GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:26:11, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_018003               6904 bp    mRNA    linear   PRI 27-SEP-2019
DEFINITION  Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin
            repeats (UACA), transcript variant 1, mRNA.
ACCESSION   NM_018003
VERSION     NM_018003.4
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6904)
  AUTHORS   Sun B, Zhang Z, Dong C, Zhang Y, Yan C and Li S.
  CONSRTM   Medscape
  TITLE     (99)Tc(m)-octreotide scintigraphy and serum eye muscle antibodies
            in evaluation of active thyroid-associated ophthalmopathy
  JOURNAL   Eye (Lond) 31 (5), 668-676 (2017)
   PUBMED   28387769
REFERENCE   2  (bases 1 to 6904)
  AUTHORS   Lim S, Hwang S, Yu JH, Lim JW and Kim H.
  TITLE     Lycopene inhibits regulator of calcineurin 1-mediated apoptosis by
            reducing oxidative stress and down-regulating Nucling in neuronal
            cells
  JOURNAL   Mol Nutr Food Res 61 (5) (2017)
   PUBMED   27928873
  REMARK    GeneRIF: Lycopene inhibits RCAN1-mediated apoptosis by reducing ROS
            levels and by inhibiting NF-kappaB activation, Nucling induction,
            and the increase in apoptotic indices in neuronal cells.
REFERENCE   3  (bases 1 to 6904)
  AUTHORS   Dang HV, Sakai T, Pham TA, Tran DH, Yorita K, Shishido Y and Fukui
            K.
  TITLE     Nucling, a novel apoptosis-associated protein, controls mammary
            gland involution by regulating NF-kappaB and STAT3
  JOURNAL   J. Biol. Chem. 290 (40), 24626-24635 (2015)
   PUBMED   26269594
REFERENCE   4  (bases 1 to 6904)
  AUTHORS   Jung JY, Lee SR, Kim S, Chi SW, Bae KH, Park BC, Kim JH and Park
            SG.
  TITLE     Identification of novel binding partners for caspase-6 using a
            proteomic approach
  JOURNAL   J. Microbiol. Biotechnol. 24 (5), 714-718 (2014)
   PUBMED   24572280
REFERENCE   5  (bases 1 to 6904)
  AUTHORS   Gylfe AE, Katainen R, Kondelin J, Tanskanen T, Cajuso T, Hanninen
            U, Taipale J, Taipale M, Renkonen-Sinisalo L, Jarvinen H, Mecklin
            JP, Kilpivaara O, Pitkanen E, Vahteristo P, Tuupanen S, Karhu A and
            Aaltonen LA.
  TITLE     Eleven candidate susceptibility genes for common familial
            colorectal cancer
  JOURNAL   PLoS Genet. 9 (10), e1003876 (2013)
   PUBMED   24146633
REFERENCE   6  (bases 1 to 6904)
  AUTHORS   Cockman ME, Lancaster DE, Stolze IP, Hewitson KS, McDonough MA,
            Coleman ML, Coles CH, Yu X, Hay RT, Ley SC, Pugh CW, Oldham NJ,
            Masson N, Schofield CJ and Ratcliffe PJ.
  TITLE     Posttranslational hydroxylation of ankyrin repeats in IkappaB
            proteins by the hypoxia-inducible factor (HIF) asparaginyl
            hydroxylase, factor inhibiting HIF (FIH)
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 103 (40), 14767-14772 (2006)
   PUBMED   17003112
REFERENCE   7  (bases 1 to 6904)
  AUTHORS   Sakai T, Liu L, Teng X, Mukai-Sakai R, Shimada H, Kaji R, Mitani T,
            Matsumoto M, Toida K, Ishimura K, Shishido Y, Mak TW and Fukui K.
  TITLE     Nucling recruits Apaf-1/pro-caspase-9 complex for the induction of
            stress-induced apoptosis
  JOURNAL   J. Biol. Chem. 279 (39), 41131-41140 (2004)
   PUBMED   15271982
REFERENCE   8  (bases 1 to 6904)
  AUTHORS   Ohkura T, Taniguchi S, Yamada K, Nishio N, Okamura T, Yoshida A,
            Kamijou K, Fukata S, Kuma K, Inoue Y, Hisatome I, Senju S,
            Nishimura Y and Shigemasa C.
  TITLE     Detection of the novel autoantibody (anti-UACA antibody) in
            patients with Graves' disease
  JOURNAL   Biochem. Biophys. Res. Commun. 321 (2), 432-440 (2004)
   PUBMED   15358194
  REMARK    GeneRIF: UACA is a novel candidate for eye muscle autoantigens in
            thyroid-associated ophthalmopathy
REFERENCE   9  (bases 1 to 6904)
  AUTHORS   Beausoleil SA, Jedrychowski M, Schwartz D, Elias JE, Villen J, Li
            J, Cohn MA, Cantley LC and Gygi SP.
  TITLE     Large-scale characterization of HeLa cell nuclear phosphoproteins
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (33), 12130-12135 (2004)
   PUBMED   15302935
REFERENCE   10 (bases 1 to 6904)
  AUTHORS   Yamada K, Senju S, Nakatsura T, Murata Y, Ishihara M, Nakamura S,
            Ohno S, Negi A and Nishimura Y.
  TITLE     Identification of a novel autoantigen UACA in patients with
            panuveitis
  JOURNAL   Biochem. Biophys. Res. Commun. 280 (4), 1169-1176 (2001)
   PUBMED   11162650
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA517503.1, AF322916.1,
            AB046781.2, BM693348.1, AC087699.11 and BU736944.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 23, 2018 this sequence version replaced NM_018003.3.
            
            Summary: This gene encodes a protein that contains ankyrin repeats
            and coiled coil domains and likely plays a role in apoptosis.
            Studies in rodents have implicated the encoded protein in the
            stimulation of apoptosis and the regulation of mammary gland
            involution, in which the mammary gland returns to its pre-pregnant
            state. This protein has also been proposed to negatively regulate
            apoptosis based on experiments in human cell lines in which the
            protein was shown to interact with PRKC apoptosis WT1 regulator
            protein, also known as PAR-4, and inhibit translocation of the
            PAR-4 receptor. Autoantibodies to this protein have been identified
            in human patients with panuveitis and Graves' disease. Differential
            expression of this gene has been observed in various human cancers.
            [provided by RefSeq, May 2017].
            
            Transcript Variant: This variant (1) represents the shorter
            transcript but encodes the longer isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803612.39834.1,
                                           SRR1803613.43279.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000322954.11/ ENSP00000314556.6
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-102               DA517503.1         36-137
            103-567             AF322916.1         1-465
            568-3105            AB046781.2         417-2954
            3106-3381           BM693348.1         212-487
            3382-4524           AB046781.2         3231-4373
            4525-6341           AC087699.11        115182-116998       c
            6342-6904           BU736944.1         17-579              c
FEATURES             Location/Qualifiers
     source          1..6904
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q23"
     gene            1..6904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
     exon            1..229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455626313"
     variation       4
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176812424"
     variation       5
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379769597"
     variation       6
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160737816"
     variation       7
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903561736"
     variation       8
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911588767"
     variation       10
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1352070146"
     variation       10
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977984415"
     variation       12
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445262091"
     variation       13
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490042529"
     variation       14
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966593060"
     variation       15
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375540754"
     variation       17
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564097233"
     variation       21
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223238458"
     variation       22
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989292566"
     variation       23
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290368193"
     variation       25
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321955482"
     variation       29
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959469367"
     variation       32
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040293783"
     variation       34
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196687526"
     variation       35
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944595326"
     variation       36
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912580461"
     variation       37..46
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="caggtggggc"
                     /db_xref="dbSNP:1464472398"
     variation       37
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184209544"
     variation       38
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4777306"
     variation       40
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164163307"
     variation       44
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1393339482"
     variation       49
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003614850"
     variation       50
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568224623"
     variation       52
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970685970"
     variation       53
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527570404"
     variation       55
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331016285"
     variation       56
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954161734"
     variation       57
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920038006"
     variation       58
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404315138"
     variation       61
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284511156"
     variation       62
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561970145"
     variation       63
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015756595"
     variation       64
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1013858733"
     variation       65
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004184191"
     variation       66
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1254200977"
     variation       67
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:888673453"
     variation       70
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049124507"
     variation       71
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541997216"
     variation       72
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420460507"
     variation       74
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002244957"
     variation       75
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903512294"
     variation       76..86
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="ccgctgccgtc"
                     /db_xref="dbSNP:1254271425"
     variation       76
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455947274"
     variation       77
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370099766"
     variation       79
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1160535789"
     variation       81
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480398294"
     variation       82
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900033891"
     variation       83
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038789967"
     variation       84
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944461690"
     variation       86
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229531038"
     variation       87
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344478226"
     variation       88
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911662258"
     variation       89
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259925145"
     variation       99
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556658984"
     variation       104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375108880"
     variation       110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193335600"
     variation       112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:944626576"
     variation       113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288791615"
     variation       115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910424757"
     variation       122
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945044019"
     variation       125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546262876"
     variation       127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915121268"
     variation       130
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050356965"
     variation       133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577294525"
     variation       135
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371955622"
     variation       141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919920009"
     variation       143
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974182547"
     variation       151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959225338"
     CDS             152..4402
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="isoform 1 is encoded by transcript variant 1;
                     nuclear membrane binding protein"
                     /codon_start=1
                     /product="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats isoform 1"
                     /protein_id="NP_060473.2"
                     /db_xref="CCDS:CCDS10235.1"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
                     /translation="
MKSLKSRLRRQDVPGPASSGAAAASAHAADWNKYDDRLMKAAERGDVEKVTSILAKKGVNPGKLDVEGRSVFHVVTSKGNLECLNAILIHGVDITTSDTAGRNALHLAAKYGHALCLQKLLQYNCPTEHADLQGRTALHDAAMADCPSSIQLLCDHGASVNAKDVDGRTPLVLATQMSRPTICQLLIDRGADVNSRDKQNRTALMLGCEYGCRDAVEVLIKNGADISLLDALGHDSSYYARIGDNLDILTLLKTASENTNKGRELWKKGPSLQQRNLTHMQDEVNVKSHQREHQNIQDLEIENEDLKERLRKIQQEQRILLDKVNGLQLQLNEEVMVADDLESEREKLKSLLAAKEKQHEESLRTIEALKNRFKYFESDHLGSGSHFSNRKEDMLLKQGQMYMADSQCTSPGIPAHMQSRSMLRPLELSLPSQTSYSENEILKKELEAMRTFCESAKQDRLKLQNELAHKVAECKALALECERVKEDSDEQIKQLEDALKDVQKRMYESEGKVKQMQTHFLALKEHLTSEAASGNHRLTEELKDQLKDLKVKYEGASAEVGKLRNQIKQNEMIVEEFKRDEGKLIEENKRLQKELSMCEMEREKKGRKVTEMEGQAKELSAKLALSIPAEKFENMKSSLSNEVNEKAKKLVEMEREHEKSLSEIRQLKRELENVKAKLAQHVKPEEHEQVKSRLEQKSGELGKKITELTLKNQTLQKEIEKVYLDNKLLKEQAHNLTIEMKNHYVPLKVSEDMKKSHDAIIDDLNRKLLDVTQKYTEKKLEMEKLLLENDSLSKDVSRLETVFVPPEKHEKEIIALKSNIVELKKQLSELKKKCGEDQEKIHALTSENTNLKKMMSNQYVPVKTHEEVKMTLNDTLAKTNRELLDVKKKFEDINQEFVKIKDKNEILKRNLENTQNQIKAEYISLAEHEAKMSSLSQSMRKVQDSNAEILANYRKGQEEIVTLHAEIKAQKKELDTIQECIKVKYAPIVSFEECERKFKATEKELKDQLSEQTQKYSVSEEEVKKNKQENDKLKKEIFTLQKDLRDKTVLIEKSHEMERALSRKTDELNKQLKDLSQKYTEVKNVKEKLVEENAKQTSEILAVQNLLQKQHVPLEQVEALKKSLNGTIENLKEELKSMQRCYEKEQQTVTKLHQLLENQKNSSVPLAEHLQIKEAFEKEVGIIKASLREKEEESQNKMEEVSKLQSEVQNTKQALKKLETREVVDLSKYKATKSDLETQISSLNEKLANLNRKYEEVCEEVLHAKKKEISAKDEKELLHFSIEQEIKDQKERCDKSLTTITELQRRIQESAKQIEAKDNKITELLNDVERLKQALNGLSQLTYTSGNPTKRQSQLIDTLQHQVKSLEQQLADADRQHQEVIAIYRTHLLSAAQGHMDEDVQEALLQIIQMRQGLVC"
     misc_feature    152..154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylmethionine. {ECO:0000244|PubMed:22814378};
                     propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     acetylation site"
     misc_feature    263..610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ankyrin repeats; ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:238125"
     misc_feature    263..526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:289560"
     misc_feature    263..349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 1"
     misc_feature    263..346
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    350..445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    350..439
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 2"
     misc_feature    443..811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ankyrin repeats; ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:238125"
     misc_feature    449..538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 3"
     misc_feature    452..544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    464..742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:289560"
     misc_feature    548..637
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 4"
     misc_feature    551..643
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    order(554..556,566..571,578..586,590..595,605..607,
                     614..616,641..643,647..649,653..655,665..670,677..685,
                     689..694,704..706,713..715,740..742,746..748,752..754,
                     764..769,776..784,788..793,803..805,812..814,839..841)
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    647..742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    647..736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 5"
     misc_feature    746..841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    746..835
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BZF9.2);
                     Region: ANK 6"
     misc_feature    749..907
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:290365"
     misc_feature    2039..4057
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="helix-rich Mycoplasma protein; Region:
                     Mplasa_alph_rch; TIGR04523"
                     /db_xref="CDD:275316"
     variation       153
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272387173"
     variation       165
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961425458"
     variation       169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375166439"
     variation       170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375183158"
     variation       171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311491785"
     variation       178
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374583908"
     variation       182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756531313"
     variation       183
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1359446456"
     variation       187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992289640"
     variation       188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:960996972"
     variation       190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981930654"
     variation       191..193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:35004869"
     variation       191
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:533979976"
     variation       192
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970759603"
     variation       194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169313067"
     variation       199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163006221"
     variation       201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371723255"
     variation       208
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568697926"
     variation       209..215
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ggcgccg"
                     /replace="ggcgccggcgccg"
                     /db_xref="dbSNP:1487092185"
     variation       209..212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ggcg"
                     /replace="ggcggcg"
                     /db_xref="dbSNP:968144106"
     variation       210
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194245446"
     variation       211..223
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cgccgccgcc"
                     /replace="cgccgccgccgcc"
                     /replace="cgccgccgccgccgcc"
                     /db_xref="dbSNP:1157740758"
     variation       211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004131889"
     variation       213
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474868181"
     variation       216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438321063"
     variation       217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867498847"
     variation       218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554846539"
     variation       220
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773521027"
     variation       221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437376460"
     variation       224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345563271"
     variation       225
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194651739"
     variation       227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455194293"
     exon            230..363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414726662"
     variation       237
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764388081"
     variation       239
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190479083"
     variation       242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753147635"
     variation       247
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396214654"
     variation       248..250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1199799532"
     variation       252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765854482"
     variation       256
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762535864"
     variation       257
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772919419"
     variation       259
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322713585"
     variation       260
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292585112"
     variation       261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760320320"
     variation       262
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764948976"
     variation       263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145243489"
     variation       264..269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tga"
                     /replace="tgatga"
                     /db_xref="dbSNP:1386137188"
     variation       267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200107284"
     variation       268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772580072"
     variation       271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349844862"
     variation       273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388399048"
     variation       277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144251833"
     variation       282..287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1566981928"
     variation       282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458175472"
     variation       283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886332937"
     variation       284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746900667"
     variation       286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304983"
     variation       287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772108083"
     variation       288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139520381"
     variation       290
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949681789"
     variation       292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779006069"
     variation       298
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908676712"
     variation       302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982980262"
     variation       303
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950429441"
     variation       304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4776525"
     variation       308
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576352018"
     variation       310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549224209"
     variation       315
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201845955"
     variation       317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488993066"
     variation       319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756445577"
     variation       321
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764828191"
     variation       323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355491607"
     variation       324
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377680103"
     variation       325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755579260"
     variation       326
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371918252"
     variation       327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303262408"
     variation       330
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764865567"
     variation       332
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339574450"
     variation       333
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757762436"
     variation       336
