GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-09-18 19:26:12, GGRNA.v2 : RefSeq release 201 (Jul, 2020)

LOCUS       NM_017716               1167 bp    mRNA    linear   PRI 05-JUL-2020
DEFINITION  Homo sapiens membrane spanning 4-domains A12 (MS4A12), transcript
            variant 1, mRNA.
ACCESSION   NM_017716
VERSION     NM_017716.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1167)
  AUTHORS   He,L., Deng,H.Y. and C Wang,X.
  TITLE     Decreased expression of MS4A12 inhibits differentiation and
            predicts early stage survival in colon cancer
  JOURNAL   Neoplasma 64 (1), 65-73 (2017)
   PUBMED   27881006
  REMARK    GeneRIF: In early stage colon cancer, the patients with low MS4A12
            expression had a poor survival, while in advanced stage colon
            cancer MS412 had little prognostic value.
REFERENCE   2  (bases 1 to 1167)
  AUTHORS   Koslowski M, Tureci O, Huber C and Sahin U.
  TITLE     Selective activation of tumor growth-promoting Ca2+ channel MS4A12
            in colon cancer by caudal type homeobox transcription factor CDX2
  JOURNAL   Mol. Cancer 8, 77 (2009)
   PUBMED   19781065
  REMARK    GeneRIF: RNA interference of CDX1 and CDX2 and chromatin
            immunoprecipitation in colon cancer cells revealed that MS4A12
            transcript and protein expression is essentially dependent on the
            presence of endogenous CDX2.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1167)
  AUTHORS   Koslowski M, Sahin U, Dhaene K, Huber C and Tureci O.
  TITLE     MS4A12 is a colon-selective store-operated calcium channel
            promoting malignant cell processes
  JOURNAL   Cancer Res. 68 (9), 3458-3466 (2008)
   PUBMED   18451174
  REMARK    GeneRIF: MS4A12 is a colon-selective store-operated calcium channel
            promoting malignant cell processes.
            Erratum:[Cancer Res. 2008 Jun 15;68(12):4958]
REFERENCE   4  (bases 1 to 1167)
  AUTHORS   Liang Y, Buckley TR, Tu L, Langdon SD and Tedder TF.
  TITLE     Structural organization of the human MS4A gene cluster on
            Chromosome 11q12
  JOURNAL   Immunogenetics 53 (5), 357-368 (2001)
   PUBMED   11486273
REFERENCE   5  (bases 1 to 1167)
  AUTHORS   Liang Y and Tedder TF.
  TITLE     Identification of a CD20-, FcepsilonRIbeta-, and HTm4-related gene
            family: sixteen new MS4A family members expressed in human and
            mouse
  JOURNAL   Genomics 72 (2), 119-127 (2001)
   PUBMED   11401424
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP262076.1 and AK000224.1.
            On May 17, 2019 this sequence version replaced NM_017716.2.
            
            Summary: The protein encoded by this gene is a cell surface protein
            found primarily in the apical membrane of colonocytes. Silencing of
            this gene in colon cancer cells inhibits the proliferation, cell
            motility, and chemotactic invasion of cells. This gene is part of a
            cluster of similar genes found on chromosome 11. Two transcript
            variants encoding different isoforms have been found for this gene.
            [provided by RefSeq, Aug 2009].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK000224.1, BC029793.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1966682, SAMEA1968540
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000016913.8/ ENSP00000016913.4
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-414               BP262076.1         3-416
            415-1167            AK000224.1         415-1167
FEATURES             Location/Qualifiers
     source          1..1167
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..1167
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="membrane spanning 4-domains A12"
                     /db_xref="GeneID:54860"
                     /db_xref="HGNC:HGNC:13370"
                     /db_xref="MIM:606550"
     exon            1..51
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192351947"
     variation       6
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576198710"
     variation       8
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016790007"
     variation       13
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454691277"
     misc_feature    31..33
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="upstream in-frame stop codon"
     variation       31
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71488477"
     variation       33
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163212354"
     variation       36
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976255870"
     variation       39
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418608004"
     variation       40
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991255142"
     variation       47
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917088183"
     variation       48
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115937965"
     exon            52..333
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       52
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756467134"
     CDS             58..861
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="isoform 1 is encoded by transcript variant 1;
                     membrane-spanning 4-domains subfamily A member 12"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     12 isoform 1"
                     /protein_id="NP_060186.2"
                     /db_xref="CCDS:CCDS7988.1"
                     /db_xref="GeneID:54860"
                     /db_xref="HGNC:HGNC:13370"
                     /db_xref="MIM:606550"
                     /translation="
MMSSKPTSHAEVNETIPNPYPPSSFMAPGFQQPLGSINLENQAQGAQRAQPYGITSPGIFASSQPGQGNIQMINPSVGTAVMNFKEEAKALGVIQIMVGLMHIGFGIVLCLISFSFREVLGFASTAVIGGYPFWGGLSFIISGSLSVSASKELSRCLVKGSLGMNIVSSILAFIGVILLLVDMCINGVAGQDYWAVLSGKGISATLMIFSLLEFFVACATAHFANQANTTTNMSVLVIPNMYESNPVTPASSSAPPRCNNYSANAPK"
     misc_feature    325..720
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:309291"
     misc_feature    331..393
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NXJ0.2);
                     transmembrane region"
     misc_feature    418..480
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NXJ0.2);
                     transmembrane region"
     misc_feature    538..600
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NXJ0.2);
                     transmembrane region"
     misc_feature    658..720
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NXJ0.2);
                     transmembrane region"
     variation       60
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1252684298"
     variation       62
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466963594"
     variation       63
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195128504"
     variation       73
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1242587090"
     variation       80
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778124679"
     variation       83
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754017666"
     variation       84
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225706224"
     variation       85
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457543254"
     variation       86
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12788393"
     variation       92
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757377903"
     variation       94
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1327771401"
     variation       101
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461568056"
     variation       103
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1163741152"
     variation       105
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318571227"
     variation       106
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138899173"
     variation       107
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780090697"
     variation       108
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778749313"
     variation       110
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320728055"
     variation       112
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367773011"
     variation       115
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566039195"
     variation       117
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237273460"
     variation       118
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746776765"
     variation       119
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357430027"
     variation       129
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536385814"
     variation       130
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166856084"
     variation       132
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272742539"
     variation       133
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476442625"
     variation       136
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768355697"
     variation       137
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206636775"
     variation       139
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776245356"
     variation       141
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747699665"
     variation       144
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590859621"
     variation       145
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190923139"
     variation       147
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761750353"
     variation       150
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78557637"
     variation       151
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:370132588"
     variation       151
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760018313"
     variation       160
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767901392"
     variation       161
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775981038"
     variation       162
