GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:17:05, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_018223               3168 bp    mRNA    linear   PRI 02-AUG-2019
DEFINITION  Homo sapiens checkpoint with forkhead and ring finger domains
            (CHFR), transcript variant 4, mRNA.
ACCESSION   NM_018223
VERSION     NM_018223.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3168)
  AUTHORS   Cha Y, Kim SY, Yeo HY, Baek JY, Choi MK, Jung KH, Dong SM and Chang
            HJ.
  TITLE     Association of CHFR Promoter Methylation with Treatment Outcomes of
            Irinotecan-Based Chemotherapy in Metastatic Colorectal Cancer
  JOURNAL   Neoplasia 21 (1), 146-155 (2019)
   PUBMED   30562637
  REMARK    GeneRIF: These data suggest that CHFR methylation may be associated
            with favorable treatment outcomes of irinotecan-based chemotherapy
            in patients with metastatic colorectal cancer.
REFERENCE   2  (bases 1 to 3168)
  AUTHORS   Woo SR, Lee HJ, Oh SJ, Kim S, Park SH, Lee J, Song KH and Kim TW.
  TITLE     Stabilization of HDAC1 via TCL1-pAKT-CHFR axis is a key element for
            NANOG-mediated multi-resistance and stem-like phenotype in
            immune-edited tumor cells
  JOURNAL   Biochem. Biophys. Res. Commun. 503 (3), 1812-1818 (2018)
   PUBMED   30060952
  REMARK    GeneRIF: The results establish a firm molecular link in
            immune-edited tumor cells among NANOG, AKT, CHFR, and HDAC1,
            identifying HDAC1 as a molecular target in controlling NANOGHIGH
            immune-refractory cancer.
REFERENCE   3  (bases 1 to 3168)
  AUTHORS   Zhou JD, Zhang TJ, Li XX, Ma JC, Guo H, Wen XM, Yao DM, Zhang W,
            Lin J and Qian J.
  TITLE     Methylation-independent CHFR expression is a potential biomarker
            affecting prognosis in acute myeloid leukemia
  JOURNAL   J. Cell. Physiol. 233 (6), 4707-4714 (2018)
   PUBMED   29115660
  REMARK    GeneRIF: Lower CHFR expression was independently associated with
            unfavorable prognosis in acute myeloid leukemia. Moreover, aberrant
            CHFR promoter methylation was a rare event in myeloid malignances.
REFERENCE   4  (bases 1 to 3168)
  AUTHORS   Castellano L, Dabrowska A, Pellegrino L, Ottaviani S, Cathcart P,
            Frampton AE, Krell J and Stebbing J.
  TITLE     Sustained expression of miR-26a promotes chromosomal instability
            and tumorigenesis through regulation of CHFR
  JOURNAL   Nucleic Acids Res. 45 (8), 4401-4412 (2017)
   PUBMED   28126920
  REMARK    GeneRIF: Re-expression of CHFR in miR-26a overexpressing cells
            partially rescues normal mitosis and impairs the tumorigenesis
            exerted by miR-26a.
REFERENCE   5  (bases 1 to 3168)
  AUTHORS   Kim M, Kwon YE, Song JO, Bae SJ and Seol JH.
  TITLE     CHFR negatively regulates SIRT1 activity upon oxidative stress
  JOURNAL   Sci Rep 6, 37578 (2016)
   PUBMED   27883020
  REMARK    GeneRIF: JNK inhibitor prevents SIRT1 phosphorylation, leading to
            elevated SIRT1 protein levels even in the presence of H2O2. Taken
            together, our results indicate that CHFR plays a crucial role in
            the cellular stress response pathway by controlling the stability
            and function of SIRT1.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3168)
  AUTHORS   Sanbhnani S and Yeong FM.
  TITLE     CHFR: a key checkpoint component implicated in a wide range of
            cancers
  JOURNAL   Cell. Mol. Life Sci. 69 (10), 1669-1687 (2012)
   PUBMED   22159584
  REMARK    GeneRIF: CHFR is thought to contribute towards regulating mitotic
            entry and possible explanations for contradictory observations
            published on the functions and regulation of CHFR are presented.
            [review]
            Review article
REFERENCE   7  (bases 1 to 3168)
  AUTHORS   Mizuno K, Osada H, Konishi H, Tatematsu Y, Yatabe Y, Mitsudomi T,
            Fujii Y and Takahashi T.
  TITLE     Aberrant hypermethylation of the CHFR prophase checkpoint gene in
            human lung cancers
  JOURNAL   Oncogene 21 (15), 2328-2333 (2002)
   PUBMED   11948416
REFERENCE   8  (bases 1 to 3168)
  AUTHORS   Chaturvedi P, Sudakin V, Bobiak ML, Fisher PW, Mattern MR,
            Jablonski SA, Hurle MR, Zhu Y, Yen TJ and Zhou BB.
  TITLE     Chfr regulates a mitotic stress pathway through its RING-finger
            domain with ubiquitin ligase activity
  JOURNAL   Cancer Res. 62 (6), 1797-1801 (2002)
   PUBMED   11912157
  REMARK    GeneRIF: Chfr regulates a mitotic stress pathway through its
            RING-finger domain with ubiquitin ligase activity.
REFERENCE   9  (bases 1 to 3168)
  AUTHORS   Kang D, Chen J, Wong J and Fang G.
  TITLE     The checkpoint protein Chfr is a ligase that ubiquitinates Plk1 and
            inhibits Cdc2 at the G2 to M transition
  JOURNAL   J. Cell Biol. 156 (2), 249-259 (2002)
   PUBMED   11807090
  REMARK    GeneRIF: checkpoint protein Chfr is a ligase that ubiquitinates
            Plk1 and inhibits Cdc2 at the G2 to M transition
REFERENCE   10 (bases 1 to 3168)
  AUTHORS   Scolnick DM and Halazonetis TD.
  TITLE     Chfr defines a mitotic stress checkpoint that delays entry into
            metaphase
  JOURNAL   Nature 406 (6794), 430-435 (2000)
   PUBMED   10935642
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP313700.1, AK001658.1,
            AK027687.1, AC127070.10 and BC012072.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 6, 2009 this sequence version replaced NM_018223.1.