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163448229"
     variation       337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398383857"
     variation       342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362621562"
     variation       343
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305757864"
     variation       348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762625258"
     variation       352
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442593483"
     variation       362
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244928153"
     exon            364..452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       364
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304730821"
     variation       369
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749452750"
     variation       371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199674938"
     variation       373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353578741"
     variation       374
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169187149"
     variation       379
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756422766"
     variation       383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748426431"
     variation       385..388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1170387613"
     variation       386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1001647122"
     variation       387
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186379110"
     variation       388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440397734"
     variation       389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1257660840"
     variation       392
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200466441"
     variation       397
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144740902"
     variation       405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755496829"
     variation       407
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752147626"
     variation       410
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199557627"
     variation       417
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372106995"
     variation       419
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756845017"
     variation       421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372824577"
     variation       425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763651305"
     variation       427
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760416879"
     variation       429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143934745"
     variation       431
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368204874"
     variation       432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139963947"
     variation       435
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290089484"
     variation       437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467685570"
     variation       438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774284055"
     variation       447
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163111259"
     variation       448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770909619"
     variation       450
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1369779891"
     exon            453..517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       457
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197933688"
     variation       464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752397778"
     variation       467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292288824"
     variation       472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767241211"
     variation       474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759312731"
     variation       475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575121985"
     variation       477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766269411"
     variation       481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762994459"
     variation       486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776691128"
     variation       487
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038668421"
     variation       489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773114002"
     variation       490
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769951675"
     variation       493
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969352633"
     variation       496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761876986"
     variation       497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304200216"
     variation       498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777009991"
     variation       503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358169206"
     variation       504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1160109907"
     variation       507
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769060788"
     variation       512
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272656817"
     variation       513
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747374334"
     variation       515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482752531"
     variation       516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170715310"
     exon            518..575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       520
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370445328"
     variation       521
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775635325"
     variation       522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61741208"
     variation       523
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425559828"
     variation       531
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373663999"
     variation       533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750381521"
     variation       535
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765177088"
     variation       536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179110010"
     variation       537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386906367"
     variation       542
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370021264"
     variation       544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776918046"
     variation       546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764380928"
     variation       547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328660098"
     variation       548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761029311"
     variation       549
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974703083"
     variation       550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775949594"
     variation       551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772488174"
     variation       554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746300849"
     variation       561
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952266634"
     variation       562
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370534833"
     variation       563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375703457"
     variation       566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282084972"
     variation       568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771406773"
     variation       569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747622571"
     variation       574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559637926"
     variation       575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150678830"
     exon            576..646
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537637071"
     variation       579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568890167"
     variation       579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1253227195"
     variation       581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178317282"
     variation       582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013155635"
     variation       591
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980202429"
     variation       592
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201525940"
     variation       595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566976158"
     variation       598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771692697"
     variation       599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745645569"
     variation       601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200529188"
     variation       602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141940448"
     variation       605
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247226009"
     variation       617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757214469"
     variation       618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753859325"
     variation       621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148128872"
     variation       625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307576177"
     variation       628..631
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:748824469"
     variation       636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317718258"
     variation       638
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199625101"
     variation       639
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577583531"
     variation       644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767747054"
     variation       646
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751899551"
     exon            647..753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575135370"
     variation       650
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955058992"
     variation       651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191038243"
     variation       653
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756160531"
     variation       654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027916003"
     variation       657
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996559283"
     variation       658
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888097908"
     variation       666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264885939"
     variation       673
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048075076"
     variation       675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774044627"
     variation       679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199643973"
     variation       682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276134047"
     variation       686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278582950"
     variation       688
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752798754"
     variation       691
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781150235"
     variation       693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296581984"
     variation       694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395484392"
     variation       695
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201050468"
     variation       697
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147378902"
     variation       698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470619919"
     variation       699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766710720"
     variation       700
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763293792"
     variation       704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463864174"
     variation       704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="ta"
                     /db_xref="dbSNP:376160405"
     variation       709
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373236592"
     variation       710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378097878"
     variation       712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139165884"
     variation       713
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287172841"
     variation       714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421512462"
     variation       715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765706515"
     variation       719
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762356912"
     variation       723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775017793"
     variation       724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759163989"
     variation       726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773860365"
     variation       727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142735122"
     variation       737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749060432"
     variation       742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138672950"
     variation       743
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314396533"
     variation       744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947475803"
     variation       746
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769801962"
     variation       747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453478751"
     variation       749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283260161"
     variation       751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928634952"
     exon            754..935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376651877"
     variation       760
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762717061"
     variation       761
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405222421"
     variation       763
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145754980"
     variation       764
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149120122"
     variation       766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225994798"
     variation       767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748057752"
     variation       769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196944776"
     variation       775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746059009"
     variation       776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368611824"
     variation       780
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938177378"
     variation       781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483419222"
     variation       796
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202142485"
     variation       797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:755443569"
     variation       797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747032491"
     variation       799
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282320019"
     variation       803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780161131"
     variation       805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351944623"
     variation       807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758567740"
     variation       808..809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:747345977"
     variation       808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222017133"
     variation       811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138086966"
     variation       812
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193950322"
     variation       817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392326783"
     variation       818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199497578"
     variation       821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536787451"
     variation       825
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754294636"
     variation       828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764476030"
     variation       831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756692970"
     variation       837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549811052"
     variation       843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766014158"
     variation       844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624989"
     variation       850
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157362356"
     variation       852
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773009171"
     variation       854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384841660"
     variation       859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933395435"
     variation       864
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475247322"
     variation       865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240582913"
     variation       867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764995653"
     variation       868
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761511146"
     variation       869
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776532990"
     variation       875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768459344"
     variation       876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760688895"
     variation       880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164741404"
     variation       884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320626526"
     variation       885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775508502"
     variation       886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218411195"
     variation       887
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772144245"
     variation       892
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271590081"
     variation       896
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746033972"
     variation       898
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:567529933"
     variation       903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366671651"
     variation       905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771223179"
     variation       909
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438272750"
     variation       912
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201109696"
     variation       914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470949991"
     variation       916
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150361297"
     variation       917
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988228657"
     variation       918
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778220594"
     variation       919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756537761"
     variation       924
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258930295"
     variation       927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349863148"
     variation       929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753257290"
     variation       930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975711700"
     exon            936..973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       937..942
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gagaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:1024431721"
     variation       937
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770205119"
     variation       945
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988124378"
     variation       946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143150748"
     variation       947
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748578187"
     variation       952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244247162"
     variation       959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144905097"
     variation       962
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755585403"
     variation       964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479849974"
     variation       971
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235019364"
     exon            974..1042
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148156777"
     variation       975
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777479598"
     variation       982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288295243"
     variation       983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373823406"
     variation       984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370959404"
     variation       986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767328670"
     variation       992
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480298310"
     variation       994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754838700"
     variation       996
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1201123710"
     variation       998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995393187"
     variation       1008
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478172484"
     variation       1016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260622295"
     variation       1017
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202800502"
     variation       1018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146712252"
     variation       1027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766284405"
     variation       1033
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203011477"
     variation       1034
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763082528"
     variation       1040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264845374"
     variation       1042
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223900439"
     exon            1043..1150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463261843"
     variation       1046
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775760805"
     variation       1048
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162316349"
     variation       1054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772579838"
     variation       1066
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759989049"
     variation       1072..1077
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1248226204"
     variation       1073
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184179132"
     variation       1074
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772639630"
     variation       1084
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769302585"
     variation       1091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295344316"
     variation       1094..1102
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="caagaacaa"
                     /replace="caagaacaagaacaa"
                     /db_xref="dbSNP:1275644276"
     variation       1094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747714236"
     variation       1097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397224882"
     variation       1101..1103
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1198423691"
     variation       1104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780818072"
     variation       1107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357417941"
     variation       1112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979060947"
     variation       1121
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145715387"
     variation       1123
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61746369"
     variation       1124
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566970715"
     variation       1125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746365"
     variation       1128..1129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:752630677"
     variation       1128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376789292"
     variation       1139
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758317449"
     variation       1142
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302182766"
     variation       1145
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750333142"
     exon            1151..1183
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402782957"
     variation       1157
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:759364060"
     variation       1157
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052686418"
     variation       1158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761281162"
     variation       1164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290454831"
     variation       1165