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1590859657"
     variation       164
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:556326036"
     variation       166
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324209869"
     variation       167
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:901841938"
     variation       171
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754071051"
     variation       175
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026503494"
     variation       180
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160589718"
     variation       181
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434470510"
     variation       185
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757436949"
     variation       187
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1400549241"
     variation       188
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296879315"
     variation       190
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377836379"
     variation       191
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972176383"
     variation       192
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765304283"
     variation       198
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147360952"
     variation       199
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137894801"
     variation       200
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545246635"
     variation       203
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:754835350"
     variation       204
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780842864"
     variation       207
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1214232115"
     variation       208
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747738624"
     variation       213
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2298552"
     variation       214
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775700798"
     variation       215
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772683966"
     variation       216
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480643121"
     variation       217
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420443215"
     variation       220
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182063794"
     variation       221
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775828292"
     variation       222
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143911504"
     variation       226..227
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1219707404"
     variation       227
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148561730"
     variation       228..230
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:778786975"
     variation       228
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201559362"
     variation       231
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777007836"
     variation       232
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537834442"
     variation       233
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765373308"
     variation       235
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1400144812"
     variation       241
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936582018"
     variation       242
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750578686"
     variation       243
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264631697"
     variation       244
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:574629951"
     variation       249
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758389107"
     variation       250..251
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:1350291380"
     variation       251
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374598941"
     variation       252..254
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1336419383"
     variation       252
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375239051"
     variation       254
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369153107"
     variation       258
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233489930"
     variation       260
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780895729"
     variation       266
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481324190"
     variation       268
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2298553"
     variation       275
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411022370"
     variation       280
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146116909"
     variation       281
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748869001"
     variation       282
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177094379"
     variation       285
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186155588"
     variation       288
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459596106"
     variation       289
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770305113"
     variation       290
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780726858"
     variation       293
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173560123"
     variation       296
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747462369"
     variation       298
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769148565"
     variation       302
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777203935"
     variation       303
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889178913"
     variation       306
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395992059"
     variation       311..319
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:1351950670"
     variation       315
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762075214"
     variation       316
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008737024"
     variation       320
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540180988"
     variation       324
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439979578"
     variation       325
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299062920"
     variation       326
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309234439"
     variation       328
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78337068"
     variation       331
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751500031"
     exon            334..471
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       334
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565204560"
     variation       336
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140200568"
     variation       337
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013735022"
     variation       339
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781773125"
     variation       341
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217004211"
     variation       345
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285899537"
     variation       346
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143892341"
     variation       355
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213057760"
     variation       362
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442728325"
     variation       363
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258317633"
     variation       364
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550483956"
     variation       365
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778062540"
     variation       368
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410492810"
     variation       371
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589223"
     variation       373
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867365250"
     variation       375
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157852910"
     variation       380
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546001592"
     variation       382
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436511664"
     variation       383
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590861648"
     variation       384
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771187436"
     variation       386
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151260783"
     variation       392
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371528920"
     variation       395
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373214880"
     variation       399
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404706838"
     variation       400
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398563254"
     variation       407
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299493410"
     variation       417
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033263732"
     variation       418
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772088969"
     variation       419
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175190309"
     variation       420
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201122448"
     variation       425
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309023758"
     variation       431
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546836504"
     variation       439
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565204620"
     variation       442..464
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="ggtgg"
                     /replace="ggtggatacccattctggggtgg"
                     /db_xref="dbSNP:770456857"
     variation       442
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237153780"
     variation       444
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891513801"
     variation       445
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764090100"