            
            Summary: This gene encodes an E3 ubiquitin-protein ligase required
            for the maintenance of the antephase checkpoint that regulates cell
            cycle entry into mitosis and, therefore, may play a key role in
            cell cycle progression and tumorigenesis. The encoded protein has
            an N-terminal forkhead-associated domain, a central RING-finger
            domain, and a cysteine-rich C-terminal region. Alternatively
            spliced transcript variants that encode different protein isoforms
            have been described. [provided by RefSeq, Mar 2014].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK001658.1, SRR1660809.224931.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-20                BP313700.1         1-20
            21-727              AK001658.1         1-707
            728-728             AK027687.1         809-809
            729-1344            AK001658.1         709-1324
            1345-1345           AK027687.1         1426-1426
            1346-1810           AK001658.1         1326-1790
            1811-2113           AK027687.1         1892-2194
            2114-2811           AC127070.10        108422-109119
            2812-3168           BC012072.1         2825-3181
FEATURES             Location/Qualifiers
     source          1..3168
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q24.33"
     gene            1..3168
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="checkpoint with forkhead and ring finger domains"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
     exon            1..72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1361815684"
     variation       4
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1003781663"
     variation       7
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287541768"
     variation       11
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553012411"
     variation       12
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905468008"
     variation       16
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534357480"
     variation       17
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570446374"
     variation       18
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896280970"
     variation       23
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452969814"
     variation       24
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468914426"
     variation       29
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403273314"
     variation       30..41
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gcggcggcggcg"
                     /replace="gcggcggcggcggcg"
                     /db_xref="dbSNP:1462255454"
     variation       30
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052274666"
     variation       32
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1023737356"
     variation       35
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177915172"
     variation       36
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305328622"
     variation       37
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043377910"
     variation       38
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942391667"
     variation       39
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910903529"
     variation       40
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986491943"
     variation       43
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867733545"
     variation       44
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866582582"
     variation       45
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184602056"
     variation       46
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457982394"
     variation       47
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180202481"
     variation       49
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955129324"
     variation       50
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418375663"
     variation       52
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918721775"
     variation       53
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379340094"
     variation       54
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558080896"
     variation       55
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401227842"
     variation       58
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203285887"
     variation       59
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373084089"
     variation       60
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460094658"
     variation       62
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972910573"
     variation       63
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962990830"
     variation       68
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210883392"
     variation       69
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261984726"
     variation       71
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318118652"
     variation       72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307468722"
     exon            73..217
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    76..78
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="upstream in-frame stop codon"
     variation       81..83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1000300479"
     variation       81
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756050840"
     variation       82
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200689283"
     variation       83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745782659"
     CDS             85..1956
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /EC_number="2.3.2.27"
                     /note="isoform 4 is encoded by transcript variant 4; RING
                     finger protein 196; checkpoint with forkhead and ring
                     finger domains, E3 ubiquitin protein ligase; RING-type E3
                     ubiquitin transferase CHFR"
                     /codon_start=1
                     /product="E3 ubiquitin-protein ligase CHFR isoform 4"
                     /protein_id="NP_060693.2"
                     /db_xref="CCDS:CCDS31937.1"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
                     /translation="
MERPEEGKQSPPPQPWGRLLRLGAEEGEPHVLLRKREWTIGRRRGCDLSFPSNKLVSGDHCRIVVDEKSGQVTLEDTSTSGTVINKLKVVKKQTCPLQTGDVIYLVYRKNEPEHNVAYLYESLSEKQGMTQESFEMVPCCVAQAGLKLLGSSDPPTLASQSIVITGSGGGGISPKGSGPSVASDEVSSFASALPDRKTASFSSLEPQDQEDLEPVKKKMRGDGDLDLNGQLLVAQPRRNAQTVHEDVRAAAGKPDKMEETLTCIICQDLLHDCVSLQPCMHTFCAACYSGWMERSSLCPTCRCPVERICKNHILNNLVEAYLIQHPDKSRSEEDVQSMDARNKITQDMLQPKVRRSFSDEEGSSEDLLELSDVDSESSDISQPYVVCRQCPEYRRQAAQPPHCPAPEGEPGAPQALGDAPSTSVSLTTAVQDYVCPLQGSHALCTCCFQPMPDRRAEREQDPRVAPQQCAVCLQPFCHLYWGCTRTGCYGCLAPFCELNLGDKCLDGVLNNNSYESDILKNYLATRGLTWKNMLTESLVALQRGVFLLSDYRVTGDTVLCYCCGLRSFRELTYQYRQNIPASELPVAVTSRPDCYWGRNCRTQVKAHHAMKFNHICEQTRFKN"
     misc_feature    130..399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated domain (FHA); found in
                     eukaryotic and prokaryotic proteins. Putative nuclear
                     signalling domain. FHA domains may bind phosphothreonine,
                     phosphoserine and sometimes phosphotyrosine. In
                     eukaryotes, many FHA domain-containing proteins...;
                     Region: FHA; cd00060"
                     /db_xref="CDD:238017"
     misc_feature    <175..>393
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated (FHA) domain, binds pSer, pThr,
                     pTyr [Signal transduction mechanisms]; Region: FHA;
                     COG1716"
                     /db_xref="CDD:224630"
     misc_feature    order(208..210,247..249,253..258,319..327)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="phosphopeptide binding site; other site"
                     /db_xref="CDD:238017"
     misc_feature    868..999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="RING-finger (Really Interesting New Gene) domain, a
                     specialized type of Zn-finger of 40 to 60 residues that
                     binds two atoms of zinc; defined by the 'cross-brace'
                     motif C-X2-C-X(9-39)-C-X(1-3)-
                     H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
                     in...; Region: RING; cd00162"
                     /db_xref="CDD:238093"
     misc_feature    order(871..873,880..882,919..921,925..927,934..936,
                     943..945,976..978,985..987)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:238093"
     variation       87
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323042743"
     variation       89
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780919643"
     variation       92
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757065782"
     variation       93
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879451433"
     variation       94
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252988651"
     variation       100
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285867152"
     variation       104
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453369842"
     variation       107
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381686714"
     variation       109
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334460653"
     variation       113..124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cgccgccgc"
                     /replace="cgccgccgccgc"
                     /replace="cgccgccgccgccgc"
                     /db_xref="dbSNP:765917829"
     variation       113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752932212"
     variation       115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372093401"
     variation       117
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566211828"
     variation       118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459172597"
     variation       121
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022133046"
     variation       122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407689006"
     variation       123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415407421"
     variation       126
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184750358"
     variation       127
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444571399"
     variation       129
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547086677"
     variation       131..134
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1180924768"
     variation       136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481059648"
     variation       141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327949016"
     variation       142
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250940821"
     variation       146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202757955"
     variation       148
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323574369"
     variation       151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292594475"
     variation       153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246548917"
     variation       156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753867941"
     variation       157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312590714"
     variation       159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448675201"
     variation       161
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373843772"
     variation       165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297235638"
     variation       169
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766461060"
     variation       170
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242357676"
     variation       171
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889736424"
     variation       172
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050716303"
     variation       174
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163686245"
     variation       175
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424534907"
     variation       177
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761126986"
     variation       178
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896897715"
     variation       180
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161017404"
     variation       181
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558346895"
     variation       183
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291046887"
     variation       186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994965729"
     variation       189
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250327307"
     variation       191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037164725"
     variation       192
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175632960"
     variation       198
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489596045"
     variation       201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269637112"
     variation       202
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329871429"
     variation       205
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220935343"
     variation       207
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360131934"
     variation       208
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941122476"
     variation       214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221878184"
     exon            218..317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       219..220
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1566203316"
     variation       221
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762757910"
     variation       222
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775199616"
     variation       223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016169013"
     variation       226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370348872"
     variation       229
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184762410"
     variation       232
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776467669"
     variation       234
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371415158"
     variation       235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765839818"
     variation       236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770855105"
     variation       238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146088609"
     variation       241
