GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:27:22, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_017339               1060 bp    mRNA    linear   ROD 25-DEC-2019
DEFINITION  Rattus norvegicus ISL LIM homeobox 1 (Isl1), mRNA.
ACCESSION   NM_017339
VERSION     NM_017339.3
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1060)
  AUTHORS   Sullivan KE, Burns LJ and Black LD 3rd.
  TITLE     An in vitro model for the assessment of stem cell fate following
            implantation within the infarct microenvironment identifies ISL-1
            expression as the strongest predictor of c-Kit(+) cardiac
            progenitor cells' therapeutic potential
  JOURNAL   J. Mol. Cell. Cardiol. 88, 91-100 (2015)
   PUBMED   26393440
  REMARK    GeneRIF: An in vitro model for the assessment of stem cell fate
            following implantation within the infarct microenvironment
            identifies ISL-1 expression as the strongest predictor of c-Kit(+)
            cardiac progenitor cells' therapeutic potential.
REFERENCE   2  (bases 1 to 1060)
  AUTHORS   Wu F, Kaczynski TJ, Sethuramanujam S, Li R, Jain V, Slaughter M and
            Mu X.
  TITLE     Two transcription factors, Pou4f2 and Isl1, are sufficient to
            specify the retinal ganglion cell fate
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 112 (13), E1559-E1568 (2015)
   PUBMED   25775587
REFERENCE   3  (bases 1 to 1060)
  AUTHORS   Serinagaoglu Y, Pare J, Giovannini M and Cao X.
  TITLE     Nf2-Yap signaling controls the expansion of DRG progenitors and
            glia during DRG development
  JOURNAL   Dev. Biol. 398 (1), 97-109 (2015)
   PUBMED   25433207
REFERENCE   4  (bases 1 to 1060)
  AUTHORS   Vincent SD, Mayeuf-Louchart A, Watanabe Y, Brzezinski JA 4th,
            Miyagawa-Tomita S, Kelly RG and Buckingham M.
  TITLE     Prdm1 functions in the mesoderm of the second heart field, where it
            interacts genetically with Tbx1, during outflow tract morphogenesis
            in the mouse embryo
  JOURNAL   Hum. Mol. Genet. 23 (19), 5087-5101 (2014)
   PUBMED   24821700
REFERENCE   5  (bases 1 to 1060)
  AUTHORS   Li R, Wu F, Ruonala R, Sapkota D, Hu Z and Mu X.
  TITLE     Isl1 and Pou4f2 form a complex to regulate target genes in
            developing retinal ganglion cells
  JOURNAL   PLoS ONE 9 (3), e92105 (2014)
   PUBMED   24643061
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1060)
  AUTHORS   Ahlgren U, Pfaff SL, Jessell TM, Edlund T and Edlund H.
  TITLE     Independent requirement for ISL1 in formation of pancreatic
            mesenchyme and islet cells
  JOURNAL   Nature 385 (6613), 257-260 (1997)
   PUBMED   9000074
REFERENCE   7  (bases 1 to 1060)
  AUTHORS   Pfaff SL, Mendelsohn M, Stewart CL, Edlund T and Jessell TM.
  TITLE     Requirement for LIM homeobox gene Isl1 in motor neuron generation
            reveals a motor neuron-dependent step in interneuron
            differentiation
  JOURNAL   Cell 84 (2), 309-320 (1996)
   PUBMED   8565076
REFERENCE   8  (bases 1 to 1060)
  AUTHORS   Wang M and Drucker DJ.
  TITLE     The LIM domain homeobox gene isl-1 is a positive regulator of islet
            cell-specific proglucagon gene transcription
  JOURNAL   J. Biol. Chem. 270 (21), 12646-12652 (1995)
   PUBMED   7759514
REFERENCE   9  (bases 1 to 1060)
  AUTHORS   Wang M and Drucker DJ.
  TITLE     The LIM domain homeobox gene isl-1: conservation of human, hamster,
            and rat complementary deoxyribonucleic acid sequences and
            expression in cell types of nonneuroendocrine lineage
  JOURNAL   Endocrinology 134 (3), 1416-1422 (1994)
   PUBMED   7907017
REFERENCE   10 (bases 1 to 1060)
  AUTHORS   Karlsson O, Thor S, Norberg T, Ohlsson H and Edlund T.