     variation       446
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139228899"
     variation       449
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761679169"
     variation       450
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150012278"
     variation       456
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758007560"
     variation       460
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765933255"
     variation       461
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751073407"
     variation       462
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1590861711"
     variation       465
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921248024"
     variation       466
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376941266"
     exon            472..528
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       475
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779180638"
     variation       483
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484694112"
     variation       488
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376865209"
     variation       489
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758679368"
     variation       495..499
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:769038765"
     variation       495
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780300796"
     variation       496
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370194824"
     variation       499
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768745030"
     variation       500
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288881477"
     variation       501
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334719730"
     variation       504
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911661661"
     variation       509
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271870796"
     variation       511
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781017742"
     variation       514
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750446764"
     variation       520
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200547614"
     variation       521
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111546873"
     variation       523
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1190907376"
     exon            529..645
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       529
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770710062"
     variation       536
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773888916"
     variation       538
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237852483"
     variation       544
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282472589"
     variation       554
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345072231"
     variation       556..562
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gtt"
                     /replace="gttagtt"
                     /db_xref="dbSNP:762144058"
     variation       556
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590863027"
     variation       558
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759159950"
     variation       559
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590863036"
     variation       561
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771617330"
     variation       568
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149091457"
     variation       572
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557717418"
     variation       581
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239183503"
     variation       586
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760157189"
     variation       589
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157377925"
     variation       591
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397467541"
     variation       598
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374195006"
     variation       602
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773669521"
     variation       604
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577537930"
     variation       605
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590863067"
     variation       608
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404377711"
     variation       612
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393377065"
     variation       614
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116528387"
     variation       621
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1375872571"
     variation       623
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444358113"
     variation       625..626
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1321800478"
     variation       626
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1365154827"
     variation       627
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305513054"
     variation       628
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780542886"
     variation       629
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751736928"
     variation       638
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755297132"
     variation       642
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771226235"
     variation       643
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767822239"
     variation       645
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198864842"
     exon            646..756
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       653
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452098521"
     variation       654..657
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:760725549"
     variation       655
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375256547"
     variation       656
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746610650"
     variation       658
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768161466"
     variation       660
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1457274616"
     variation       661
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565206128"
     variation       665
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291677898"
     variation       669
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178787516"
     variation       671
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147819793"
     variation       672
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141480500"
     variation       673
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297049192"
     variation       676
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337891485"
     variation       679
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771505319"
     variation       681
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313072224"
     variation       685
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774676964"
     variation       698
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1244582339"
     variation       702
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759965296"
     variation       703
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147008825"
     variation       704
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559899560"
     variation       707
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262585651"
     variation       714
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921249682"
     variation       716
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761043413"
     variation       717
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764397438"
     variation       718
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1590864682"
     variation       719
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423000621"
     variation       721
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573431813"
     variation       723..726
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:766426334"
     variation       725
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761768684"
     variation       727
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879204053"
     variation       737
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765251191"
     variation       738
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358073839"
     variation       741
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388484219"
     variation       742
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380617165"
     variation       743
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868687955"
     variation       744
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452299840"
     variation       749
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750280122"
     variation       750
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17852697"
     variation       751
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396800822"
     variation       752
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1286542708"
     variation       754
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779760931"
     variation       756
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378021469"
     exon            757..1167
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /inference="alignment:Splign:2.1.0"
     variation       759
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220974645"
     variation       762
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000885946"
     variation       763
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777213684"
     variation       776
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311741451"
     variation       779
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748792642"
     variation       780
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772755028"
     variation       782