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77052806"
     variation       244
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540426488"
     variation       249
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771849929"
     variation       254
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325393287"
     variation       257
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573017098"
     variation       258
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780255609"
     variation       259
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956973617"
     variation       262
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756177652"
     variation       263
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336502857"
     variation       264
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468386635"
     variation       272
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750466757"
     variation       274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781107351"
     variation       275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142824452"
     variation       277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372280960"
     variation       278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752104453"
     variation       283
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190933998"
     variation       291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446377947"
     variation       292
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764607751"
     variation       296
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763356188"
     variation       302
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436266778"
     variation       303
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115711908"
     variation       304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252203966"
     variation       309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390531305"
     variation       314
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196075617"
     variation       315
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764905392"
     variation       317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996565819"
     exon            318..427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405603798"
     variation       321
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200283117"
     variation       330
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138320999"
     variation       333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262248032"
     variation       341
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403538188"
     variation       349..354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gtt"
                     /replace="gttgtt"
                     /db_xref="dbSNP:749471534"
     variation       351
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026698840"
     variation       358
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753427887"
     variation       360
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409273260"
     variation       361
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765931951"
     variation       362
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145622325"
     variation       363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896801495"
     variation       370
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220821081"
     variation       377
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773164146"
     variation       379
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1285340068"
     variation       391
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204882792"
     variation       395
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349041006"
     variation       397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767392115"
     variation       399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761633567"
     variation       400
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774239471"
     variation       405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768330210"
     variation       413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281470229"
     variation       415
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036686943"
     variation       417
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277101257"
     variation       419
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377703818"
     variation       420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771143796"
     variation       424
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201058448"
     variation       425
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778449705"
     variation       427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758996497"
     exon            428..487
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       429
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368692761"
     variation       430
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765096474"
     variation       433
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300704622"
     variation       435
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761045629"
     variation       436
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402185439"
     variation       439
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773555344"
     variation       443
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772208422"
     variation       451
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428337510"
     variation       454
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1387598301"
     variation       462
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164831443"
     variation       466
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202105666"
     variation       467
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769092725"
     variation       469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415955003"
     variation       472
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312795252"
     variation       474
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374502930"
     variation       475
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761297928"
     variation       476
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481092256"
     variation       478
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780460479"
     variation       480
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773617187"
     variation       483
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1443614623"
     exon            488..580
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       491
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331574821"
     variation       493
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349750283"
     variation       496
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180972611"
     variation       497
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9943856"
     variation       500
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771714333"
     variation       501
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747621911"
     variation       503
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159355477"
     variation       505
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139045656"
     variation       506
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225701393"
     variation       512
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770802724"
     variation       514
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113941471"
     variation       516
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200997859"
     variation       518
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478094317"
     variation       525
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238108509"
     variation       526..530
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:1216434365"
     variation       526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749243668"
     variation       530
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004863721"
     variation       532
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249948248"
     variation       533
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449096307"
     variation       534
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890489027"
     variation       539
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536448896"
     variation       542
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912312301"
     variation       544
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386156952"
     variation       547
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208289168"
     variation       551
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327378162"
     variation       554
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161754439"
     variation       555
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052427155"
     variation       556
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265270599"
     variation       558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413566399"
     variation       560
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1224174923"
     variation       565
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344471837"
     variation       566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390162710"
     variation       567
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274177364"
     variation       570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932290965"
     variation       571
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434216915"
     variation       573
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190910189"
     variation       574
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321004658"
     variation       580
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319461623"
     exon            581..748
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       584
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038150337"
     variation       586
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370517411"
     variation       589
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438318944"
     variation       590
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777186106"
     variation       592..593
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1189456093"
     variation       592
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766667278"
     variation       595
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761034338"
     variation       598
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138637226"
     variation       601
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387477118"
     variation       604
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34220055"
     variation       605
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761525824"
     variation       614
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774070010"
     variation       615
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419993206"
     variation       617
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201192149"
     variation       618
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989203291"
     variation       624
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:796201985"
     variation       625
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163339779"
     variation       633
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749192848"
     variation       637
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374107669"
     variation       639
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769505625"
     variation       644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780945230"
     variation       661
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35206714"
     variation       664
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1366834805"
     variation       666
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038008124"
     variation       668
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560433355"
     variation       673
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201727566"
     variation       678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758662673"
     variation       679
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533118486"
     variation       680
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150995074"
     variation       681
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755027328"
     variation       684
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908433616"
     variation       687
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200213031"
     variation       689
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754307363"
     variation       690
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145246258"
     variation       692
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141183005"
     variation       693
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767988129"
     variation       694..695
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:766718829"
     variation       696
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566189184"
     variation       697
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423637297"
     variation       700..703
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:762524769"
     variation       700
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751592981"
     variation       704
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373754363"
     variation       705
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761615752"
     variation       706
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147803776"
     variation       708
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566189143"
     variation       714
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774088595"
     variation       715
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472958431"
     variation       723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768052255"
     variation       725
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762481129"
     variation       726
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025589682"
     variation       727
