GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:05:02, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_017149               2244 bp    mRNA    linear   ROD 23-SEP-2019
DEFINITION  Rattus norvegicus mesenchyme homeobox 2 (Meox2), mRNA.
ACCESSION   NM_017149
VERSION     NM_017149.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2244)
  AUTHORS   Liu P, Feng J, Kong F, Lu Q, Xu H, Meng J and Jiang Y.
  TITLE     Gax inhibits perivascular preadipocyte biofunction mediated by
            IGF-1 induced FAK/Pyk2 and ERK2 cooperative pathways
  JOURNAL   Cell. Signal. 26 (12), 3036-3045 (2014)
   PUBMED   25280940
  REMARK    GeneRIF: The present study was designed to investigate whether
            FAK/Pyk2 and ERK1/2 MAPK signaling pathways participate in
            Perivascular adipocyte functions, which is activated by
            insulin-like growth factor 1(IGF-1) and inhibited by Gax.
REFERENCE   2  (bases 1 to 2244)
  AUTHORS   Cunnington RH, Northcott JM, Ghavami S, Filomeno KL, Jahan F,
            Kavosh MS, Davies JJ, Wigle JT and Dixon IM.
  TITLE     The Ski-Zeb2-Meox2 pathway provides a novel mechanism for
            regulation of the cardiac myofibroblast phenotype
  JOURNAL   J. Cell. Sci. 127 (Pt 1), 40-49 (2014)
   PUBMED   24155330
  REMARK    GeneRIF: Ski modulates the cardiac myofibroblast phenotype and
            function through suppression of Zeb2 by upregulating the expression
            of Meox2.
REFERENCE   3  (bases 1 to 2244)
  AUTHORS   Rovelet-Lecrux A, Legallic S, Wallon D, Flaman JM, Martinaud O,
            Bombois S, Rollin-Sillaire A, Michon A, Le Ber I, Pariente J, Puel
            M, Paquet C, Croisile B, Thomas-Anterion C, Vercelletto M, Levy R,
            Frebourg T, Hannequin D and Campion D.
  CONSRTM   Investigators of the GMAJ project
  TITLE     A genome-wide study reveals rare CNVs exclusive to extreme
            phenotypes of Alzheimer disease
  JOURNAL   Eur. J. Hum. Genet. 20 (6), 613-617 (2012)
   PUBMED   22166940
REFERENCE   4  (bases 1 to 2244)
  AUTHORS   Douville JM, Cheung DY, Herbert KL, Moffatt T and Wigle JT.
  TITLE     Mechanisms of MEOX1 and MEOX2 regulation of the cyclin dependent
            kinase inhibitors p21 and p16 in vascular endothelial cells
  JOURNAL   PLoS ONE 6 (12), e29099 (2011)
   PUBMED   22206000
REFERENCE   5  (bases 1 to 2244)
  AUTHORS   Chen Y, Banda M, Speyer CL, Smith JS, Rabson AB and Gorski DH.
  TITLE     Regulation of the expression and activity of the antiangiogenic
            homeobox gene GAX/MEOX2 by ZEB2 and microRNA-221
  JOURNAL   Mol. Cell. Biol. 30 (15), 3902-3913 (2010)
   PUBMED   20516212
REFERENCE   6  (bases 1 to 2244)
  AUTHORS   Saito T, Itoh H, Yamashita J, Doi K, Chun TH, Tanaka T, Inoue M,
            Masatsugu K, Fukunaga Y, Sawada N, Sakaguchi S, Arai H, Tojo K,
            Tajima N, Hosoya T and Nakao K.
  TITLE     Angiotensin II suppresses growth arrest specific homeobox (Gax)
            expression via redox-sensitive mitogen-activated protein kinase
            (MAPK)
  JOURNAL   Regul. Pept. 127 (1-3), 159-167 (2005)
   PUBMED   15680482
  REMARK    GeneRIF: demonstrated that Ang II down-regulated Gax expression via
            redox-sensitive ERK1/2 activation in vascular smooth muscle cells
            [Gax]
REFERENCE   7  (bases 1 to 2244)
  AUTHORS   Mankoo BS, Skuntz S, Harrigan I, Grigorieva E, Candia A, Wright CV,
            Arnheiter H and Pachnis V.
  TITLE     The concerted action of Meox homeobox genes is required upstream of
            genetic pathways essential for the formation, patterning and
            differentiation of somites
  JOURNAL   Development 130 (19), 4655-4664 (2003)
   PUBMED   12925591
REFERENCE   8  (bases 1 to 2244)
  AUTHORS   Mankoo BS, Collins NS, Ashby P, Grigorieva E, Pevny LH, Candia A,
            Wright CV, Rigby PW and Pachnis V.
  TITLE     Mox2 is a component of the genetic hierarchy controlling limb
            muscle development
  JOURNAL   Nature 400 (6739), 69-73 (1999)
   PUBMED   10403250
REFERENCE   9  (bases 1 to 2244)
  AUTHORS   Quinn LM, Johnson BV, Nicholl J, Sutherland GR and Kalionis B.
  TITLE     Isolation and identification of homeobox genes from the human
            placenta including a novel member of the Distal-less family, DLX4
  JOURNAL   Gene 187 (1), 55-61 (1997)
   PUBMED   9073066
REFERENCE   10 (bases 1 to 2244)
  AUTHORS   Gorski DH, LePage DF, Patel CV, Copeland NG, Jenkins NA and Walsh
            K.