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776166541"
     variation       1171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200302709"
     variation       1172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768303511"
     variation       1173
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382637908"
     variation       1178
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142271497"
     variation       1179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779831779"
     variation       1180
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369346643"
     variation       1181
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306315355"
     variation       1182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745719709"
     exon            1184..1282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867191492"
     variation       1194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361173843"
     variation       1195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760318791"
     variation       1200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383103981"
     variation       1208
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372300506"
     variation       1210
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565517215"
     variation       1222
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475113537"
     variation       1227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828314"
     variation       1228
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319431733"
     variation       1230
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745631620"
     variation       1235
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465694321"
     variation       1236
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243090307"
     variation       1238
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774340258"
     variation       1244
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314345049"
     variation       1247
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770945768"
     variation       1248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749239182"
     variation       1253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184375610"
     variation       1259..1263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1566969951"
     variation       1263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418353952"
     variation       1264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741196"
     variation       1265
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1566969944"
     variation       1266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748323152"
     exon            1283..1319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774221009"
     variation       1304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405278410"
     variation       1313
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325480584"
     variation       1314
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228442003"
     variation       1318
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770861703"
     variation       1319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749149499"
     exon            1320..1372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1324
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945191881"
     variation       1327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773108087"
     variation       1328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465988518"
     variation       1329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174815224"
     variation       1331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553785289"
     variation       1332
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761839722"
     variation       1337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913701457"
     variation       1340..1345
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaacaa"
                     /db_xref="dbSNP:1297344563"
     variation       1340..1342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1428444297"
     variation       1341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:976029823"
     variation       1348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266308167"
     variation       1349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507272"
     variation       1356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768738122"
     variation       1358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150049035"
     variation       1362
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112415946"
     variation       1368..1371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1566967325"
     variation       1368
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574725954"
     variation       1370
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772324074"
     exon            1373..4111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1374
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202844390"
     variation       1376
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776619025"
     variation       1380
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768648048"
     variation       1383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235618053"
     variation       1386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760715088"
     variation       1395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775600260"
     variation       1400
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283869153"
     variation       1417
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139369634"
     variation       1425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746136094"
     variation       1429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321769231"
     variation       1430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774515740"
     variation       1432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771310964"
     variation       1434..1474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaatt"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaattatcttta
                     cccagtcaaacgtcatactctgaaaatgaaatt"
                     /db_xref="dbSNP:750095912"
     variation       1435
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749680290"
     variation       1440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147499743"
     variation       1443
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897579140"
     variation       1446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200591121"
     variation       1452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142769157"
     variation       1453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570402849"
     variation       1457
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757920252"
     variation       1465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1455895333"
     variation       1474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182860391"
     variation       1477..1485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaga"
                     /replace="aaagaaaga"
                     /db_xref="dbSNP:1200815816"
     variation       1478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157224002"
     variation       1481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379997134"
     variation       1485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750101761"
     variation       1486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386536409"
     variation       1489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483733617"
     variation       1492
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764857714"
     variation       1493
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226323671"
     variation       1494
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344354609"
     variation       1498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299016704"
     variation       1499
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757072272"
     variation       1500
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753673926"
     variation       1506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322532596"
     variation       1508
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551986241"
     variation       1516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236304709"
     variation       1524
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001451916"
     variation       1525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78821209"
     variation       1528
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537236890"
     variation       1529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369379599"
     variation       1530
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571781334"
     variation       1533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370575616"
     variation       1537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162858778"
     variation       1538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566966234"
     variation       1539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471807664"
     variation       1540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370103425"
     variation       1545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566966222"
     variation       1547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1209298850"
     variation       1547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188053967"
     variation       1548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253935608"
     variation       1554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147152893"
     variation       1556
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469993608"
     variation       1564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771094058"
     variation       1571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250115960"
     variation       1574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931827501"
     variation       1575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867253624"
     variation       1577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749637765"
     variation       1581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420006408"
     variation       1584
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191011342"
     variation       1585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375893173"
     variation       1599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748668041"
     variation       1601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539534982"
     variation       1604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757914518"
     variation       1606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163578023"
     variation       1607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246027586"
     variation       1609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335497796"
     variation       1611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923147961"
     variation       1612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052494407"
     variation       1617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745438939"
     variation       1622
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778596630"
     variation       1625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372485796"
     variation       1629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403071720"
     variation       1630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538327129"
     variation       1634
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308811624"
     variation       1642
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040186718"
     variation       1648..1651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:764913324"
     variation       1651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338495342"
     variation       1652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426982968"
     variation       1653
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935486637"
     variation       1654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372813692"
     variation       1656
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274030713"
     variation       1663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898543"
     variation       1664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753584998"
     variation       1669
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571464088"
     variation       1671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755982027"
     variation       1675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473730350"
     variation       1676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252790170"
     variation       1679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198301540"
     variation       1681
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566572244"
     variation       1682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292671501"
     variation       1687
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767418284"
     variation       1699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337290879"
     variation       1701
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350415570"
     variation       1704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266700509"
     variation       1707
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230606808"
     variation       1717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1481218749"
     variation       1726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759626819"
     variation       1729
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774338996"
     variation       1737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766571413"
     variation       1738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332269324"
     variation       1739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147142448"
     variation       1740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381510765"
     variation       1742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386348273"
     variation       1744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773643136"
     variation       1748
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1457548131"
     variation       1749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769242051"
     variation       1750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762325166"
     variation       1753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777192081"
     variation       1758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368193973"
     variation       1761
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769084461"
     variation       1768
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745363839"
     variation       1769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1167864673"
     variation       1769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374373516"
     variation       1772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353434609"
     variation       1774
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188217497"
     variation       1779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566965906"
     variation       1780
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748949025"
     variation       1781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946732138"
     variation       1787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211011324"
     variation       1788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266089926"
     variation       1790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973029319"
     variation       1791
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941670591"
     variation       1799
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777490563"
     variation       1801
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916827234"
     variation       1802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230873"
     variation       1803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370993832"
     variation       1805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755896148"
     variation       1807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262141192"
     variation       1809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752525197"
     variation       1810
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141625629"
     variation       1817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754891956"
     variation       1818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965837"
     variation       1821..1826
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cag"
                     /replace="cagcag"
                     /db_xref="dbSNP:1312173141"
     variation       1822
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226035123"
     variation       1837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035144433"
     variation       1839
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751617518"
     variation       1845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322418730"
     variation       1846
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766372312"
     variation       1850
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277583685"
     variation       1854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308156923"
     variation       1860
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405011603"
     variation       1864
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972902015"
     variation       1869..1874
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:761259954"
     variation       1877
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765082684"
     variation       1878
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1241524280"
     variation       1878
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983130163"
     variation       1879
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763209812"
     variation       1889..1893
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ga"
                     /replace="gatga"
                     /db_xref="dbSNP:1483236528"
     variation       1891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1014700431"
     variation       1898
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750659290"
     variation       1900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765623117"
     variation       1901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260089275"
     variation       1902
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762237342"
     variation       1906
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776911245"
     variation       1914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542712606"
     variation       1919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1566965737"
     variation       1919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428584780"
     variation       1920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143460657"
     variation       1921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761120761"
     variation       1925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389271529"
     variation       1927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392493964"
     variation       1931
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434063535"
     variation       1937..1940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="agta"
                     /db_xref="dbSNP:776234127"
     variation       1938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237191959"
     variation       1940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530712413"
     variation       1941
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965692"
     variation       1949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372319891"
     variation       1951
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278858554"
     variation       1952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867923886"
     variation       1955
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748859067"
     variation       1956
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761442046"
     variation       1957
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377063029"
     variation       1959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299751588"
     variation       1962
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777370351"
     variation       1967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381941641"
     variation       1969..1975
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaaag"
                     /db_xref="dbSNP:752971680"
     variation       1970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769480423"
     variation       1974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368054323"
     variation       1980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143605384"
     variation       1981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762372831"
     variation       1982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754876721"
     variation       1985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751462507"
     variation       1986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171037362"
     variation       1991
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780096426"
     variation       1992
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750571401"
     variation       1995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765534267"
     variation       1998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957984005"
     variation       1999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440239377"
     variation       2000
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182468125"
     variation       2003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566965605"
     variation       2012
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237719512"
     variation       2013
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764373773"
     variation       2014
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189747910"
     variation       2016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1276241026"
     variation       2017
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205237913"
     variation       2022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149316568"
     variation       2023
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935185666"
     variation       2024
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287603706"
     variation       2026..2035
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttcca"
                     /replace="ttccattcca"
                     /db_xref="dbSNP:1209304699"
     variation       2028
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051919371"
     variation       2039
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1379562256"
     variation       2053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137905046"
     variation       2054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409364953"
     variation       2064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772729423"
     variation       2065
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769394198"
     variation       2068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900765014"
     variation       2073
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417619180"
     variation       2086
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777042000"
     variation       2091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345977854"
     variation       2092..2098
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:761196686"
     variation       2092
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144753268"
     variation       2097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776427691"
     variation       2099..2100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1407455541"
     variation       2099
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:916605642"
     variation       2100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291808645"
     variation       2105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768322363"