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775309126"
     variation       729
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764279540"
     variation       731
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463671908"
     variation       733
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974854406"
     variation       736
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1221100387"
     variation       738
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238379063"
     variation       740
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566189061"
     variation       745
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745763828"
     exon            749..908
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       750
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756088633"
     variation       754
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563202190"
     variation       758
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360404336"
     variation       762
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781748631"
     variation       765
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757715316"
     variation       767
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752016583"
     variation       768
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377318460"
     variation       769
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115096950"
     variation       771
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393923793"
     variation       772..773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:776753889"
     variation       773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1311480210"
     variation       774
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758139441"
     variation       775
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973250523"
     variation       777
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021390710"
     variation       781
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752281100"
     variation       783
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115431373"
     variation       784
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148618944"
     variation       786
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369526598"
     variation       789
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769878915"
     variation       790
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540759128"
     variation       791
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760584451"
     variation       792
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773102049"
     variation       793
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749537035"
     variation       794
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375174098"
     variation       796
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770024903"
     variation       802
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188170704"
     variation       803
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745889598"
     variation       805
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781395404"
     variation       807
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757876886"
     variation       810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747517165"
     variation       811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199761208"
     variation       816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380131918"
     variation       817
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144838296"
     variation       819
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449844658"
     variation       821
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000960906"
     variation       822
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371434249"
     variation       823
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764757412"
     variation       824
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:768680290"
     variation       824
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464052810"
     variation       826
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754506935"
     variation       827
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149862277"
     variation       831
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765845584"
     variation       833
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277312621"
     variation       834
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746414469"
     variation       835
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341883561"
     variation       837
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295926976"
     variation       839
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306779303"
     variation       842
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1375950961"
     variation       846
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35011845"
     variation       847
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341253353"
     variation       852
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312306793"
     variation       853
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767348322"
     variation       855
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352413194"
     variation       863
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761474515"
     variation       864
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775799321"
     variation       870
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369689338"
     variation       876
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770185579"
     variation       877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252007101"
     variation       879
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12315353"
     variation       882
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146107503"
     variation       888
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368629651"
     variation       891
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186411942"
     variation       893
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759798633"
     variation       897
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253421391"
     variation       903
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776915637"
     variation       904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771123706"
     variation       906
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469130916"
     exon            909..1063
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       909
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560066373"
     variation       913
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213141444"
     variation       917
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780721649"
     variation       918
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565644778"
     variation       922
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987211916"
     variation       925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566185781"
     variation       926
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174814592"
     variation       927
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478670195"
     variation       929
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751498855"
     variation       930
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142975525"
     variation       933
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466544467"
     variation       936
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138280939"
     variation       937
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754144763"
     variation       938
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921635691"
     variation       939
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766660009"
     variation       940
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760933260"
     variation       941
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221124973"
     variation       947
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368405665"
     variation       948
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767634272"
     variation       950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287710"
     variation       951
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367099211"
     variation       953
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774770261"
     variation       958
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433978124"
     variation       960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553735979"
     variation       961..963
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1566185670"
     variation       962
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968563777"
     variation       964
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749601873"
     variation       965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775805064"
     variation       968
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402056016"
     variation       969
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769371058"
     variation       972
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745529097"
     variation       978
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780623191"
     variation       982
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535313174"
     variation       983
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756736276"
     variation       985
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474574138"
     variation       988
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034782"
     variation       989
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146343801"
     variation       992
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441931198"
     variation       994
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571101753"
     variation       996
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115029653"
     variation       997
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344021759"
     variation       1003
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182092641"
     variation       1004
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756361707"
     variation       1008
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359376881"
     variation       1010
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141404869"
     variation       1013
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767497782"
     variation       1015
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313496770"
     variation       1016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319716667"
     variation       1017
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339366523"
     variation       1023
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375199215"
     variation       1028
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774858017"
     variation       1030
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371529354"
     variation       1031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764629991"
     variation       1033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255988921"
     variation       1035
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191062458"
     variation       1036
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775898959"
     variation       1039
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182669640"
     variation       1042
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213131732"
     variation       1043
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241168194"
     variation       1047
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148311652"
     variation       1050
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143181439"
     variation       1051
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241159400"
     variation       1053
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770380694"
     variation       1057
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746470663"
     variation       1058
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370386571"
     exon            1064..1226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1065
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227736511"
     variation       1066..1067
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:777961507"
     variation       1072
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210874026"
     variation       1074
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928539042"
     variation       1080
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184554"
     variation       1087
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879123151"
     variation       1089
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229649968"
     variation       1091
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777930523"
     variation       1092
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184534"
     variation       1094
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293723698"
     variation       1096
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377225060"
     variation       1100
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748309050"
     variation       1101
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778828908"
     variation       1102
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434082116"
     variation       1103
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200764395"
     variation       1104
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369063253"
     variation       1105
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1026572995"
     variation       1106
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766865645"
     variation       1107
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2062163"
     variation       1115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047280041"
     variation       1116
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750119581"
     variation       1118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760238279"
     variation       1120
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761337268"
     variation       1126
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150467142"