  TITLE     Molecular cloning of a diverged homeobox gene that is rapidly
            down-regulated during the G0/G1 transition in vascular smooth
            muscle cells
  JOURNAL   Mol. Cell. Biol. 13 (6), 3722-3733 (1993)
   PUBMED   8098844
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from Z17223.1.
            
            Summary: homeobox gene; may have a regulatory function in the
            G0-to-G1 transition of the cell cycle in vascular smooth muscle
            cells [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: Z17223.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2689596, SAMEA2689599
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2244
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="6"
                     /map="6q21"
     gene            1..2244
                     /gene="Meox2"
                     /note="mesenchyme homeobox 2"
                     /db_xref="GeneID:29279"
                     /db_xref="RGD:3079"
     misc_feature    182..184
                     /gene="Meox2"
                     /note="upstream in-frame stop codon"
     CDS             197..1108
                     /gene="Meox2"
                     /note="growth arrest-specific homeobox; mesenchyme homeo
                     box 2 (growth arrest-specific homeo box)"
                     /codon_start=1
                     /product="homeobox protein MOX-2"
                     /protein_id="NP_058845.1"
                     /db_xref="GeneID:29279"
                     /db_xref="RGD:3079"
                     /translation="
MEHPLFGCLRSPHATAQGLHPFSQSSLALHGRSDHMSYPELSTSSSSCIIAGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQSNWHLPQMSSPPSAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGSSTPTGAACAPRDYGRQALSPAEVEKRSGSKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAAAREKELVNVKKGTLLPSELSGIGAATLQQTGDSLANDDSRDSDHSSEHAHL"
     misc_feature    order(755..769,773..775,824..826,842..844,881..883,
                     887..892,899..904,908..916,920..925)
                     /gene="Meox2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(761..763,770..772,890..892,899..904,911..913)
                     /gene="Meox2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    764..922
                     /gene="Meox2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
ORIGIN      
gtcaagtgtttatacgtgcaggagactggccgctcggctcaggactgggattagcgggctctgctcaaacccgcgcggcttttacattaggagtgagtgggggagagtcctaggatttctagtgaaaagtgacagcgcttggtggactttgggaccttcgtgaagtcttctgcttggaagctgagacttgcatgccatggaacaccccctctttggctgcctgcgcagcccccacgccacagcgcaaggcttgcaccccttctcgcagtcttctctggccctccatggaagatctgaccacatgtcctaccccgaactctccacatcttcctcgtcttgcataatcgcgggataccccaatgaggagggcatgtttgccagccagcatcacagggggcaccaccaccaccaccaccaccaccatcaccaccaccagcagcagcagcaccaggctctgcaaagcaactggcacctcccgcagatgtcctccccgccaagcgcggcccggcacagcctttgcctgcagcctgattccggagggcccccggagctggggagcagccctccggtcctgtgctccaactcttctagcctgggctccagcaccccgaccggagccgcgtgcgcaccaagggattatggccgtcaagcgctgtcacccgcagaagtggagaagagaagtggcagcaaaagaaaaagcgacagttcagattcccaggaaggaaattacaagtcagaagtgaacagcaaacctaggaaggaaagaacagctttcaccaaagagcaaatcagagaacttgaggcagagttcgcccatcataactatctgaccagactgagaagatatgagatagcggtgaacctagacctcactgaaagacaggtgaaagtgtggttccagaacaggagaatgaagtggaagcgggtcaaggggggacaacaaggagctgcagcccgagaaaaggaactggtgaatgtgaaaaagggaacacttcttccatcagagctgtcaggaattggtgcagccaccctccagcagacaggggactcactagcaaatgacgacagtcgcgatagtgaccacagctctgagcacgcacacttatgatacatacagagaccagctccgttctcaggaaagcaccattgtgatggcaaatctcacccaaacatcgtttacatggcagatgactgtggcagtgttgcttaatataattaaacgcaggcatctcaagtctgtttctcatgattgatagaaggtttacactaagtgcctcttattgaagatgcttccacagtgaaattggagaaagtgaacatatctaaatatacttgttccttatatgacagagagggagatgaatgtttgctttggcttgcactgaaaattaaattgctaccaagagcaaactcggtaagacattttgactcaagttgtctccagagtgaagatgttatagaaatgctttgaacattccagttgtaccaggtcatgtgtgtgacactgggcaggtatttgcttttgcttgcactgaaacttaaactgctatcaagttaacccatgaaatagtttatcttgaacagccacagtgcctgaaatcaccaagtggatataaaatgaactgaaattctgtatatattactcctaagtcattttcctgtcttcactaattttagcaaatgcattcatattagctgatgaaaataggctttcccgtggacaaatgcagccagcttcttgtatttttatacatttttttgtcagtcagagacatcagtatgtgcttacttgtgttcaagtagaggaaatgcagtagagtctgataggacatattcttggtaccacagacaaaacaaatcttctgttgcattgactatcaactgctgcagatacattagagaacacacctagcccccctccagcctccctctgttatcgctcgaagacattagcgtcataggcaagtagttaccttgccaaatgagtcttgtgtggcagatgtctgattttgtatctttaaactgttaatggtatgtgtctgcttcagttaacagggaaaaagatttcttcctcattgtttatgatacaaaacccaagtgccaaacaaagctagttcttcaagggatagatgagaaactgaatgtctgacaagtagactcagcgaaaatacattatttttcagaggctgtgtattcatgcagtacaagtccttgtattttgtaaaaaaaaaagttaaataaatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]