     variation       2108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990837009"
     variation       2109
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181905465"
     variation       2115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746888229"
     variation       2117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780109504"
     variation       2119
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182318688"
     variation       2127..2140
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aatcacttagtgaa"
                     /db_xref="dbSNP:776135225"
     variation       2132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487849376"
     variation       2133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244932965"
     variation       2136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223599749"
     variation       2146
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267339515"
     variation       2149
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352221163"
     variation       2150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226330202"
     variation       2152..2156
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:1217943474"
     variation       2154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758459810"
     variation       2158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374297683"
     variation       2161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779167032"
     variation       2170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757490219"
     variation       2171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307499623"
     variation       2172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235939807"
     variation       2174
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140635691"
     variation       2180
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754023228"
     variation       2182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317092567"
     variation       2184
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764438751"
     variation       2186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756435149"
     variation       2190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158956599"
     variation       2192
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753151975"
     variation       2194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146812558"
     variation       2195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150332740"
     variation       2196..2212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tcaaaccagaggaacat"
                     /db_xref="dbSNP:1247316402"
     variation       2198
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432106607"
     variation       2199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764739595"
     variation       2209
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761443025"
     variation       2211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488797117"
     variation       2218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776143210"
     variation       2219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140160623"
     variation       2220..2221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:772377977"
     variation       2226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746758700"
     variation       2228
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311824317"
     variation       2229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299359674"
     variation       2233..2236
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agaa"
                     /db_xref="dbSNP:970273738"
     variation       2233
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979975050"
     variation       2237
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557645324"
     variation       2245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775448576"
     variation       2254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772096665"
     variation       2255
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199892116"
     variation       2256
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779081391"
     variation       2257..2264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1375990005"
     variation       2257
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936438"
     variation       2260
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866060046"
     variation       2269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373326012"
     variation       2272..2274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtt"
                     /db_xref="dbSNP:1270870020"
     variation       2276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777832416"
     variation       2278
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756377521"
     variation       2279
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148252688"
     variation       2282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274537467"
     variation       2287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767869140"
     variation       2288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578213404"
     variation       2298
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965237"
     variation       2304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435955969"
     variation       2307..2308
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1451108300"
     variation       2307
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558028386"
     variation       2312
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373285275"
     variation       2316
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766938380"
     variation       2319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761196411"
     variation       2320
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753438291"
     variation       2321
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179954027"
     variation       2323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763604401"
     variation       2325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996377083"
     variation       2326
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212377743"
     variation       2333
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760408838"
     variation       2335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297526559"
     variation       2336
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398223085"
     variation       2345
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029042423"
     variation       2351
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226748397"
     variation       2352
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775358941"
     variation       2353..2361
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taac"
                     /replace="taacttaac"
                     /db_xref="dbSNP:746217937"
     variation       2357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296811524"
     variation       2359..2363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1378003575"
     variation       2360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409830101"
     variation       2363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995870019"
     variation       2369
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79724871"
     variation       2371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304177552"
     variation       2373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434816509"
     variation       2376
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772008800"
     variation       2379..2383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:768133711"
     variation       2382
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774430262"
     variation       2383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142981855"
     variation       2387
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1186628370"
     variation       2388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566442081"
     variation       2389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749274778"
     variation       2401
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183755247"
     variation       2404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233546440"
     variation       2405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486042331"
     variation       2410
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374407527"
     variation       2412
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294530834"
     variation       2414
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777936135"
     variation       2416
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203089850"
     variation       2420
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1344994724"
     variation       2424
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769838106"
     variation       2426
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244552166"
     variation       2427
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722238"
     variation       2428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265370501"
     variation       2429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314440584"
     variation       2430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781449269"
     variation       2434..2440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgat"
                     /replace="tgatgat"
                     /db_xref="dbSNP:886129812"
     variation       2436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999303820"
     variation       2444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115305380"
     variation       2446..2448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:771141640"
     variation       2446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043813141"
     variation       2449
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965008"
     variation       2452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751960436"
     variation       2453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256574910"
     variation       2455
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780402434"
     variation       2465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143107777"
     variation       2475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746153669"
     variation       2476
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763666095"
     variation       2477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475118411"
     variation       2486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760189268"
     variation       2488
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475690959"
     variation       2489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114734080"
     variation       2494
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055504626"
     variation       2497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767347929"
     variation       2498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251895617"
     variation       2499
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209699606"
     variation       2503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759376888"
     variation       2508
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267670492"
     variation       2509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774340474"
     variation       2515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328099333"
     variation       2527
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770730167"
     variation       2529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762949630"
     variation       2531
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335772850"
     variation       2534
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322815679"
     variation       2535
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928183718"
     variation       2537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037315077"
     variation       2543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550619844"
     variation       2544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530685196"
     variation       2548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748293056"
     variation       2552
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456477947"
     variation       2553
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411541636"
     variation       2554..2558
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:749389307"
     variation       2554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157150095"
     variation       2555
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226026499"
     variation       2557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270305251"
     variation       2560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781361234"
     variation       2561
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747325846"
     variation       2573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200006843"
     variation       2576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780499099"
     variation       2580
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140445271"
     variation       2588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934543893"
     variation       2589
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212832355"
     variation       2590
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383721061"
     variation       2592
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3743315"
     variation       2593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779348840"
     variation       2594
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755684641"
     variation       2595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146530294"
     variation       2609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144149272"
     variation       2616
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141249659"
     variation       2620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751243389"
     variation       2627
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766207502"
     variation       2629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139052072"
     variation       2631
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436953298"
     variation       2632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150709937"
     variation       2635
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761857749"
     variation       2640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565495606"
     variation       2641
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240440235"
     variation       2643
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768826242"
     variation       2646
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866984332"
     variation       2650
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200395651"
     variation       2651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529227646"
     variation       2655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772473505"
     variation       2656
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746288247"
     variation       2662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194746304"
     variation       2665
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449245811"
     variation       2667
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022511481"
     variation       2676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438169337"
     variation       2677
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181818682"
     variation       2678
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757891331"
     variation       2683
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236184502"
     variation       2684
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747617330"
     variation       2685
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113034898"
     variation       2686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277434255"
     variation       2697
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780849532"
     variation       2699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543814859"
     variation       2704..2711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1350165153"
     variation       2704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751208406"
     variation       2709
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227665151"
     variation       2710..2717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gatgatga"
                     /replace="gatgatgatga"
                     /db_xref="dbSNP:1566964634"
     variation       2711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362931327"
     variation       2712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766011610"
     variation       2714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376472787"
     variation       2716
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431162816"
     variation       2717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327281597"
     variation       2718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372114429"
     variation       2720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750233015"
     variation       2723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412850542"
     variation       2731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765110929"
     variation       2745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174334195"
     variation       2751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572194470"
     variation       2752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61742861"
     variation       2757
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055238133"
     variation       2761
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776626083"
     variation       2762
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373897961"
     variation       2763
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236554388"
     variation       2775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760804726"
     variation       2776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370496255"
     variation       2785..2791
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aac"
                     /replace="aactaac"
                     /db_xref="dbSNP:1371591644"
     variation       2787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280498533"
     variation       2788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203787188"
     variation       2791
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340023525"
     variation       2792..2796
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:777766591"
     variation       2794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274980061"
     variation       2796..2800
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aatta"
                     /db_xref="dbSNP:1355309424"
     variation       2800
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304525321"
     variation       2802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772226288"
     variation       2803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267931146"
     variation       2804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446173919"
     variation       2806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746224315"
     variation       2809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:756184473"
     variation       2817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774605454"
     variation       2818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771493657"
     variation       2819
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749822960"
     variation       2820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778478573"
     variation       2822
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201529951"
     variation       2825
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754528890"
     variation       2827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377221680"
     variation       2828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779733419"
     variation       2830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940222197"
     variation       2831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766173619"
     variation       2834
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758008300"
     variation       2838
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750193346"
     variation       2841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778685231"
     variation       2843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190718928"
     variation       2851
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762576820"
     variation       2854..2858
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agata"
                     /db_xref="dbSNP:1402710829"
     variation       2855
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753763851"
     variation       2860
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764087607"
     variation       2861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332224732"
     variation       2863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:924540713"
     variation       2865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337270794"
     variation       2867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413673713"
     variation       2872..2876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1474040206"
     variation       2872
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465299577"
     variation       2878
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760779968"
     variation       2880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227885264"
     variation       2882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752771670"
     variation       2886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767734444"
     variation       2891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:572636096"
     variation       2892
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186541436"
     variation       2893
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974501075"
     variation       2899
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463306916"
     variation       2900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201393156"
     variation       2901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770471453"
     variation       2902
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746477639"
     variation       2905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750139193"
     variation       2906
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:911516443"
     variation       2908
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771689094"
     variation       2912
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745522222"
     variation       2914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391733409"
     variation       2917
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778595564"
     variation       2920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977733665"
     variation       2922
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569081139"
     variation       2925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244875719"
     variation       2929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215364258"
     variation       2932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468712893"
     variation       2935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138757062"
     variation       2936
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144820825"
     variation       2938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761275966"
     variation       2940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567387793"
     variation       2948
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315343704"
     variation       2949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293917832"
     variation       2950
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011137827"
     variation       2952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142570134"
     variation       2953
