GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-15 17:39:22, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_017339               1060 bp    mRNA    linear   ROD 23-JUN-2025
DEFINITION  Rattus norvegicus ISL LIM homeobox 1 (Isl1), mRNA.
ACCESSION   NM_017339
VERSION     NM_017339.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1060)
  AUTHORS   Zhang,J., Zhang,R., Liu,C., Ge,X., Wang,Y., Jiang,F., Zhuang,L.,
            Li,T., Zhu,Q., Jiang,Y., Chen,Y., Lu,M., Wang,Y., Jiang,M., Liu,Y.
            and Liu,L.
  TITLE     Missense mutation of ISL1 (E283D) is associated with the
            development of type 2 diabetes
  JOURNAL   Diabetologia 67 (8), 1698-1713 (2024)
   PUBMED   38819467
  REMARK    GeneRIF: Missense mutation of ISL1 (E283D) is associated with the
            development of type 2 diabetes.
REFERENCE   2  (bases 1 to 1060)
  AUTHORS   Wu,S.H., Wang,X.H., Xu,Y.J., Gu,J.N., Yang,C.X., Qiao,Q., Guo,X.J.,
            Guo,Y.H., Qiu,X.B., Jiang,W.F. and Yang,Y.Q.
  TITLE     ISL1 loss-of-function variation causes familial atrial fibrillation
  JOURNAL   Eur J Med Genet 63 (11), 104029 (2020)
   PUBMED   32771629
REFERENCE   3  (bases 1 to 1060)
  AUTHORS   Sun,Q., Zeng,J., Liu,Y., Chen,J., Zeng,Q.C., Chen,Y.Q., Tu,L.L.,
            Chen,P., Yang,F. and Zhang,M.
  TITLE     microRNA-9 and -29a regulate the progression of diabetic peripheral
            neuropathy via ISL1-mediated sonic hedgehog signaling pathway
  JOURNAL   Aging (Albany NY) 12 (12), 11446-11465 (2020)
   PUBMED   32544883
REFERENCE   4  (bases 1 to 1060)
  AUTHORS   Liang,L., Su,W., Zhou,L., Cao,Y., Zhou,X., Liu,S., Zhao,Y.,
            Ding,X., Wang,Q. and Zhang,H.
  TITLE     Statin downregulation of miR-652-3p protects endothelium from
            dyslipidemia by promoting ISL1 expression
  JOURNAL   Metabolism 107, 154226 (2020)
   PUBMED   32277945
REFERENCE   5  (bases 1 to 1060)
  AUTHORS   Wang,Z., Song,H.M., Wang,F., Zhao,C.M., Huang,R.T., Xue,S.,
            Li,R.G., Qiu,X.B., Xu,Y.J., Liu,X.Y. and Yang,Y.Q.
  TITLE     A New ISL1 Loss-of-Function Mutation Predisposes to Congenital
            Double Outlet Right Ventricle
  JOURNAL   Int Heart J 60 (5), 1113-1122 (2019)
   PUBMED   31484864
REFERENCE   6  (bases 1 to 1060)
  AUTHORS   Ahlgren,U., Pfaff,S.L., Jessell,T.M., Edlund,T. and Edlund,H.
  TITLE     Independent requirement for ISL1 in formation of pancreatic
            mesenchyme and islet cells
  JOURNAL   Nature 385 (6613), 257-260 (1997)
   PUBMED   9000074
REFERENCE   7  (bases 1 to 1060)
  AUTHORS   Pfaff,S.L., Mendelsohn,M., Stewart,C.L., Edlund,T. and Jessell,T.M.
  TITLE     Requirement for LIM homeobox gene Isl1 in motor neuron generation
            reveals a motor neuron-dependent step in interneuron
            differentiation
  JOURNAL   Cell 84 (2), 309-320 (1996)
   PUBMED   8565076
REFERENCE   8  (bases 1 to 1060)
  AUTHORS   Wang,M. and Drucker,D.J.
  TITLE     The LIM domain homeobox gene isl-1 is a positive regulator of islet
            cell-specific proglucagon gene transcription
  JOURNAL   J Biol Chem 270 (21), 12646-12652 (1995)
   PUBMED   7759514
REFERENCE   9  (bases 1 to 1060)
  AUTHORS   Wang,M. and Drucker,D.J.
  TITLE     The LIM domain homeobox gene isl-1: conservation of human, hamster,
            and rat complementary deoxyribonucleic acid sequences and
            expression in cell types of nonneuroendocrine lineage
  JOURNAL   Endocrinology 134 (3), 1416-1422 (1994)
   PUBMED   7907017
REFERENCE   10 (bases 1 to 1060)
  AUTHORS   Karlsson,O., Thor,S., Norberg,T., Ohlsson,H. and Edlund,T.