     variation       1134
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763498728"
     variation       1143
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930183182"
     variation       1144
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322357484"
     variation       1145
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762961678"
     variation       1146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879252133"
     variation       1147
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920205326"
     variation       1148
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201828860"
     variation       1151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769607729"
     variation       1152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745615761"
     variation       1155
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776390811"
     variation       1159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974463026"
     variation       1162..1168
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1434190222"
     variation       1169
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772321674"
     variation       1172
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315657949"
     variation       1175
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413044699"
     variation       1179
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353432969"
     variation       1186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309789349"
     variation       1191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748314312"
     variation       1197
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283784330"
     variation       1200
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395585538"
     variation       1201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165776578"
     variation       1211
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779111370"
     variation       1215
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368718436"
     variation       1224
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754958760"
     exon            1227..1369
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1230
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286314037"
     variation       1231
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020597739"
     variation       1233
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748419509"
     variation       1234
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372270460"
     variation       1235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013270057"
     variation       1236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438322046"
     variation       1237
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768814594"
     variation       1238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318363216"
     variation       1239
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749373830"
     variation       1240
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150627547"
     variation       1242
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368755833"
     variation       1246
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435723841"
     variation       1247
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746360566"
     variation       1248
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191956640"
     variation       1254
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451601823"
     variation       1256
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781699438"
     variation       1259
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757496767"
     variation       1263
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192492326"
     variation       1267
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445358565"
     variation       1274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374229656"
     variation       1275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777240371"
     variation       1276
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303770543"
     variation       1277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371541325"
     variation       1278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563852229"
     variation       1282
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231849613"
     variation       1285
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366854652"
     variation       1286
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270421677"
     variation       1287
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429332642"
     variation       1289
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176161885"
     variation       1290
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764723102"
     variation       1300
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1237028076"
     variation       1302
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759529335"
     variation       1303
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753721064"
     variation       1305
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375184437"
     variation       1307
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367968934"
     variation       1308
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374006779"
     variation       1309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774658371"
     variation       1310
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167629443"
     variation       1311
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566181842"
     variation       1312
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924051400"
     variation       1314
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041545091"
     variation       1318
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768798394"
     variation       1320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239336733"
     variation       1335
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189940191"
     variation       1340
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138207644"
     variation       1342
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256747525"
     variation       1344
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379314322"
     variation       1345
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775767314"
     variation       1348
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196421815"
     variation       1349
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769933100"
     variation       1350
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746380972"
     variation       1351
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1215461680"
     variation       1353
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781511228"
     variation       1354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141835819"
     variation       1358
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747380214"
     variation       1361
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778169456"
     variation       1363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355326421"
     variation       1364
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752333209"
     variation       1365
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536396076"
     exon            1370..1489
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1370
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402157616"
     variation       1371
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757077660"
     variation       1374
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146976267"
     variation       1376
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765605647"
     variation       1377
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408464611"
     variation       1383
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141349945"
     variation       1384
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776642806"
     variation       1389
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306934237"
     variation       1390
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764423128"
     variation       1393
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766469365"
     variation       1395
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761102171"
     variation       1400
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304421220"
     variation       1404
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773703522"
     variation       1405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772460210"
     variation       1407
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147791929"
     variation       1408
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1454391193"
     variation       1412
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345653105"
     variation       1413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116286061"
     variation       1416
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768361418"
     variation       1418
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396714833"
     variation       1419..1426
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctgct"
                     /replace="ctgctgct"
                     /db_xref="dbSNP:1363396811"
     variation       1419
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748952886"
     variation       1420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763257394"
     variation       1422
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278317795"
     variation       1430
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779441212"
     variation       1431
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775978433"
     variation       1438
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187706335"
     variation       1440
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781224248"
     variation       1441
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757239007"
     variation       1444
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936864653"
     variation       1445
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969442993"
     variation       1448
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751440176"
     variation       1451
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306541"
     variation       1452
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755310429"
     variation       1453
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298012137"
     variation       1456
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754035414"
     variation       1457
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944300584"
     variation       1458
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766376169"
     variation       1459
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150920425"
     variation       1462
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015010652"
     variation       1463
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617183"
     variation       1469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768065335"
     variation       1470
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142511371"
     variation       1471
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114117795"
     variation       1472
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201454195"
     variation       1473
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172173801"
     variation       1474
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200436687"
     variation       1476
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920038038"
     variation       1477
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746554223"
     variation       1479
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973207321"
     variation       1483
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486915053"
     variation       1485
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346472721"
     variation       1486
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258850426"
     variation       1488
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769207559"
     exon            1490..1573
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1492
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372012714"
     variation       1493
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350082"
     variation       1494
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7975454"
     variation       1497
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375656978"
     variation       1503
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335016856"
     variation       1505
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201237898"
     variation       1506
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442703181"
     variation       1507
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765505226"
     variation       1508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324580295"
     variation       1517
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403110794"
     variation       1524
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759242088"
     variation       1529
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953787024"
     variation       1533
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546055046"
     variation       1535
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766020195"
     variation       1537
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371092913"
     variation       1538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146156998"
     variation       1539
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454840670"
     variation       1540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979112170"
     variation       1541
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252629926"
     variation       1542
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772089817"
     variation       1543
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448818469"
     variation       1548
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249069969"
     variation       1550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767140702"
     variation       1551
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765611625"
     variation       1552
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349644861"