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756032048"
     variation       2962
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301816495"
     variation       2966
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566964256"
     variation       2968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752786283"
     variation       2976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767504087"
     variation       2980..2981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1320303593"
     variation       2984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759716420"
     variation       2989
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145177868"
     variation       2990
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766776608"
     variation       2994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763399066"
     variation       2998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481269884"
     variation       3000
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202233435"
     variation       3002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773727019"
     variation       3006
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454552195"
     variation       3009
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143299796"
     variation       3011
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206572054"
     variation       3013..3016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1566964208"
     variation       3018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770270564"
     variation       3020
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262673982"
     variation       3023
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216618477"
     variation       3025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762259073"
     variation       3026
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775015884"
     variation       3034
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771459849"
     variation       3040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745420520"
     variation       3041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867743924"
     variation       3045
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199811737"
     variation       3046
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372349789"
     variation       3047
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776238893"
     variation       3050
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186785151"
     variation       3060..3067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:747011009"
     variation       3064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778530154"
     variation       3065..3066
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1380852623"
     variation       3073
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149154885"
     variation       3074
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377062806"
     variation       3075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037005896"
     variation       3077..3085
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="acaa"
                     /replace="acaatacaa"
                     /db_xref="dbSNP:984944897"
     variation       3078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167760889"
     variation       3080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777545622"
     variation       3087
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462458974"
     variation       3089
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229574674"
     variation       3092
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200262267"
     variation       3094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373954045"
     variation       3096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781233334"
     variation       3097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186479155"
     variation       3100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430033055"
     variation       3106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934005"
     variation       3107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187267933"
     variation       3108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483047561"
     variation       3109
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751749504"
     variation       3110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766651986"
     variation       3111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349283189"
     variation       3112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274496633"
     variation       3113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565566100"
     variation       3116
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150013138"
     variation       3118
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762286800"
     variation       3124
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003526969"
     variation       3126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293401872"
     variation       3128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150396339"
     variation       3130
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295852845"
     variation       3133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764727706"
     variation       3134
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759030929"
     variation       3140
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314224198"
     variation       3141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78910436"
     variation       3144
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770500675"
     variation       3151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378745086"
     variation       3154..3158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1373504461"
     variation       3154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1309748995"
     variation       3155
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166029557"
     variation       3156..3163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaa"
                     /replace="agaaagaa"
                     /db_xref="dbSNP:779948888"
     variation       3157
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463337434"
     variation       3161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257749507"
     variation       3163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761282559"
     variation       3164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186538346"
     variation       3171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423512004"
     variation       3173
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900040152"
     variation       3174
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892903658"
     variation       3176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255628584"
     variation       3178
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190186663"
     variation       3179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748967422"
     variation       3182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772971250"
     variation       3187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1393260936"
     variation       3190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769448570"
     variation       3192..3195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1433847781"
     variation       3196
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201129903"
     variation       3198
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533405767"
     variation       3199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747020540"
     variation       3202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780313659"
     variation       3203
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758644950"
     variation       3204
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1428916618"
     variation       3209..3218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaag"
                     /replace="gaagaagaag"
                     /db_xref="dbSNP:752051341"
     variation       3211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750650986"
     variation       3212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370665811"
     variation       3213
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911653516"
     variation       3216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377370063"
     variation       3217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761172640"
     variation       3219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963853"
     variation       3222
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292771673"
     variation       3228
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977702702"
     variation       3233
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773806522"
     variation       3236
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765892818"
     variation       3243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475577182"
     variation       3245..3251
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aagttaa"
                     /db_xref="dbSNP:766568043"
     variation       3245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363364328"
     variation       3248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762493874"
     variation       3250..3255
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:764821090"
     variation       3251..3256
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:756877452"
     variation       3254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772738557"
     variation       3255..3259
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:753401958"
     variation       3259
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769550419"
     variation       3266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:763761269"
     variation       3267..3269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1251031317"
     variation       3267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485902818"
     variation       3268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328037304"
     variation       3269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747843231"
     variation       3271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610970"
     variation       3273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453756158"
     variation       3276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923326489"
     variation       3279
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139290693"
     variation       3283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427027182"
     variation       3288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115468507"
     variation       3289
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200022948"
     variation       3292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396315633"
     variation       3293..3295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1326328053"
     variation       3293
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346073421"
     variation       3294
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144888058"
     variation       3297
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462217381"
     variation       3301
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384497021"
     variation       3303
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150879212"
     variation       3320
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746025331"
     variation       3322
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364894691"
     variation       3324
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193485115"
     variation       3327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453114233"
     variation       3329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255352641"
     variation       3331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778988212"
     variation       3338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446110801"
     variation       3344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757511713"
     variation       3345
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367717515"
     variation       3347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350690111"
     variation       3349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151082439"
     variation       3350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232074099"
     variation       3351
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144784600"
     variation       3355..3363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaca"
                     /replace="aaacaaaca"
                     /db_xref="dbSNP:760248027"
     variation       3355..3356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1434046169"
     variation       3355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753175278"
     variation       3357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762440473"
     variation       3359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749966397"
     variation       3360..3363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaca"
                     /db_xref="dbSNP:776187194"
     variation       3360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963604"
     variation       3361
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764731158"
     variation       3366
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201495100"
     variation       3367..3370
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:768033647"
     variation       3368..3372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:759845763"
     variation       3371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61729919"
     variation       3374
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981738348"
     variation       3381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374484868"
     variation       3388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768549664"
     variation       3389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760587117"
     variation       3390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775563177"
     variation       3391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749286770"
     variation       3393
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447209836"
     variation       3396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256260967"
     variation       3398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208069831"
     variation       3409..3413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1350011472"
     variation       3410
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462360350"
     variation       3411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112724542"
     variation       3416
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180946566"
     variation       3418
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963487"
     variation       3433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041165424"
     variation       3438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772610492"
     variation       3440..3441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1291392072"
     variation       3448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441900290"
     variation       3452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:774725796"
     variation       3452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227412444"
     variation       3455
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779052323"
     variation       3456
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771016231"
     variation       3459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566466849"
     variation       3462
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312398424"
     variation       3463
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60600939"
     variation       3467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032768595"
     variation       3472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301398857"
     variation       3473
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143154561"
     variation       3474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228452639"
     variation       3475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042148247"
     variation       3477..3483
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:552400386"
     variation       3480
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409751072"
     variation       3481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291910130"
     variation       3482
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998603734"
     variation       3483
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753122092"
     variation       3484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963385"
     variation       3485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169990957"
     variation       3488
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475565207"
     variation       3489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963372"
     variation       3490
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:903041127"
     variation       3491
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945027721"
     variation       3497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781623644"
     variation       3499
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486338070"
     variation       3505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755483322"
     variation       3507
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777911577"
     variation       3512..3517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1475565609"
     variation       3517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417486764"
     variation       3519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165117759"
     variation       3521
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749863215"
     variation       3522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274916743"
     variation       3525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764825647"
     variation       3533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318917370"
     variation       3536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753497715"
     variation       3537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329897637"
     variation       3540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763904811"
     variation       3544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139791694"
     variation       3545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775436524"
     variation       3551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146031233"
     variation       3554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759546659"
     variation       3555
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754814316"
     variation       3556
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188103753"
     variation       3557..3570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagagtatgcaaag"
                     /db_xref="dbSNP:1566963228"
     variation       3557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546764485"
     variation       3560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410839490"
     variation       3563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749398612"
     variation       3564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162265176"
     variation       3565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413932"
     variation       3568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770019747"
     variation       3571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963221"
     variation       3573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176101172"
     variation       3577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548726754"
     variation       3578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781569828"
     variation       3583
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559274117"
     variation       3586
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796110323"
     variation       3588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989553182"
     variation       3590
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204990567"
     variation       3593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755393718"
     variation       3595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747528345"
     variation       3598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746327"
     variation       3599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756787230"
     variation       3601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753457065"
     variation       3603
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981924422"
     variation       3611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763779567"
     variation       3613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215002996"
     variation       3615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213927961"
     variation       3620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150767083"
     variation       3627..3630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1281732084"
     variation       3630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970579095"
     variation       3632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752497204"
     variation       3634
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767439854"
     variation       3636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759294074"
     variation       3644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462736263"
     variation       3645
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866429673"
     variation       3647
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157774747"
     variation       3651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398405690"
     variation       3655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219987023"
     variation       3659
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410091794"
     variation       3665
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371543852"
     variation       3667
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1240444209"
     variation       3675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766288503"
     variation       3681
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1250965782"
     variation       3684
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763035452"
     variation       3685
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773286699"
     variation       3687
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769966701"
     variation       3692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281421381"
     variation       3705
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748393199"
     variation       3708
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776890041"
     variation       3711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433219998"
     variation       3714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769035026"
     variation       3717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173449925"
     variation       3718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747398460"
     variation       3721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780597103"
     variation       3722..3730
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:749581565"
     variation       3723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288738264"
     variation       3727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026954629"
     variation       3733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443519032"
     variation       3734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550285923"
     variation       3736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779816286"
     variation       3739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777453408"
     variation       3740..3743
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1324173165"
     variation       3743
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346519107"
