GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 01:07:16, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_016932               2206 bp    mRNA    linear   PRI 25-JUL-2020
DEFINITION  Homo sapiens SIX homeobox 2 (SIX2), mRNA.
ACCESSION   NM_016932
VERSION     NM_016932.5
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2206)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   2  (bases 1 to 2206)
  AUTHORS   Wan ZH, Ma YH, Jiang TY, Lin YK, Shi YY, Tan YX, Dong LW and Wang
            HY.
  TITLE     Six2 is negatively correlated with prognosis and facilitates
            epithelial-mesenchymal transition via TGF-beta/Smad signal pathway
            in hepatocellular carcinoma
  JOURNAL   HBPD INT 18 (6), 525-531 (2019)
   PUBMED   31564506
  REMARK    GeneRIF: Elevated Six2 expression in hepatocellular carcinoma
            patients was associated with negative prognosis. Upregulated Six2
            promoted tumor growth and facilitated HCC metastasis via
            TGF-beta/Smad signal pathway.
REFERENCE   3  (bases 1 to 2206)
  AUTHORS   Cheng N, Li H, Han Y and Sun S.
  TITLE     Transcription factor Six2 induces a stem cell-like phenotype in
            renal cell carcinoma cells
  JOURNAL   FEBS Open Bio 9 (10), 1808-1816 (2019)
   PUBMED   31420918
  REMARK    GeneRIF: The six2 knockdown attenuated the stemness of Renal cell
            carcinoma (RCC) cells, which was evident by decreased spheroid
            formation ability and stemness marker (sox2 and nanog) expression.
REFERENCE   4  (bases 1 to 2206)
  AUTHORS   Wu Y, Song T, Liu M, He Q, Chen L, Liu Y, Ni D, Liu J, Hu Y, Gu Y,
            Li Q, Zhou Q and Xie Y.
  TITLE     PPARG Negatively Modulates Six2 in Tumor Formation of Clear Cell
            Renal Cell Carcinoma
  JOURNAL   DNA Cell Biol. 38 (7), 700-707 (2019)
   PUBMED   31090452
  REMARK    GeneRIF: Six2 expression negatively correlated with the overall
            survival of clear cell renal cell carcinoma patients.
REFERENCE   5  (bases 1 to 2206)
  AUTHORS   Rodas LM, Garcia-Herrera A, Ramirez Bajo M, Fernandez-Larrea C,
            Cibeira MT, Blasco M, Rosinol L, Sole M, Blade J, Campistol JM and
            Quintana LF.
  TITLE     Six-2 glomerular expression for the prediction of renal outcome in
            systemic amyloidosis
  JOURNAL   Amyloid 26 (sup1), 97-98 (2019)
   PUBMED   31343337
  REMARK    GeneRIF: Glomerular Six-2 deposits in renal biopsy should be
            validated in prospective series as a predictor of renal outcome in
            renal amyloidosis
REFERENCE   6  (bases 1 to 2206)
  AUTHORS   Weber S, Taylor JC, Winyard P, Baker KF, Sullivan-Brown J, Schild
            R, Knuppel T, Zurowska AM, Caldas-Alfonso A, Litwin M, Emre S,
            Ghiggeri GM, Bakkaloglu A, Mehls O, Antignac C, Network E, Schaefer
            F and Burdine RD.
  TITLE     SIX2 and BMP4 mutations associate with anomalous kidney development
  JOURNAL   J. Am. Soc. Nephrol. 19 (5), 891-903 (2008)
   PUBMED   18305125
  REMARK    GeneRIF: Defects in these proteins could affect kidney development
            at multiple stages, leading to the congenital anomalies observed in
            patients with renal hypodysplasia
REFERENCE   7  (bases 1 to 2206)
  AUTHORS   Buller C, Xu X, Marquis V, Schwanke R and Xu PX.
  TITLE     Molecular effects of Eya1 domain mutations causing organ defects in
            BOR syndrome
  JOURNAL   Hum. Mol. Genet. 10 (24), 2775-2781 (2001)
   PUBMED   11734542
REFERENCE   8  (bases 1 to 2206)
  AUTHORS   Boucher CA, Winchester CL, Hamilton GM, Winter AD, Johnson KJ and
            Bailey ME.
  TITLE     Structure, mapping and expression of the human gene encoding the
            homeodomain protein, SIX2
  JOURNAL   Gene 247 (1-2), 145-151 (2000)
   PUBMED   10773454
REFERENCE   9  (bases 1 to 2206)
  AUTHORS   Celli J, van Beusekom E, Hennekam RC, Gallardo ME, Smeets DF, de
            Cordoba SR, Innis JW, Frydman M, Konig R, Kingston H, Tolmie J,
            Govaerts LC, van Bokhoven H and Brunner HG.
  TITLE     Familial syndromic esophageal atresia maps to 2p23-p24
  JOURNAL   Am. J. Hum. Genet. 66 (2), 436-444 (2000)
   PUBMED   10677303
REFERENCE   10 (bases 1 to 2206)
  AUTHORS   Kawakami K, Ohto H, Takizawa T and Saito T.