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954156247"
     variation       784
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986828692"
     variation       786
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325382639"
     variation       788
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780675530"
     variation       791
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1590864945"
     variation       794
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747409283"
     variation       800
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768853841"
     variation       802
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191210210"
     variation       803
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961621774"
     variation       805
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776926656"
     variation       806
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748252951"
     variation       807
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59813271"
     variation       814
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773340421"
     variation       817
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466420382"
     variation       821
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920079485"
     variation       823
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770028029"
     variation       825
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248840884"
     variation       828
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353197104"
     variation       830
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439208171"
     variation       834
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763002323"
     variation       846
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:754928643"
     variation       851
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766347364"
     variation       852
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774220966"
     variation       856
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376989014"
     variation       859
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1318914376"
     variation       861
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197708518"
     variation       862
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255932271"
     variation       867
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453169491"
     variation       871
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222211165"
     variation       873
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767148279"
     variation       874
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565206377"
     variation       876
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927070929"
     variation       877
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752530922"
     variation       878
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276433368"
     variation       881
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195237590"
     variation       889
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755778298"
     variation       893
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977413948"
     variation       904
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2298559"
     variation       905
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201703923"
     variation       906
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373758551"
     variation       907
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780728976"
     variation       910
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747462337"
     variation       911..915
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1175201968"
     variation       911
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349833065"
     variation       913
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412430651"
     variation       914
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945951961"
     variation       918
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042976498"
     variation       919
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414309506"
     variation       922..928
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1173577778"
     variation       926
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537377916"
     variation       939
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556994577"
     variation       942
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:995980841"
     variation       947
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577132569"
     variation       948
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590865063"
     variation       950
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590865067"
     variation       969..973
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:933802438"
     variation       979
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328433128"
     variation       983
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028793998"
     variation       984
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050972536"
     variation       987
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444387860"
     variation       988
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908434105"
     variation       990
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749387747"
     variation       993
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532718489"
     variation       995
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349685963"
     variation       997
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008769580"
     variation       998
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549411971"
     variation       999
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376939564"
     variation       1002
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565206447"
     variation       1003
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773255438"
     variation       1010
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590865101"
     variation       1015
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539456128"
     variation       1028
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750463834"
     variation       1030
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445326159"
     variation       1045
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485922958"
     variation       1049
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055251913"
     variation       1064
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188517726"
     variation       1065
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378871217"
     variation       1072
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76519292"
     variation       1077
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440883692"
     variation       1078
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384657738"
     variation       1079
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542431954"
     variation       1081
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952821970"
     variation       1093
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562302627"
     variation       1096
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575828350"
     variation       1098
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766315783"
     variation       1102..1105
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="t"
                     /replace="tctt"
                     /db_xref="dbSNP:1446160611"
     variation       1108
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283657959"
     variation       1116
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448390714"
     variation       1117
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999299683"
     variation       1130
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980296875"
     variation       1134
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927492930"
     variation       1137
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957714593"
     variation       1139
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590865160"
     variation       1144
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:938435969"
     variation       1146
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776398868"
     variation       1151
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358983180"
     variation       1155
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300478541"
     variation       1156
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175906955"
ORIGIN      
acacaggttggagcagagaaagaggaaacatagaggtgccaaaggaacaaagacataatgatgtcatccaagccaacaagccatgctgaagtaaatgaaaccatacccaacccttacccaccaagcagctttatggctcctggatttcaacagcctctgggttcaatcaacttagaaaaccaagctcagggtgctcagcgtgctcagccctacggcatcacatctccgggaatctttgctagcagtcaaccgggtcaaggaaatatacaaatgataaatccaagtgtgggaacagcagtaatgaactttaaagaagaagcaaaggcactaggggtgatccagatcatggttggattgatgcacattggttttggaattgttttgtgtttaatatccttctcttttagagaagtattaggttttgcctctactgctgttattggtggatacccattctggggtggcctttcttttattatctctggctctctctctgtgtcagcatccaaggagctttcccgttgtctggtgaaaggcagcctgggaatgaacattgttagttctatcttggccttcattggagtgattctgctgctggtggatatgtgcatcaatggggtagctggccaagactactgggccgtgctttctggaaaaggcatttcagccacgctgatgatcttctccctcttggagttcttcgtagcttgtgccacagcccattttgccaaccaagcaaacaccacaaccaatatgtctgtcctggttattccaaatatgtatgaaagcaaccctgtgacaccagcgtcttcttcagctcctcccagatgcaacaactactcagctaatgcccctaaatagtaaaagaaaaaggggtatcagtctaatctcatggagaaaaactacttgcaaaaacttcttaagaagatgtcttttattgtctacaatgatttctagtctttaaaaactgtgtttgagatttgtttttaggttggtcgctaatgatggctgtatctcccttcactgtctcttcctacattaccactactacatgctggcaaaggtgaaggatcagaggactgaaaaatgattctgcaactctcttaaagttagaaatgtttctgttcatattactttttccttaataaaatgtcattagaaacaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]