     variation       1557
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189987561"
     variation       1558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236250946"
     variation       1560
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966632867"
     variation       1564
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348083185"
     variation       1565
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302248351"
     variation       1566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433674477"
     variation       1569
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327743680"
     exon            1574..1644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1575
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777921940"
     variation       1581
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200853567"
     variation       1584
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748721756"
     variation       1585
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179840200"
     variation       1590
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471040037"
     variation       1593
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415191475"
     variation       1595
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233090445"
     variation       1602
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372404283"
     variation       1603
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755522022"
     variation       1604
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754297675"
     variation       1605
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323808548"
     variation       1614
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213796881"
     variation       1615
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780565079"
     variation       1616
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288355908"
     variation       1619
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225827826"
     variation       1620
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755891788"
     variation       1622
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288380542"
     variation       1626
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749973618"
     variation       1628
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379904886"
     variation       1629
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767082498"
     variation       1635
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416698488"
     variation       1639
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761176081"
     variation       1644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326600805"
     exon            1645..1732
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1646
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432073088"
     variation       1650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422500887"
     variation       1651
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899072283"
     variation       1652
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008556440"
     variation       1657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776466473"
     variation       1661
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576074865"
     variation       1666
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306537"
     variation       1671
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536151635"
     variation       1672
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281285798"
     variation       1673
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378971375"
     variation       1675..1679
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1224656808"
     variation       1679
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232869629"
     variation       1681
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200187965"
     variation       1689
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749821203"
     variation       1690
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780655269"
     variation       1696
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770399858"
     variation       1698
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899313894"
     variation       1699
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2306536"
     variation       1702
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485801990"
     variation       1703
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781614371"
     variation       1704
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756917083"
     variation       1709
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313082363"
     variation       1710
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465200907"
     variation       1711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357095646"
     variation       1712
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558156375"
     variation       1719
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363290036"
     variation       1723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1428595949"
     variation       1730
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423530802"
     exon            1733..1840
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1733
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265969471"
     variation       1745
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115684143"
     variation       1746
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222086097"
     variation       1755
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115566777"
     variation       1756
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758025460"
     variation       1758
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976650599"
     variation       1759
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747697880"
     variation       1760
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566173893"
     variation       1766
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356919481"
     variation       1768
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778392987"
     variation       1769
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754931883"
     variation       1770
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442480016"
     variation       1779
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937547511"
     variation       1780
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961309862"
     variation       1781
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557461509"
     variation       1782
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456695524"
     variation       1784
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766096241"
     variation       1789
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376798546"
     variation       1795
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439266364"
     variation       1799
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764448295"
     variation       1801
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220708351"
     variation       1803
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195509679"
     variation       1805
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114483951"
     variation       1810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775769340"
     variation       1811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144644143"
     variation       1830
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373411620"
     variation       1831
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777155485"
     variation       1837
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76224039"
     exon            1841..1913
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1845
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772354359"
     variation       1846
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761464761"
     variation       1847
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1476434657"
     variation       1849
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425682767"
     variation       1854
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194364986"
     variation       1860
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774002945"
     variation       1863
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260717996"
     variation       1864
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212784968"
     variation       1869
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768078789"
     variation       1876
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192495200"
     variation       1877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779420556"
     variation       1883..1887
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gc"
                     /replace="gccgc"
                     /db_xref="dbSNP:1218603125"
     variation       1885
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769922499"
     variation       1886
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745735958"
     variation       1889
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339131647"
     variation       1892
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188833829"
     variation       1894
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295444518"
     variation       1896
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449229353"
     variation       1902
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340024053"
     variation       1908
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146332668"
     variation       1909
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371841032"
     variation       1911
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401175113"
     variation       1912
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752894210"
     variation       1913
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779235326"
     exon            1914..3158
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1920
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456116703"
     variation       1922
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549826875"
     variation       1925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223009144"
     variation       1926
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772496941"
     variation       1939
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288110354"
     variation       1940
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190631767"
     variation       1944
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200441646"
     variation       1957
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242787279"
     variation       1964
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776670620"
     variation       1965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770961851"
     variation       1967
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566171705"
     variation       1968
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238046110"
     variation       1971
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746869999"
     variation       1972
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777416500"
     variation       1973
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755292850"
     variation       1974
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973123804"
     variation       1976
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375664747"
     variation       1979..1981
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1566171684"
     variation       1982
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780118329"
     variation       1986
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293032557"
     variation       1987
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756135373"
     variation       1993
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750955936"
     variation       1994
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157735470"
     variation       1995
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531300162"
     variation       1998
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757695645"
     variation       1999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113800546"
     variation       2002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752032125"
     variation       2003
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549782692"
     variation       2004
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762683133"
     variation       2021
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314603974"
     variation       2025
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353651008"
     variation       2026
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1286369531"
     variation       2027
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045979"
     variation       2030
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954494653"
     variation       2031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749186808"
     variation       2033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283042988"
     variation       2036
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237120100"
     variation       2037
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348995249"
     variation       2042
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030178377"
     variation       2054
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925838751"
     variation       2057
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361292300"
     variation       2063
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974644686"
     variation       2066
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567430632"
     variation       2067
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341331550"
     variation       2071
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911586191"
     variation       2074
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:542153503"
     variation       2077
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156419163"
     variation       2078
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435059615"
     variation       2081
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370209943"
     variation       2083
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950536054"