     variation       3744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159174060"
     variation       3745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1434076328"
     variation       3752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140913353"
     variation       3753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971565660"
     variation       3754
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175314937"
     variation       3765
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900068673"
     variation       3766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367322744"
     variation       3768
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376705053"
     variation       3769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767111911"
     variation       3775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754792990"
     variation       3782
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576595433"
     variation       3788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751329436"
     variation       3790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766275347"
     variation       3791
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750052938"
     variation       3793
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:773412063"
     variation       3793
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056326"
     variation       3796..3802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1250410682"
     variation       3797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761921200"
     variation       3798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446489704"
     variation       3802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776830335"
     variation       3803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768817091"
     variation       3805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1236977978"
     variation       3808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313084114"
     variation       3811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295306150"
     variation       3814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761042400"
     variation       3817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775720069"
     variation       3818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193343738"
     variation       3820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147338503"
     variation       3821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413585528"
     variation       3824
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373580260"
     variation       3825
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466169050"
     variation       3829
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314585451"
     variation       3831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466364119"
     variation       3832..3841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taaa"
                     /replace="taaatataaa"
                     /db_xref="dbSNP:769915866"
     variation       3832..3833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1372347806"
     variation       3837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168032217"
     variation       3840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746397117"
     variation       3845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779609784"
     variation       3848
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485354177"
     variation       3854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370637648"
     variation       3855
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256034065"
     variation       3859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213731967"
     variation       3863..3867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:748199092"
     variation       3863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:564736890"
     variation       3865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382398935"
     variation       3880..3882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:34632458"
     variation       3882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527950551"
     variation       3883
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998635060"
     variation       3886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225658987"
     variation       3890
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747723416"
     variation       3896
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544492679"
     variation       3899
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780844113"
     variation       3902
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352946045"
     variation       3903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294587299"
     variation       3905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754595776"
     variation       3909
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201992560"
     variation       3910
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779738218"
     variation       3912
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758240181"
     variation       3913
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373804994"
     variation       3915
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113255037"
     variation       3916
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750331586"
     variation       3920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765225720"
     variation       3921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209393544"
     variation       3924
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761867692"
     variation       3925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415851746"
     variation       3928
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467479016"
     variation       3939
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213617382"
     variation       3949..3955
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaa"
                     /replace="gaaggaa"
                     /db_xref="dbSNP:1566962706"
     variation       3949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753877154"
     variation       3950
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424937886"
     variation       3956
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368669913"
     variation       3957
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899633827"
     variation       3959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764308005"
     variation       3967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756942622"
     variation       3970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760836364"
     variation       3971
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472074991"
     variation       3972
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772299860"
     variation       3977
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760014936"
     variation       3982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470269792"
     variation       3983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143679420"
     variation       3984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332190606"
     variation       3988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274550235"
     variation       3992
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369029822"
     variation       3993
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244833921"
     variation       4003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771581561"
     variation       4013
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747599122"
     variation       4014
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392927393"
     variation       4022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541103929"
     variation       4025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201043161"
     variation       4026
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768309300"
     variation       4032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005420623"
     variation       4033
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292859757"
     variation       4034
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746621471"
     variation       4036
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165101429"
     variation       4037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779798678"
     variation       4038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318616573"
     variation       4039
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388262388"
     variation       4040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363741276"
     variation       4042..4049
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:779889058"
     variation       4044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294985784"
     variation       4045
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335347127"
     variation       4047
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758185068"
     variation       4063..4070
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1566962581"
     variation       4064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542436249"
     variation       4067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369571784"
     variation       4071
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566962576"
     variation       4072
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757191526"
     variation       4075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374854267"
     variation       4076
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209929563"
     variation       4085
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049036897"
     variation       4088
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250279275"
     variation       4091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349257488"
     variation       4092
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764101632"
     variation       4096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756263317"
     variation       4097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182451243"
     variation       4100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576748008"
     variation       4104..4110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:758307207"
     variation       4105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141557783"
     variation       4106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368078785"
     variation       4107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766957344"
     variation       4108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535536215"
     exon            4112..4264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4114..4123
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aactg"
                     /replace="aactgaactg"
                     /db_xref="dbSNP:756996963"
     variation       4116
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566961523"
     variation       4117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905956365"
     variation       4125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200132897"
     variation       4127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763416581"
     variation       4129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773588553"
     variation       4133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765832322"
     variation       4139
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760047960"
     variation       4141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774984644"
     variation       4148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138988448"
     variation       4152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566961470"
     variation       4154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256719926"
     variation       4157
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547776848"
     variation       4158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146910380"
     variation       4159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78551559"
     variation       4161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368965063"
     variation       4167
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450309405"
     variation       4168
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535745285"
     variation       4171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151042907"
     variation       4173
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480459583"
     variation       4177
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002044207"
     variation       4179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781446308"
     variation       4186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941084181"
     variation       4200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341282473"
     variation       4204
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755161566"
     variation       4209
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375621948"
     variation       4211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150030349"
     variation       4214
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780491610"
     variation       4215
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403447526"
     variation       4218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758676774"
     variation       4223
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393892269"
     variation       4224..4227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1323109898"
     variation       4224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:753600540"
     variation       4224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750815316"
     variation       4226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765597280"
     variation       4227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762411725"
     variation       4229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234255488"
     variation       4234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473759839"
     variation       4237
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237936259"
     variation       4238
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752153370"
     variation       4240
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435797405"
     variation       4245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140236740"
     variation       4252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759083805"
     variation       4254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933684841"
     variation       4260
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1240379077"
     variation       4260
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272673604"
     variation       4261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773984259"
     variation       4264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151171457"
     exon            4265..4330
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4265
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747020730"
     variation       4271..4279
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gacag"
                     /replace="gacagacag"
                     /db_xref="dbSNP:1398918298"
     variation       4272
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780214940"
     variation       4276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746078546"
     variation       4277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868344716"
     variation       4283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779043438"
     variation       4286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159044303"
     variation       4287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485299506"
     variation       4293
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453514839"
     variation       4298
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394712701"
     variation       4304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757610547"
     variation       4305
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749706162"
     variation       4307
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201974563"
     variation       4315
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756615583"
     variation       4319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487612749"
     variation       4324
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751024908"
     variation       4328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420514544"
     exon            4331..6904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4332
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157456909"
     variation       4335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304407458"
     variation       4337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368378898"
     variation       4338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554198379"
     variation       4339
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359978954"
     variation       4342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377324710"
     variation       4346
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170318180"
     variation       4352
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865836657"
     variation       4353
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162603788"
     variation       4357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978196574"
     variation       4364
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954400470"
     variation       4372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044554760"
     variation       4373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143220817"
     variation       4382
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139824373"
     variation       4383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773466932"
     variation       4386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770143078"
     variation       4388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111540102"
     variation       4390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483747316"
     variation       4391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748522787"
     variation       4392
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196440176"
     variation       4393..4398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgtgtg"
                     /replace="tgtgtgtg"
                     /db_xref="dbSNP:1227042530"
     variation       4394..4399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgtgc"
                     /db_xref="dbSNP:866156067"
     variation       4394
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769048146"
     variation       4396..4399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgc"
                     /db_xref="dbSNP:752210788"
     variation       4396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745343823"
     variation       4397
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249241"
     variation       4398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756874021"
     variation       4399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145929072"
     variation       4403
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396531642"
     variation       4404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755923541"
     variation       4405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141286633"
     variation       4408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201158136"
     variation       4411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886388966"
     variation       4416
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200933895"
     variation       4419
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772199061"
     variation       4421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457417587"
     variation       4425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200343329"
     variation       4426
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766418592"
     variation       4429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763090198"
     variation       4432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:906520715"
     variation       4433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413779"
     variation       4440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1384502490"
     variation       4441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376522425"
     variation       4446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238358762"
     variation       4447
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212536917"
     variation       4448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941268056"
     variation       4451
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762170475"
     variation       4467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985303826"
     variation       4468
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948180091"
     variation       4470
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561472467"
     variation       4471
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544263104"
     variation       4482
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356549977"
     variation       4501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922431606"
     variation       4506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445902886"
     variation       4515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261285164"
     variation       4516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314505135"
     variation       4520
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384151695"
     variation       4526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248828953"
     variation       4530
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:916623904"
     variation       4533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988859145"
     variation       4534..4542
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:367590847"
     variation       4539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194818555"
     variation       4542
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956123043"
     variation       4543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:575622216"
     variation       4555
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000221049"
     variation       4556
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763484127"
     variation       4562
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:954557874"
     variation       4568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474955160"
     variation       4573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922978083"
     variation       4577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974792883"
     variation       4578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556089663"
     variation       4579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964461730"
     variation       4583
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970323383"
     variation       4590
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016012066"
     variation       4591
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023675426"
     variation       4599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773639790"
     variation       4601..4602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="aca"
                     /db_xref="dbSNP:1226047297"
     variation       4601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895934625"
     variation       4606..4607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1326425807"
     variation       4617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228574756"
     variation       4627
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047894097"
     variation       4629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558550431"
     variation       4630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74021812"
     variation       4631
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261892840"
     variation       4637
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461385830"