  TITLE     Insulin gene enhancer binding protein Isl-1 is a member of a novel
            class of proteins containing both a homeo- and a Cys-His domain
  JOURNAL   Nature 344 (6269), 879-882 (1990)
   PUBMED   1691825
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from S69329.1.
            On Apr 28, 2006 this sequence version replaced NM_017339.2.
            
            Summary: transcription factor; may regulate insulin gene expression
            or islet cell development [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S69329.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00052296 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1060
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="2"
                     /map="2q14"
     gene            1..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="ISL LIM homeobox 1"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
     exon            1..33
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
     CDS             6..1055
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="islet-1; isl-1 homeobox; ISL1 transcription factor,
                     LIM/homeodomain 1; ISL1 transcription factor
                     LIM/homeodomain (islet-1)"
                     /codon_start=1
                     /product="insulin gene enhancer protein ISL-1"
                     /protein_id="NP_059035.3"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
                     /translation="
MGDMGDPPKKKRLISLCVGCGNQIHDQYILRVSPDLEWHAACLKCAECNQYLDESCTCFVRDGKTYCKRDYIRLYGIKCAKCSIGFSKNDFVMRARSKVYHIECFRCVACSRQLIPGDEFALREDGLFCRADHDVVERASLGAGDPLSPLHPARPLQMAAEPISARQPALRPHVHKQPEKTTRVRTVLNEKQLHTLRTCYAANPRPDALMKEQLVEMTGLSPRVIRVWFQNKRCKDKKRSIMMKQLQQQQPNDKTNIQGMTGTPMVAASPERHDGGLQANPVEVQSYQPPWKVLSDFALQSDIDQPAFQQLVNFSEGGPGSNSTGSEVASMSSQLPDTPNSMVASPIEA"
     misc_feature    54..218
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The first LIM domain of Isl, a member of LHX
                     protein family; Region: LIM1_Isl; cd09366"
                     /db_xref="CDD:188752"
     misc_feature    order(54..56,63..65,120..122,129..131,138..140,147..149,
                     204..206,213..215)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188752"
     misc_feature    240..404
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The second LIM domain of Isl, a member of LHX
                     protein family; Region: LIM2_Isl; cd09374"
                     /db_xref="CDD:188760"
     misc_feature    order(240..242,249..251,306..308,315..317,324..326,
                     333..335,390..392,399..401)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188760"
     misc_feature    546..716
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(552..563,567..569,618..620,636..638,675..677,
                     681..686,693..698,702..710,714..719)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(555..557,564..566,684..686,693..698,705..707)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    789..878
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P61374.1);
                     Region: LIM-binding domain (LID). {ECO:0000250}"
     exon            34..223
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
     exon            224..483
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
     exon            484..770
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
     exon            771..938
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
     exon            939..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.0.8"
ORIGIN      
cagatatgggagacatgggcgatccaccaaaaaaaaaacgtctgatttccctatgtgttggttgcggtaatcaaattcacgatcagtatattctgagggtttctccggatttggaatggcatgcggcatgtttgaaatgtgcggagtgtaatcagtatttggacgaaagctgtacctgctttgttagggacgggaaaacctactgtaaaagagattatatcaggttgtacgggatcaaatgcgccaagtgcagcataggcttcagcaagaacgacttcgtgatgcgcgcccgctctaaggtgtaccacatcgaatgtttccgctgtgtagcatgcagccgacagctcatcccgggagacgaattcgcgctgcgggaggatgggcttttctgccgcgcggaccacgatgtagtggagagggccagcctaggagctggagaccctctcagtcccttgcatccagcgcggcctctgcaaatggcagccgagcccatctccgctaggcagccagctctgcggccgcacgtccacaaacagcccgagaagaccacccgagtgcggactgtgctcaacgaaaagcagctgcacaccttgcggacctgctacgcagccaaccctcggccagatgcgctcatgaaggagcaactagtggagatgaccggcctcagtccccgagtcatccgggtctggtttcaaaacaagaggtgcaaggacaagaaacgcagcatcatgatgaagcagctccagcagcagcaacccaacgacaaaactaatatccaggggatgacaggaactcccatggtggctgctagtccggagagacatgatggtggtttacaggctaacccagttgaggtgcaaagttaccagccgccctggaaagtactgagtgacttcgccttgcaaagtgacatagatcagcctgcttttcagcaactggtcaatttttcagaaggaggaccaggctctaattccactggcagtgaagtagcatcgatgtcctctcagctcccagatacacccaacagcatggtagccagtcctatagaggcatgaggaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]