  TITLE     Insulin gene enhancer binding protein Isl-1 is a member of a novel
            class of proteins containing both a homeo- and a Cys-His domain
  JOURNAL   Nature 344 (6269), 879-882 (1990)
   PUBMED   1691825
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from S69329.1.
            
            On Apr 28, 2006 this sequence version replaced NM_017339.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S69329.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760389 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1060
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="2"
                     /map="2q14"
     gene            1..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="ISL LIM homeobox 1"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
     exon            1..33
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     CDS             6..1055
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="islet-1; isl-1 homeobox; ISL1 transcription factor,
                     LIM/homeodomain 1; ISL1 transcription factor
                     LIM/homeodomain (islet-1)"
                     /codon_start=1
                     /product="insulin gene enhancer protein ISL-1"
                     /protein_id="NP_059035.3"
                     /db_xref="GeneID:64444"
                     /db_xref="RGD:61957"
                     /translation="
MGDMGDPPKKKRLISLCVGCGNQIHDQYILRVSPDLEWHAACLKCAECNQYLDESCTCFVRDGKTYCKRDYIRLYGIKCAKCSIGFSKNDFVMRARSKVYHIECFRCVACSRQLIPGDEFALREDGLFCRADHDVVERASLGAGDPLSPLHPARPLQMAAEPISARQPALRPHVHKQPEKTTRVRTVLNEKQLHTLRTCYAANPRPDALMKEQLVEMTGLSPRVIRVWFQNKRCKDKKRSIMMKQLQQQQPNDKTNIQGMTGTPMVAASPERHDGGLQANPVEVQSYQPPWKVLSDFALQSDIDQPAFQQLVNFSEGGPGSNSTGSEVASMSSQLPDTPNSMVASPIEA"
     misc_feature    54..218
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The first LIM domain of Isl, a member of LHX
                     protein family; Region: LIM1_Isl; cd09366"
                     /db_xref="CDD:188752"
     misc_feature    order(54..56,63..65,120..122,129..131,138..140,147..149,
                     204..206,213..215)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188752"
     misc_feature    240..404
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="The second LIM domain of Isl, a member of LHX
                     protein family; Region: LIM2_Isl; cd09374"
                     /db_xref="CDD:188760"
     misc_feature    order(240..242,249..251,306..308,315..317,324..326,
                     333..335,390..392,399..401)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188760"
     misc_feature    546..716
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(552..563,567..569,618..620,636..638,675..677,
                     681..686,693..698,702..710,714..719)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(555..557,564..566,684..686,693..698,705..707)
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    789..878
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="propagated from UniProtKB/Swiss-Prot (P61374.1);
                     Region: LIM-binding domain (LID). /evidence=ECO:0000250"
     misc_feature    939..1052
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /note="propagated from UniProtKB/Swiss-Prot (P61374.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            34..223
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            224..483
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            484..770
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            771..938
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
     exon            939..1060
                     /gene="Isl1"
                     /gene_synonym="Isl-1; isl-1=homeobox"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cagatatgggagacatgggcgatccaccaaaaaaaaaacgtctgatttccctatgtgttggttgcggtaatcaaattcacgatcagtatattctgagggtttctccggatttggaatggcatgcggcatgtttgaaatgtgcggagtgtaatcagtatttggacgaaagctgtacctgctttgttagggacgggaaaacctactgtaaaagagattatatcaggttgtacgggatcaaatgcgccaagtgcagcataggcttcagcaagaacgacttcgtgatgcgcgcccgctctaaggtgtaccacatcgaatgtttccgctgtgtagcatgcagccgacagctcatcccgggagacgaattcgcgctgcgggaggatgggcttttctgccgcgcggaccacgatgtagtggagagggccagcctaggagctggagaccctctcagtcccttgcatccagcgcggcctctgcaaatggcagccgagcccatctccgctaggcagccagctctgcggccgcacgtccacaaacagcccgagaagaccacccgagtgcggactgtgctcaacgaaaagcagctgcacaccttgcggacctgctacgcagccaaccctcggccagatgcgctcatgaaggagcaactagtggagatgaccggcctcagtccccgagtcatccgggtctggtttcaaaacaagaggtgcaaggacaagaaacgcagcatcatgatgaagcagctccagcagcagcaacccaacgacaaaactaatatccaggggatgacaggaactcccatggtggctgctagtccggagagacatgatggtggtttacaggctaacccagttgaggtgcaaagttaccagccgccctggaaagtactgagtgacttcgccttgcaaagtgacatagatcagcctgcttttcagcaactggtcaatttttcagaaggaggaccaggctctaattccactggcagtgaagtagcatcgatgtcctctcagctcccagatacacccaacagcatggtagccagtcctatagaggcatgaggaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]