     variation       4644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205075102"
     variation       4653
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400418401"
     variation       4660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259574288"
     variation       4664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446402935"
     variation       4669
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:896931954"
     variation       4680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037985884"
     variation       4684
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534898579"
     variation       4689
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889707263"
     variation       4690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148246069"
     variation       4698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933929633"
     variation       4702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175986018"
     variation       4707
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553102743"
     variation       4712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536896734"
     variation       4714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748422160"
     variation       4715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421809840"
     variation       4734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926056836"
     variation       4736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978777572"
     variation       4750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042924019"
     variation       4755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566956467"
     variation       4762
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414459417"
     variation       4769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1344027659"
     variation       4772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933608609"
     variation       4775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323906137"
     variation       4781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566255230"
     variation       4782
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1258489352"
     variation       4788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173039014"
     variation       4791
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970505722"
     variation       4808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205680984"
     variation       4827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022970717"
     variation       4841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478363779"
     variation       4844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993456430"
     variation       4845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574441205"
     variation       4850..4882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gta"
                     /replace="gtaacttggctggccaagttacatgttacagta"
                     /db_xref="dbSNP:1194776576"
     variation       4858
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960297404"
     variation       4860
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554685403"
     variation       4861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537424706"
     variation       4876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481569720"
     variation       4877
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1179689840"
     variation       4880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363329341"
     variation       4881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144173426"
     variation       4888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364311896"
     variation       4898
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424414765"
     variation       4900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304178735"
     variation       4901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345730540"
     variation       4902
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456042311"
     variation       4903..4904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1304186348"
     variation       4905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552641520"
     variation       4911..4913
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1239611021"
     variation       4918..4923
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1288061433"
     variation       4927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950419321"
     variation       4929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005303314"
     variation       4933
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026165493"
     variation       4934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003079503"
     variation       4936
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1194298789"
     variation       4936
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182158874"
     variation       4944..4948
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1566956366"
     variation       4952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419730587"
     variation       4959..4967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cttttatgc"
                     /db_xref="dbSNP:1444618777"
     variation       4959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184152687"
     variation       4964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1023297488"
     variation       4972
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1049417283"
     variation       4981..4983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1367886537"
     variation       4982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012242924"
     variation       4989
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868861603"
     variation       4994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459062768"
     variation       4999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296108844"
     variation       5004
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395399866"
     variation       5005
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391459558"
     variation       5016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566777165"
     variation       5029
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310876154"
     variation       5035
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1053828160"
     variation       5035
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191192670"
     variation       5060
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315395497"
     variation       5061
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529932553"
     variation       5069
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052926971"
     variation       5071
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934515852"
     variation       5075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042564517"
     variation       5082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197610915"
     variation       5090
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1446166632"
     variation       5103
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398137618"
     variation       5105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241388071"
     variation       5106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333629485"
     variation       5107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561204039"
     variation       5108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387408783"
     variation       5115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427097038"
     variation       5118
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2217180"
     variation       5122
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170271752"
     variation       5125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390276297"
     variation       5127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161882710"
     variation       5133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186433966"
     variation       5142
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403269110"
     variation       5152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369585188"
     variation       5153
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039675411"
     variation       5154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181658926"
     variation       5164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337294398"
     variation       5170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113849152"
     variation       5171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756112019"
     variation       5179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239400548"
     variation       5186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908888891"
     variation       5187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984432070"
     variation       5188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198725509"
     variation       5197..5201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aatta"
                     /replace="aattaaatta"
                     /db_xref="dbSNP:1467797221"
     variation       5208
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149532510"
     variation       5212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211457851"
     variation       5213
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204455271"
     variation       5217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356738621"
     variation       5218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138733397"
     variation       5219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992864819"
     variation       5226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262904710"
     variation       5229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428671960"
     variation       5235
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172387132"
     variation       5243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426836032"
     variation       5252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960266201"
     variation       5266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278907159"
     variation       5274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176569306"
     variation       5281
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360800689"
     variation       5285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428583446"
     variation       5297
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971636391"
     variation       5304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022905256"
     variation       5311..5313
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1362409814"
     variation       5320
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237790718"
     variation       5322
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758601952"
     variation       5325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402019838"
     variation       5333..5334
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1323179205"
     variation       5333
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991353434"
     variation       5344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026555875"
     variation       5347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1896430"
     variation       5368
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963474823"
     variation       5373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032326108"
     variation       5380
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215709830"
     variation       5381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447585662"
     variation       5388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489467274"
     variation       5391..5399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ac"
                     /replace="acagtaaac"
                     /db_xref="dbSNP:1266285437"
     variation       5396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000784435"
     variation       5399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566956161"
     variation       5402..5404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1021453371"
     variation       5403
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902606299"
     variation       5405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426707858"
     variation       5408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398814767"
     variation       5409
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016440644"
     variation       5412
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321787319"
     variation       5426..5434
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataa"
                     /replace="ataacataa"
                     /db_xref="dbSNP:1345777426"
     variation       5430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181691919"
     variation       5433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391837361"
     variation       5435
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889561353"
     variation       5438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301106578"
     variation       5442..5452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgtttatagta"
                     /replace="tgtttatagtatttactgtttatagta"
                     /db_xref="dbSNP:1405814502"
     variation       5442
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345097521"
     variation       5463
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:901993360"
     variation       5467..5472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:943619219"
     variation       5471
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028389714"
     variation       5473
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189012551"
     variation       5474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777532110"
     variation       5475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901083054"
     variation       5484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477389956"
     variation       5493
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928947422"
     variation       5500
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244652053"
     variation       5510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200489817"
     variation       5514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919053375"
     variation       5515..5519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1247891531"
     variation       5516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981582011"
     variation       5517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451975851"
     variation       5521..5526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1468147959"
     variation       5528
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949943559"
     variation       5533..5541
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="attt"
                     /replace="attttattt"
                     /db_xref="dbSNP:1566956075"
     variation       5534..5537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1441522771"
     variation       5536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915743282"
     variation       5544..5549
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ca"
                     /replace="cattca"
                     /db_xref="dbSNP:1161389720"
     variation       5546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373479135"
     variation       5562
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053064825"
     variation       5565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355831189"
     variation       5568..5572
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tgagt"
                     /db_xref="dbSNP:1286614193"
     variation       5578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353043111"
     variation       5586
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:998777235"
     variation       5593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241008941"
     variation       5597
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344342739"
     variation       5599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574208509"
     variation       5604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904324587"
     variation       5605
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042910074"
     variation       5606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566956042"
     variation       5612..5615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1379691136"
     variation       5618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948796091"
     variation       5621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557296507"
     variation       5634
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184837742"
     variation       5636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360638120"
     variation       5640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979438692"
     variation       5642
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530090733"
     variation       5645
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1291574853"
     variation       5649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938720605"
     variation       5651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021064890"
     variation       5659
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181191060"
     variation       5660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363046107"
     variation       5663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458984409"
     variation       5664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1181690447"
     variation       5668
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384594406"
     variation       5673
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473000486"
     variation       5677..5679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:71152306"
     variation       5677
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998020336"
     variation       5692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972254101"
     variation       5695
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422376232"
     variation       5696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402557832"
     variation       5708
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007697272"
     variation       5711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963610347"
     variation       5714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1478189186"
     variation       5723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384272313"
     variation       5726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752380957"
     variation       5733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450598040"
     variation       5744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566955991"
     variation       5746..5751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:34923449"
     variation       5746
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268839781"
     variation       5750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:888063091"
     variation       5752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986340483"
     variation       5753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953917167"
     variation       5754
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538685435"
     variation       5756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028107879"
     variation       5766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370819736"
     variation       5767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189296104"
     variation       5768
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240171371"
     variation       5769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997848877"
     variation       5774
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209266494"
     variation       5789
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965005725"
     variation       5795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171674259"
     variation       5796
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:949860297"
     variation       5802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468298638"
     variation       5806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767361500"
     variation       5814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403507344"
     variation       5824
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78351424"
     variation       5826
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316632893"
     variation       5827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904458706"
     variation       5833..5839
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tta"
                     /replace="ttaatta"
                     /db_xref="dbSNP:1566955946"
     variation       5833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326221804"
     variation       5840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376013977"
     variation       5842
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751250766"
     variation       5845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1342031933"
     variation       5847
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221125788"
     variation       5853
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546899841"
     variation       5854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536177816"
     variation       5862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202109991"
     variation       5867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276676362"
     variation       5882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043267468"
     variation       5884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012784561"
     variation       5885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346040663"
     variation       5886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967290732"
     variation       5889
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913908454"
     variation       5901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217215300"
     variation       5905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549305478"
     variation       5908
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467970680"
     variation       5916
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342712529"
     variation       5923
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:976068926"
     variation       5929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1299352439"
     variation       5933..5943
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ccgggggtggt"
                     /db_xref="dbSNP:1299908588"
     variation       5934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765849726"
     variation       5935..5939
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1402747565"
     variation       5935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447856344"
     variation       5938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894546851"
     variation       5939
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751311781"
     variation       5946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1331189153"
     variation       5947..5948
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1234860729"
     variation       5948
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017693258"
     variation       5949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349925724"
     variation       5953
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217041774"
     variation       5956..5970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="taatcccagcacttt"
                     /db_xref="dbSNP:757913661"
     variation       5969
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779863503"
     variation       5981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287925965"
     variation       5982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057176200"
     variation       5983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938776456"
     variation       5999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146273253"
     variation       6010
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036338827"
     variation       6011
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942268077"