     variation       2088
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559705268"
     variation       2090
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010901456"
     variation       2094
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298882440"
     variation       2096
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893810615"
     variation       2102
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963549804"
     variation       2111..2113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:3832804"
     variation       2115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111820152"
     variation       2116
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052601435"
     variation       2118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414983132"
     variation       2124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935595520"
     variation       2129..2131
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1418783722"
     variation       2135
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002477975"
     variation       2142
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278595598"
     variation       2144
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347878070"
     variation       2145
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541179525"
     variation       2149
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576945941"
     variation       2151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769326943"
     variation       2152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892514179"
     variation       2153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054288089"
     variation       2158
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367620504"
     variation       2159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916367947"
     variation       2162
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973064787"
     variation       2168
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038910312"
     variation       2169
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:963001005"
     variation       2170..2171
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ga"
                     /db_xref="dbSNP:796574941"
     variation       2171
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943323229"
     variation       2184
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370314942"
     variation       2187
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182916402"
     variation       2188
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3741490"
     variation       2193
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443374356"
     variation       2199
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983339952"
     variation       2204
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301770978"
     variation       2210
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987116079"
     variation       2213
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554895850"
     variation       2225
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298316988"
     variation       2230
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75237791"
     variation       2231
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746850522"
     variation       2233
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353265460"
     variation       2234
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777597930"
     variation       2235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973165920"
     variation       2239
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758214417"
     variation       2240
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996057076"
     variation       2242
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192844482"
     variation       2243..2247
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1423726431"
     variation       2243
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547619077"
     variation       2251
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010952147"
     variation       2252
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002451487"
     variation       2258
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893777773"
     variation       2262
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030977492"
     variation       2264
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163686844"
     variation       2276
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781543889"
     variation       2277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906815915"
     variation       2281
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415593537"
     variation       2283
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046993159"
     variation       2293
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334852400"
     variation       2294
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3741489"
     variation       2304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270832087"
     variation       2305
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450666893"
     variation       2307
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4758909"
     variation       2315
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201112509"
     variation       2318
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192780707"
     variation       2329
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258321216"
     variation       2333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112870346"
     variation       2338
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476204979"
     variation       2339
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163079471"
     variation       2344
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754605513"
     variation       2345
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549889950"
     variation       2348
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458219528"
     variation       2355
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413405596"
     variation       2363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037421988"
     variation       2365..2367
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1272645289"
     variation       2369
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053774837"
     variation       2374
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401470577"
     variation       2379
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231595234"
     variation       2382
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161815482"
     variation       2388
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343788492"
     variation       2390
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941773272"
     variation       2391
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907515157"
     variation       2392
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142376269"
     variation       2397..2398
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:36039891"
     variation       2408
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933225060"
     variation       2418
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355291257"
     variation       2420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223981564"
     variation       2430
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923251377"
     variation       2434
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755120503"
     variation       2438
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566171220"
     variation       2442
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964542689"
     variation       2446
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021425081"
     variation       2459..2466
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctt"
                     /replace="cttatctt"
                     /db_xref="dbSNP:943198387"
     variation       2464
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989498094"
     variation       2469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215845332"
     variation       2481
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258077252"
     variation       2487
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296311836"
     variation       2493
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958138392"
     variation       2506..2521
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tataattta"
                     /replace="tataatttataattta"
                     /db_xref="dbSNP:1401013436"
     variation       2506
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486597998"
     variation       2518
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030946220"
     variation       2526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236969685"
     variation       2531
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911779056"
     variation       2534
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1179105860"
     variation       2538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406240647"
     variation       2540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560709767"
     variation       2545
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999568389"
     variation       2549
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548922117"
     variation       2550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377843900"
     variation       2556
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025188661"
     variation       2565
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331697816"
     variation       2566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973134921"
     variation       2567
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012923039"
     variation       2570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895287582"
     variation       2575..2576
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34409499"
     variation       2576
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165063779"
     variation       2585..2591
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1350044921"
     variation       2585
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374414628"
     variation       2586
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926776920"
     variation       2591
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1280739400"
     variation       2596
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:530330334"
     variation       2597
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971314022"
     variation       2603
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438398757"
     variation       2620
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206923715"
     variation       2621
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231446323"
     variation       2622
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406251214"
     variation       2624
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941743070"
     variation       2627
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115799873"
     variation       2628
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541241838"
     variation       2643
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047424647"
     variation       2645
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932962176"
     variation       2646
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753996875"
     variation       2647
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211863620"
     variation       2650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397721159"
     variation       2651
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489535422"
     variation       2653
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1215337863"
     variation       2653
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266210457"
     variation       2658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316055975"
     variation       2659..2660
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgct"
                     /db_xref="dbSNP:1441439409"
     variation       2659
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575351"
     variation       2660..2661
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="ctcccttct"
                     /db_xref="dbSNP:1336309071"
     variation       2661
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gacatgctgctcccttgtgtgagtgaccacggccccgagcctggggct
                     ggacgcaggtcccaggacgtgctgctcccttctg"
                     /db_xref="dbSNP:1566171025"
     variation       2662
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974656529"
     variation       2663
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304579464"
     variation       2670
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577007021"
     variation       2671
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60054929"
     variation       2672..2711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatg"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatgttgctccc
                     ttgtgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggacgtgctg
                     ctcccttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggaca
                     tg"
                     /db_xref="dbSNP:1566170943"
     variation       2672..2708
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggac"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacgtgctgctccc
                     ttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggac"
                     /db_xref="dbSNP:1566170955"
     variation       2672
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137860747"
     variation       2673
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543507917"
     variation       2674
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339972650"
     variation       2678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576425597"
     variation       2679
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978587251"
     variation       2682
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970720837"
     variation       2691
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000902244"
     variation       2694
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025409954"
     variation       2695
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012477120"
     variation       2702