  TITLE     Identification and expression of six family genes in mouse retina
  JOURNAL   FEBS Lett. 393 (2-3), 259-263 (1996)
   PUBMED   8814301
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC012354.11, AF332197.1,
            BC024033.2, AI697804.1 and AI299144.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 23, 2018 this sequence version replaced NM_016932.4.
            
            Summary: This gene is a member of the vertebrate gene family which
            encode proteins homologous to the Drosophila 'sine oculis' homeobox
            protein. The encoded protein is a transcription factor which, like
            other members of this gene family, may be involved in limb or eye
            development. [provided by RefSeq, Dec 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF332197.1, BC024033.2 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968540, SAMEA1968832
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000303077.7/ ENSP00000304502.6
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-49                AC012354.11        166978-167026       c
            50-995              AF332197.1         1-946
            996-1840            BC024033.2         927-1771
            1841-2185           AI697804.1         1-345               c
            2186-2203           AI299144.1         25-42               c
            2204-2206           AC012354.11        162756-162758       c
FEATURES             Location/Qualifiers
     source          1..2206
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2p21"
     gene            1..2206
                     /gene="SIX2"
                     /note="SIX homeobox 2"
                     /db_xref="GeneID:10736"
                     /db_xref="HGNC:HGNC:10888"
                     /db_xref="MIM:604994"
     exon            1..902
                     /gene="SIX2"
                     /inference="alignment:Splign:2.1.0"
     variation       1..5
                     /gene="SIX2"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:1375869578"
     variation       3
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455107641"
     variation       4
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1572650601"
     variation       7
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045695560"
     variation       9
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930329175"
     variation       11
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433695325"
     variation       12
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447429736"
     variation       15
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920220778"
     variation       16
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971697866"
     variation       19
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312949131"
     variation       24
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:940485146"
     variation       25
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911613497"
     variation       27
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572650575"
     variation       30
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987351627"
     variation       36
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:953308091"
     variation       37
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243947958"
     variation       46
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028930693"
     variation       47
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978637307"
     variation       48
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968047691"
     variation       50
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171945585"
     variation       51
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356973627"
     variation       52
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554687033"
     variation       54
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009566550"
     variation       56
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217829402"
     variation       59
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1454926060"
     variation       60
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318887551"
     variation       63
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365133933"
     variation       66
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:952310972"
     variation       69..77
                     /gene="SIX2"
                     /replace="gcgcggagc"
                     /replace="gcgcggagcgcgcggagc"
                     /db_xref="dbSNP:1043263252"
     variation       70
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024345714"
     variation       75
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487016006"
     variation       78
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866575066"
     variation       79
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233233594"
     variation       83
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329121680"
     variation       86
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264060486"
     variation       87
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462771515"
     variation       89
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206603957"
     variation       90
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003727325"
     variation       94
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486055146"
     variation       98
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1188260606"
     variation       99..100
                     /gene="SIX2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:905334308"
     variation       99
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284691975"
     variation       101
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216206080"
     variation       106..127
                     /gene="SIX2"
                     /replace="gggcttgggc"
                     /replace="gggcttgggcgagggcttgggc"
                     /db_xref="dbSNP:545280202"
     variation       110
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430996862"
     variation       113
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455275182"
     variation       125
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318996159"
     variation       129
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930932115"
     variation       137
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291201835"
     variation       140
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366105661"
     variation       143
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278370826"
     variation       145
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899422565"
     variation       149
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325954104"
     variation       151
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399879599"
     variation       160
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267718660"
     variation       163
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036010634"
     variation       173..174
                     /gene="SIX2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1350158299"
     variation       173
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462815960"
     variation       175
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317359533"
     variation       177
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217674744"
     variation       181
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199546125"
     variation       186
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471304683"
     variation       190
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158022244"
     variation       200
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302029250"
     variation       204
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940348081"
     variation       207
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911661330"
     variation       209
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408160169"
     variation       210
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535223850"
     variation       212
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178709571"
     variation       215
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987603924"
     variation       220
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931838952"
     variation       223
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347521795"
     variation       224
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:921728930"
     variation       227..242
                     /gene="SIX2"
                     /replace="cc"
                     /replace="ccagggggccagcccc"
                     /db_xref="dbSNP:1225272566"
     variation       229
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430509283"
     variation       230
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254573956"
     variation       234
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200210494"
     variation       239
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374246345"
     variation       241
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569522660"
     variation       243
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483882188"
     variation       246
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549628521"
     variation       248
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:563220941"
     variation       250
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196224151"
     variation       251
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:968660827"
     variation       253
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481819235"
     variation       255
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180815734"
     variation       258
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278270360"
     variation       259..260
                     /gene="SIX2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:913132667"
     variation       263
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533097092"
     variation       267
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1338311284"
     variation       270
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424400501"
     variation       273
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164841634"
     variation       274
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988166599"
     variation       276
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311783573"
     variation       280
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328201302"
     variation       282