     variation       6016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440866710"
     variation       6019
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:909497079"
     variation       6022..6023
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1160778073"
     variation       6024
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550508544"
     variation       6027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566651092"
     variation       6029
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292572117"
     variation       6043
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898054161"
     variation       6044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565083022"
     variation       6049
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1181069400"
     variation       6054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:551350522"
     variation       6055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482271067"
     variation       6063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375998333"
     variation       6066
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240827808"
     variation       6068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311098852"
     variation       6075..6080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tggtgg"
                     /replace="tggtggtgg"
                     /db_xref="dbSNP:1357027939"
     variation       6079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528502860"
     variation       6094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1013889031"
     variation       6095..6097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1266226780"
     variation       6097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239111573"
     variation       6105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142443713"
     variation       6106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543281121"
     variation       6109
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567189507"
     variation       6111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548876308"
     variation       6122
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181064644"
     variation       6128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189196450"
     variation       6145
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575408468"
     variation       6148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558728127"
     variation       6154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165981253"
     variation       6156
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368666449"
     variation       6162
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041527447"
     variation       6163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1165612170"
     variation       6164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398928142"
     variation       6165
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447352701"
     variation       6169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333278391"
     variation       6170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380541884"
     variation       6172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969030386"
     variation       6176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313184887"
     variation       6179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377684511"
     variation       6186..6187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555406629"
     variation       6188..6190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:869092932"
     variation       6188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021579741"
     variation       6196
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257436096"
     variation       6200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318678364"
     variation       6205
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922509821"
     variation       6211..6229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaataaaataaaa"
                     /replace="aaaataaaataaaataaaa"
                     /replace="aaaataaaataaaataaaataaaa"
                     /db_xref="dbSNP:966069714"
     variation       6234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182759116"
     variation       6236
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013250202"
     variation       6241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894274927"
     variation       6242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1190597893"
     variation       6251
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955751"
     variation       6252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035500924"
     variation       6253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465659373"
     variation       6255
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002888196"
     variation       6261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955741"
     variation       6267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403754022"
     variation       6271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465510594"
     variation       6280
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303141260"
     variation       6282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897936808"
     variation       6292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163874554"
     variation       6295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380368119"
     variation       6296
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421804026"
     variation       6300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184289849"
     variation       6304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027843735"
     variation       6305
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312086785"
     variation       6306
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036309356"
     variation       6307
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866570959"
     variation       6310..6320
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tatttt"
                     /replace="tattttatttt"
                     /db_xref="dbSNP:993643128"
     variation       6321
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572848245"
     variation       6328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261991210"
     variation       6337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477956173"
     variation       6347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024554904"
     variation       6356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195162097"
     variation       6357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192296258"
     variation       6359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536503895"
     variation       6362
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894130356"
     variation       6366
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176682836"
     variation       6384
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360888176"
     variation       6385
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196825044"
     variation       6387
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762395038"
     variation       6391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1055356955"
     variation       6393
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999918758"
     variation       6394
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252084840"
     variation       6398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567449909"
     variation       6402
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976267599"
     variation       6405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281384153"
     variation       6420..6421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1219949140"
     variation       6420
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367016007"
     variation       6426
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304046917"
     variation       6429..6430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1320242437"
     variation       6430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315711389"
     variation       6434
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292660252"
     variation       6435
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247268113"
     variation       6436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488374926"
     variation       6441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943753105"
     variation       6442
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244675690"
     variation       6446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487868942"
     variation       6451
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924389167"
     variation       6455
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427156278"
     variation       6461
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533500094"
     variation       6478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448327718"
     variation       6479
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968371968"
     variation       6480
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021715104"
     variation       6487
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991392978"
     variation       6495
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958891501"
     variation       6502..6509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cttc"
                     /replace="cttccttc"
                     /db_xref="dbSNP:1437251810"
     variation       6503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349586868"
     variation       6509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1292538395"
     variation       6511
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295383125"
     variation       6514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035468145"
     variation       6515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040948848"
     variation       6519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:944718523"
     variation       6525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002689646"
     variation       6532
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528333462"
     variation       6541
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930718120"
     variation       6543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920645657"
     variation       6544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320799311"
     variation       6545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378389333"
     variation       6546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247986088"
     variation       6547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456337839"
     variation       6550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769207895"
     variation       6551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006721461"
     variation       6557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962236657"
     variation       6559
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441312016"
     variation       6560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183643713"
     variation       6561
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187857141"
     variation       6563..6565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="tta"
                     /db_xref="dbSNP:1251544571"
     variation       6563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:993105354"
     variation       6567
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369389555"
     variation       6568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166920584"
     variation       6576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352850425"
     variation       6580
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958921150"
     variation       6581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033977485"
     variation       6592
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1379811196"
     variation       6597
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190771773"
     variation       6598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283999952"
     variation       6602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355163745"
     variation       6604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184636639"
     variation       6605
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932231950"
     variation       6608
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315518394"
     variation       6610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197536154"
     variation       6611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902121924"
     variation       6618..6630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgg"
                     /replace="tggacaatgctgg"
                     /db_xref="dbSNP:1459050665"
     variation       6619
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040552971"
     variation       6623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:935522713"
     variation       6624
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775806600"
     variation       6656
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185090750"
     variation       6659
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28607477"
     variation       6665..6666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1421837047"
     variation       6665
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353688055"
     variation       6666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183800036"
     variation       6676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465138990"
     variation       6682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745869768"
     variation       6694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977133089"
     variation       6698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403025013"
     variation       6699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010509254"
     variation       6703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333849134"
     variation       6704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341461952"
     variation       6709
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450707160"
     variation       6711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947137345"
     variation       6724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241729587"
     variation       6726..6727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:545806821"
     variation       6735
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041248899"
     variation       6737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914219964"
     variation       6747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779066785"
     variation       6750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958635220"
     variation       6753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198672415"
     variation       6755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293953729"
     variation       6756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442784928"
     variation       6758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528588448"
     variation       6761
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981239338"
     variation       6776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961814928"
     variation       6781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014719480"
     variation       6795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194429299"
     variation       6797..6808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttttttttt"
                     /replace="tttttttttttt"
                     /replace="ttttttttttttt"
                     /db_xref="dbSNP:796588055"
     variation       6799
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1421607196"
     variation       6801
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972157827"
     variation       6808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78174670"
     variation       6809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77025671"
     variation       6811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051296"
     variation       6822
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296792898"
     variation       6824
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:720519"
     variation       6850
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566033667"
     variation       6854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175446538"
     variation       6855
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:917439953"
     variation       6861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399013563"
     variation       6863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278208399"
     variation       6864..6868
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:1269714214"
     variation       6866
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431723272"
     variation       6884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230522007"
     variation       6886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549118530"
     variation       6888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955459"
     variation       6889
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992916521"
     variation       6898
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345691533"
     variation       6899
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200655759"
ORIGIN      
gtcgacgtctgctgcccggggcccgcaggtggcaggcaggtggggctggtacagcccgcgccgcctctgctgcagccgctgccgtctactccttgcgcgctggcactccgcagcctttaaggttcgcgcgggggccaggcaagagttagccatgaagagcctcaagtcccgcctgaggaggcaggacgtgcccggccccgcgtcgtctggcgccgccgccgccagcgcgcatgcagcagattggaataaatatgatgaccgattgatgaaagcagcagaaaggggggatgtagaaaaagtgacctcaatccttgctaaaaagggggtcaatccaggcaaactagatgtggaaggcagatctgtcttccatgttgtgacctcaaaggggaatcttgagtgtttgaatgccatccttatacatggagttgatattacaaccagtgacactgcagggagaaatgctcttcacctggctgctaagtatggacatgcattgtgcctacaaaaacttctacagtacaattgtcccactgagcatgcagacctgcagggaagaactgcacttcacgatgccgcaatggcagattgtccttctagcatacagctgctttgtgaccatggggcctctgtgaatgccaaagatgtagacgggcggacaccacttgttctggctactcagatgagtaggccaacaatatgtcaactgctgatagatagaggagcggatgttaattccagagacaaacaaaacagaactgccctcatgctaggttgcgaatatggttgcagagatgcagtagaagtcttaattaaaaatggtgctgatataagcttgctggatgcgcttggccatgatagttcttactatgcaagaattggtgacaatctggacattctaaccttgttgaagactgcatcggaaaataccaacaaagggagagaactttggaagaaagggccatctttgcaacagcgaaatttgacacacatgcaagatgaagtaaatgtgaagtcacatcagagggagcatcaaaatattcaggatttggagattgaaaatgaagatttgaaagagaggttgagaaaaattcagcaagaacaaagaatacttttggataaagtcaatggtttacagttacagctgaatgaggaagttatggttgctgatgatctggaaagcgagagagaaaagctgaagtcccttttggcagctaaagaaaagcaacatgaagaaagcttaaggactattgaggctctgaaaaatagatttaaatattttgagagtgatcatttaggatcaggaagtcatttcagtaaccgaaaagaagatatgcttcttaaacaaggtcagatgtatatggcagactcacagtgtacttccccaggtataccagcccatatgcaaagcagatctatgttaagacctctggaactatctttacccagtcaaacgtcatactctgaaaatgaaattttaaagaaagagttagaagcaatgcgaactttctgtgagtcagcaaaacaagaccgactgaagctccaaaatgaactggcacacaaagtggcagaatgcaaagctttagcattagaatgtgaaagggtcaaggaggattcagatgaacagataaagcaattagaagatgcattaaaagatgtgcagaagaggatgtatgagtcagaaggtaaagttaaacaaatgcagacccattttcttgcccttaaagaacacttaacaagtgaagcagcctcagggaatcacagactaaccgaggaactgaaggatcagttgaaagacttgaaagtaaaatatgaaggtgcttcagcagaagtggggaaattaagaaaccaaatcaaacaaaatgagatgatagtagaagagtttaagagggatgaaggcaagctgatagaagaaaataagcgattacagaaggaacttagtatgtgtgaaatggagcgagagaagaaaggaagaaaggtcacagagatggaaggccaggcaaaagaattgtcagcgaagttggccctttccattccagctgaaaaatttgaaaacatgaagagctcattatcaaatgaagtgaatgagaaagcaaaaaaattagtagaaatggaaagagaacatgaaaaatcacttagtgaaattagacagttaaagagagaacttgagaatgttaaggccaagcttgctcagcacgtcaaaccagaggaacatgaacaggttaagagcagattagaacagaaatcaggagaacttgggaagaagatcactgagttaacattgaaaaatcagacactacaaaaggaaattgaaaaagtttatttggataataagctcctcaaggagcaagcacataacttaacaattgaaatgaaaaatcattatgttcctttaaaagtaagtgaagacatgaaaaagtcacatgatgcaattattgatgatcttaatagaaagcttttagatgtaacacaaaaatatacagaaaagaagttggaaatggagaaattgctactggaaaatgacagcttaagtaaggatgtaagccgcctagaaactgtgtttgtacctcctgagaaacatgaaaaagagataatagctctgaaatccaatattgttgaacttaagaaacagctgtctgaacttaagaaaaaatgtggtgaagaccaggagaaaatacacgctctcacatctgaaaacactaacttgaagaagatgatgagtaatcagtatgtgccagttaaaacccatgaagaggttaaaatgacactgaatgacacgttagccaaaactaacagagaattattagatgtgaagaaaaaatttgaagatataaatcaggaatttgtaaaaataaaagataagaatgaaatattaaaaagaaacctggaaaacactcagaaccaaataaaagctgagtacatcagcctggcagagcacgaggcaaagatgagctcgctaagtcagagcatgagaaaggtgcaggatagtaatgctgaaatcttggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaaagcccagaagaaggagctcgacacaatacaagaatgcattaaggtaaaatacgccccaattgtcagctttgaggagtgcgagagaaaatttaaagcaacagagaaagaactaaaagaccagttatcagagcagacacaaaagtatagtgtcagtgaagaagaagtcaagaaaaacaagcaagagaatgacaagttaaagaaggagatttttacccttcagaaagatttgagagataagacagttctcattgagaagtctcatgaaatggaaagagcattaagcagaaaaacagacgagctaaacaaacagttaaaagacttgtcacagaaatacacggaagtaaagaatgtgaaagagaagctagtagaagaaaatgccaaacagacttctgagatacttgcagtgcaaaatcttttgcaaaaacaacatgttccattggaacaggttgaggctctgaaaaaatctcttaatggcacaattgaaaatctaaaggaagaactgaagagtatgcaaaggtgttacgagaaagagcagcagacagtgaccaaactgcatcaattgttggagaatcaaaagaactcttctgtacccctggcagagcatttgcagattaaagaagcatttgagaaagaagttggaatcataaaagccagcttgagagaaaaggaagaagaaagccaaaacaaaatggaagaagtctccaaacttcagtcggaggttcagaatactaaacaagcattaaaaaaattagagactagagaggtagttgacttgtctaaatataaagcaacaaaaagtgatttggagacacagatttctagcttaaatgaaaaattggccaatctgaatagaaagtatgaggaagtatgtgaggaagttttgcatgccaaaaagaaggaaatatctgcaaaagatgagaaggaattactgcatttcagcattgagcaagaaattaaggatcagaaggaacgatgtgataagtccttaacaacaatcacagagttacaaagaagaatacaagaatctgctaaacaaatagaagcaaaagataataagataactgaactgcttaatgatgtggaaagattaaaacaggcactcaatggcctttcccaactcacctacacaagtgggaaccccaccaagaggcagagccagctgattgacactctgcagcaccaagtgaaatctctggagcaacagctggccgatgctgacagacagcaccaagaagtaattgcaatttatcggacacaccttcttagtgctgcacagggtcacatggatgaagatgttcaggaggctctgctccagatcatacaaatgcggcaggggcttgtgtgctagccgttagcactgactgccagtatctgttttatcttgctggtgctgaacattctttgtgcaactccatggtctttctgggccttactgtgctggtataattaaaataaaatatattttgttctattggtaggtttttttttaaaattagatgaatatgttagtctttttcaatatcagtttgaatcttattttctgtatgtgttaattttacaaataggcaaacaacataactttgccctggattgactacatatttttaaaccttcaagtccctaataaaacatgagccatctgagtgagtccatatgaagcgaggttaggctgaaataattgcttaaagatgtctttcagagaaattaatttggttggtggccacttttaggtggatcaaaagacctttcagatcctcagaaccttgagacataatacagttgtgaggaatgtgttgtaacttggctggccaagttacatgttacagtatctttactgaggtaacttcattagtgtctttggccttttttgtaggtatagatattttttctttttacactaataacttttatgccttttaaaataaatttattttcataaatggtttgcagtgctaaattacatttagattaagaacaggcaggggtggaatatatcaggaatttataataaaattgccttaatctctacaacagtatcttaatttttacttgcggtgactattcttgccacaatattggagaataatgatagatgatatactagatttttcaaagtgtgaaaacctttagactttttttagcaattagtttgacattcgctactatagtaaccaagcactcattatatatgcatcctccaaatgtttcatgcttatttataggaaagttatattaatgagattaataatgtgaaatacagttttcctgcaaaattagcattagagaattgattttagataacagatttttaaagttttagagaaaagtacagtaatacagtaaactgaaagagtatatagatagcaataaaataacataagtggacatgtttatagtaaatactctgaagtaaacaaccgtttttattaactgcatctcattagggaaagtttatatgtcttgttattttttattaacattttatttaccattcagagtgaaaattactaatttgagtattaacaaataactgaataaatggatcattacagttaggttttctcaaattgcaaaatttgccttagcaattatctttgaacatcccgaaccagatttttaaatcccatttttgtttaatagggtaaaaataccatcaaaatgacttctcataccaaagaataagccatcatattttttcggtgttgaaacaacattgaaagtcagaattggatttgtttttaattctttatacggtttacataagcaatatctgtctctttaattattatgattaatgtcgtccttcagcatgagttctgtttcacaagttttgggccacctatttcaataaaaaataaaatataaattaaaaaagttgccgggggtggtggctcatgcctgtaatcccagcactttgggaggctgagggaggtagatcacctgaggtcagaagttcgagaccagccttaccaatatggtgaagccccatctctactaaaaatacaaaaattagccctgcatggtggcaggtgcctgtagtcccaggtactcgggaggctgagacaggagaatcgcttgaacctgggaggcggaggttgcagtgagccaagatctcgccactgcactccagcttgggcaatagcaagactccatctcaaaataaaataaaataaaacttagagcaaagtttaaaactgagtattcatattaagtgttttattttccatattagagatgggaagggaaccttatgtgtattttattttgttttcaaccatcaataaagttttctctagaatattgttttgaacatccttgtaaaagatttgcgagttaaactattttatttactgtctgtgagagcattgggagtaggaaacgatggactccaaagtacaagggagaatacccattttcattcagctatctggagtaaaatatcaagtacttccttcaactaatcttgtctcattcactcaccttttgatatcgaaggcagaaattgcgtttacaacactgaagaccaaagctttttaattagtaaacaagcggaacatagataatggacaatgctggccactgccattctgtgttcagaaagactatgagacctgaacatatggccaagaggaaagaagagtgacgttgtctaagatgtaatgagtgctctctgagagaatcactcaattcctattggagtgcaatccttacttgagaactttattactcttgttctgtgtagttttttttttttgtcacttccccatcagaaaagcatattctttttgatagagggtcagtgttataaataattgtcttttgaaataaaatcaaatattcatgcattgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]