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452627569"
     variation       2705
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899887350"
     variation       2709
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373137192"
     variation       2712
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554677515"
     variation       2715
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377537751"
     variation       2719
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420814830"
     variation       2722
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:796139459"
     variation       2723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006432643"
     variation       2732
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396446600"
     variation       2733..2734
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgctgctcc
                     cttctgtgagt"
                     /db_xref="dbSNP:1566170899"
     variation       2733
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384812230"
     variation       2734..2735
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1566170888"
     variation       2734
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:15638"
     variation       2735
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111799372"
     variation       2736
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572274927"
     variation       2739
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997687935"
     variation       2741
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376925671"
     variation       2742
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039131607"
     variation       2747..2797
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="tggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtga
                     cca"
                     /db_xref="dbSNP:1566170810"
     variation       2747
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373528706"
     variation       2752
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354479573"
     variation       2753
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1192334475"
     variation       2757
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369891917"
     variation       2762
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867795922"
     variation       2769
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187667016"
     variation       2771
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186063298"
     variation       2772
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111786421"
     variation       2780
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485012640"
     variation       2784
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054216011"
     variation       2785
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75167846"
     variation       2797
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456063340"
     variation       2798
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538873969"
     variation       2799
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117246365"
     variation       2800..2812
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gccccaagcccag"
                     /db_xref="dbSNP:1230976787"
     variation       2800
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566170789"
     variation       2803
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007364269"
     variation       2804
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218487646"
     variation       2805
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111338463"
     variation       2810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978174785"
     variation       2811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8021"
     variation       2813
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917908364"
     variation       2820
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332266605"
     variation       2821
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890301777"
     variation       2822
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301350623"
     variation       2832
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051667411"
     variation       2834
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991258229"
     variation       2835
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959608059"
     variation       2836
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016485269"
     variation       2837
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006486333"
     variation       2839
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73489148"
     variation       2844
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364197764"
     variation       2845
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455110594"
     variation       2853
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026915435"
     variation       2855
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359866417"
     variation       2856
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566170710"
     variation       2857
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172254217"
     variation       2858
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1468017193"
     variation       2860
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376990440"
     variation       2866
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997254637"
     variation       2869
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395673079"
     variation       2870
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378783852"
     variation       2879
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941680964"
     variation       2882
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535014873"
     variation       2898
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238486499"
     variation       2905
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038687461"
     variation       2906
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007221366"
     variation       2907
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182104463"
     variation       2910
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980532486"
     variation       2911
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349314061"
     variation       2915
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213577280"
     variation       2921
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436173408"
     variation       2924
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764304023"
     variation       2932
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566065778"
     variation       2936
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481966746"
     variation       2950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199546557"
     variation       2954
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892808322"
     variation       2958
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949556782"
     variation       2960..2961
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1176616028"
     variation       2962..2969
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:rs957212862"
     variation       2962
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265543823"
     variation       2963
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054268966"
     variation       2964
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934594162"
     variation       2965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488453973"
     variation       2970
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191072646"
     variation       2971..2976
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1566170618"
     variation       2973
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256563011"
     variation       2977
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566122046"
     variation       2980
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949484292"
     variation       2995
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018288530"
     variation       3002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299758456"
     variation       3003
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549120489"
     variation       3016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918030300"
     variation       3018
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565128269"
     variation       3022
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458856890"
     variation       3030..3037
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:1468716986"
     variation       3031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937960418"
     variation       3032
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909224402"
     variation       3033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226033314"
     variation       3036
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046106"
     variation       3043
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315555821"
     variation       3045
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279655347"
     variation       3047
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985017981"
     variation       3056
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432491382"
     variation       3059
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753726528"
     variation       3069
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425798710"
     variation       3077
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529547282"
     variation       3080
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148270257"
     variation       3082
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11542904"
     variation       3095
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976689419"
     variation       3103
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819930"
     variation       3113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:897708347"
     variation       3113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367604138"
     variation       3116
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037632913"
     variation       3131
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941651179"
     variation       3132
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046130"
     regulatory      3134..3139
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
     variation       3140
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904877930"
     variation       3141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017734390"
     variation       3145
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376262240"
     variation       3146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007273719"
     variation       3147
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892777244"
     variation       3148
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561407931"
     variation       3152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244757352"
     variation       3154
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298125618"
     variation       3155
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998710936"
     polyA_site      3158
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
ORIGIN      
agctgagggagccgcaatgtctcttgacagcggcggcggcgcagccggttccgggttcggcgcggggcggggatgtgaatcccgatggagcggcccgaggaaggcaagcagtcgccgccgccgcagccctggggacggctcctgcgtctgggcgcggaggagggcgagccgcacgtcctcctgaggaagcgggagtggaccatcgggcggagacgaggttgcgacctttccttccccagcaataaactggtctctggagatcactgtagaattgtagtggatgaaaaatcaggtcaggtgacactggaagataccagcaccagtggaacagtgattaacaagctgaaggttgttaagaagcagacatgccctttacagactggggatgtcatctacttggtgtacaggaagaatgaaccggaacacaacgtggcatacctctatgaatctttaagtgaaaagcaaggcatgacacaagaatcctttgagatggtgccttgctgtgttgcccaggctggtctaaaactcctgggatcaagtgatcctcccaccttggcctcccaaagtattgtgattacagggtctgggggtggtggcatctcccctaaaggaagtggtccctctgtggcaagtgatgaagtctccagctttgcctcagctctcccagacagaaagactgcgtccttttcgtcgttggaaccccaggatcaggaggatttggagcccgtgaagaagaaaatgagaggagatggggaccttgacctgaacgggcagttgttggtcgcacaaccgcgtagaaatgcccaaaccgtccacgaggacgtcagagcagcggctgggaagccagacaagatggaggagacgctgacatgcatcatctgccaggacctgctgcacgactgcgtgagtttgcagccctgcatgcacacgttctgcgcggcttgctactcgggctggatggagcgctcgtccctgtgtcctacctgccgctgtcccgtggagcggatctgtaaaaaccacatcctcaacaacctcgtggaagcatacctcatccagcatccagacaagagtcgcagtgaagaagatgtgcaaagtatggatgccaggaataaaatcactcaagacatgctgcagcccaaagtcaggcggtctttttctgatgaagaagggagttcagaggacctgctggagctgtcagacgttgacagtgagtcctcagacattagccagccatacgtcgtgtgccggcagtgtcctgagtacagaaggcaggcggcgcagcctccccactgcccagcacccgagggcgagccaggagccccacaggccctgggggatgcaccctccacgtccgtcagcctgacgacagcagtccaggattacgtgtgccctctgcaaggaagccacgccctgtgcacctgctgcttccagcccatgcccgaccggagagcggagcgcgagcaggacccgcgtgtcgcccctcagcagtgtgcggtctgcctgcagcctttctgccacctgtactggggctgcacccggaccggctgctacggctgcctggccccgttttgtgagctcaacctgggtgacaagtgtctggacggcgtgctgaacaacaacagctacgagtcagacatcctgaagaattacctggcaaccagaggtttgacatggaaaaacatgttgaccgagagcctcgtggctctccagcggggagtgtttctgctgtctgattacagagtcacgggagacaccgttctgtgttactgctgtggcctgcgcagcttccgtgagctgacctatcagtatcggcagaacattcctgcttccgagttgccagtggccgtaacatcccgtcctgactgctactggggccgtaactgccgcactcaggtgaaagctcaccacgccatgaaattcaatcatatctgtgaacagacaaggttcaaaaactaagcatccagaggccctgagcagctttcagcactggaggtgaagagagcgtgtttttaaaatacagagacaagcacgtcaaggtgttttcacagccccctgagggaagggacgcagggtctccgacaggtgctctggggtgactcttctgtggagctttaccctctgagtgagaccctccccagagccccgggggccgcagcccgccctcctggtgagcgctgggcagggctcgtggtggcatcagcagcagagacgaagcctttctgtaacatgcggccgtcccgccgagaggggcagttttgctcttttgtacattttccgaaactacagttaaagcagaagtctgtttttaggaaaagtttcaagggagaagggcaagtttatcaaaaacattgtttcaggagaagggagcataagtttacagcctacaggacgtacacaatatcctgctgctgggaaaaccacagcattttatctattttttattttaataggtttggtgcttatcttctaataagatttaaatgtcacaaactgtagcacaaataatataatttataatttacaaattgactaaaattgggtatagtatggtatttgaaagaataagcatatgcttctgtttattaaaaaaagaaaccttccaatgtccaaaactgctaaccctcgacgtggccgccaagttagtcgctccttgctaaccggtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacatgctgctcccttgtgtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtgaccacggccccaagcccagggctggaggcaggtcccaggacgcgccgctccctcatgctgcccgggcccttcctccaagaccctacagagcctgaggggcaccttggcttccgcctgtgctagctttgccatgtcatctggaataatacttgaaattttgatttttggaaaaaaaagttttttatcttttgttgaaatcacctgttatccttgtttgtaaactgataacttttttgcttcttctcaggaatacagttttcaactgttgtcttgctcttgatagaaactgagaagcagcaatctgtatttgtggaggaaagtcctctcttttgcatattctaataaatgagccgcgtttgctcctcaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]