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753515885"
     variation       1085
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1010919096"
     variation       1098
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232362708"
     variation       1099
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373439841"
     variation       1105
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889831803"
     variation       1110
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760430648"
     variation       1113
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382693842"
     variation       1114
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752447455"
     variation       1121
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753664039"
     variation       1122
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768472899"
     variation       1125
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866950336"
     variation       1130
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774156825"
     variation       1138
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758777639"
     variation       1139
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750988910"
     variation       1141
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186378311"
     variation       1142
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184349554"
     variation       1143
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475182091"
     variation       1144
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762995770"
     variation       1146
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773456270"
     variation       1147
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426201941"
     variation       1148
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194778821"
     variation       1155..1157
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1565448633"
     variation       1156
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428324398"
     variation       1160
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260178726"
     variation       1162
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210198212"
     variation       1167
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770103702"
     variation       1174
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748406454"
     variation       1176
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1273343151"
     variation       1178
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368157243"
     variation       1179
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769148436"
     variation       1181
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372341342"
     variation       1185
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227842019"
     variation       1192
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261417946"
     variation       1205
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963696193"
     variation       1209
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749962907"
     variation       1219
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019803817"
     variation       1226
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987091750"
     variation       1227
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037222646"
     variation       1231
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776168538"
     variation       1236
                     /gene="GDF3"
                     /gene_synonym="KFS3; MCOP7; MCOPCB6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761425629"
ORIGIN      
agtctggcagtggagctctccccggtctgacagccactccagaggccatgcttcgtttcttgccagatttggctttcagcttcctgttaattctggctttgggccaggcagtccaatttcaagaatatgtctttctccaatttctgggcttagataaggcgccttcaccccagaagttccaacctgtgccttatatcttgaagaaaattttccaggatcgcgaggcagcagcgaccactggggtctcccgagacttatgctacgtaaaggagctgggcgtccgcgggaatgtacttcgctttctcccagaccaaggtttctttctttacccaaagaaaatttcccaagcttcctcctgcctgcagaagctcctctactttaacctgtctgccatcaaagaaagggaacagttgacattggcccagctgggcctggacttggggcccaattcttactataacctgggaccagagctggaactggctctgttcctggttcaggagcctcatgtgtggggccagaccacccctaagccaggtaaaatgtttgtgttgcggtcagtcccatggccacaaggtgctgttcacttcaacctgctggatgtagctaaggattggaatgacaacccccggaaaaatttcgggttattcctggagatactggtcaaagaagatagagactcaggggtgaattttcagcctgaagacacctgtgccagactaagatgctcccttcatgcttccctgctggtggtgactctcaaccctgatcagtgccacccttctcggaaaaggagagcagccatccctgtccccaagctttcttgtaagaacctctgccaccgtcaccagctattcattaacttccgggacctgggttggcacaagtggatcattgcccccaaggggttcatggcaaattactgccatggagagtgtcccttctcactgaccatctctctcaacagctccaattatgctttcatgcaagccctgatgcatgccgttgacccagagatcccccaggctgtgtgtatccccaccaagctgtctcccatttccatgctctaccaggacaataatgacaatgtcattctacgacattatgaagacatggtagtcgatgaatgtgggtgtgggtaggatgtcagaaatgggaatagaaggagtgttcttagggtaaatcttttaataaaactacctatctggtttatgaccacttagatcgaaatgtcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]