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396348353"
     variation       284
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355362274"
     variation       286
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535238556"
     variation       287
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035129104"
     variation       292
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381827628"
     variation       295
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417923146"
     variation       297
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166544818"
     variation       299
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185453944"
     variation       300..307
                     /gene="SIX2"
                     /replace=""
                     /replace="ccggtgag"
                     /db_xref="dbSNP:1439285800"
     variation       301
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486519672"
     variation       302..327
                     /gene="SIX2"
                     /replace="gg"
                     /replace="ggtgagggcgcgcgcgggcgggcggg"
                     /db_xref="dbSNP:1205212671"
     variation       302
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474180228"
     variation       303
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1003996649"
     misc_feature    304..306
                     /gene="SIX2"
                     /note="upstream in-frame stop codon"
     variation       307
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182452020"
     variation       309..317
                     /gene="SIX2"
                     /replace="gcgcgcg"
                     /replace="gcgcgcgcg"
                     /db_xref="dbSNP:771892913"
     variation       311
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248189859"
     variation       314
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969590576"
     variation       315
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335789488"
     variation       316
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113836842"
     variation       317
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231607232"
     variation       320
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753012609"
     variation       321..323
                     /gene="SIX2"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1448154178"
     variation       321
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280592680"
     variation       326
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445022111"
     variation       328
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334315848"
     variation       330
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1328658014"
     variation       332
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445559796"
     variation       333
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394847488"
     variation       334
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374980680"
     variation       335
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755177564"
     variation       336
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036544667"
     variation       338
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412469861"
     variation       341
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766486968"
     CDS             343..1218
                     /gene="SIX2"
                     /note="sine oculis homeobox homolog 2"
                     /codon_start=1
                     /product="homeobox protein SIX2"
                     /protein_id="NP_058628.3"
                     /db_xref="CCDS:CCDS1822.1"
                     /db_xref="GeneID:10736"
                     /db_xref="HGNC:HGNC:10888"
                     /db_xref="MIM:604994"
                     /translation="
MSMLPTFGFTQEQVACVCEVLQQGGNIERLGRFLWSLPACEHLHKNESVLKAKAVVAFHRGNFRELYKILESHQFSPHNHAKLQQLWLKAHYIEAEKLRGRPLGAVGKYRVRRKFPLPRSIWDGEETSYCFKEKSRSVLREWYAHNPYPSPREKRELAEATGLTTTQVSNWFKNRRQRDRAAEAKERENNENSNSNSHNPLNGSGKSVLGSSEDEKTPSGTPDHSSSSPALLLSPPPPGLPSLHSLGHPPGPSAVPVPVPGGGGADPLQHHHGLQDSILNPMSANLVDLGS"
     misc_feature    367..696
                     /gene="SIX2"
                     /note="Transcriptional regulator, SIX1, N-terminal SD
                     domain; Region: SIX1_SD; pfam16878"
                     /db_xref="CDD:318970"
     misc_feature    727..882
                     /gene="SIX2"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(730..732,850..852,859..864,871..873)
                     /gene="SIX2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     variation       346
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471143290"
     variation       349
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760590442"
     variation       350
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572650296"
     variation       355
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773074130"
     variation       357
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767445560"
     variation       360
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761555251"
     variation       363
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774034314"
     variation       364
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451062432"
     variation       372
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285092172"
     variation       375
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225949527"
     variation       376
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349228254"
     variation       378
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279326999"
     variation       379
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235394611"
     variation       383
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768328129"
     variation       384
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748929534"
     variation       387
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201430813"
     variation       390
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745387244"
     variation       395
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348763009"
     variation       399
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778361827"
     variation       401
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402361886"
     variation       402
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278038835"
     variation       409
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382783878"
     variation       412
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759005649"
     variation       415
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748497053"
     variation       416
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779195505"
     variation       423
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755198683"
     variation       424
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461446076"
     variation       425
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477849344"
     variation       427
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754064188"
     variation       429
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218116448"
     variation       433
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445356095"
     variation       437
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572650203"
     variation       444
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780266512"
     variation       450
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756119100"
     variation       451
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193162317"
     variation       456
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750533239"
     variation       459
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350449982"
     variation       461
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170824168"
     variation       463
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767389980"
     variation       465
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004244007"
     variation       468
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141233412"
     variation       469
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142188105"
     variation       471
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432211155"
     variation       473
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761885079"
     variation       475
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762656667"
     variation       480
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435301297"
     variation       484
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318978237"
     variation       487
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377023303"
     variation       490
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162669421"
     variation       496
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328060990"
     variation       504
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171585184"
     variation       505
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775227612"
     variation       507
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420407308"
     variation       513
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371643533"
     variation       516
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759081313"
     variation       520
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772685693"
     variation       522
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189229819"
     variation       529
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748645065"
     variation       531
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476186900"
     variation       533
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541992883"
     variation       534
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768843368"
     variation       538
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749666764"
     variation       542
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308451126"
     variation       546
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1273204133"
     variation       547
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323853697"
     variation       549
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780209481"
     variation       552
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948792823"
     variation       555
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756350301"
     variation       564
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415307802"
     variation       567
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357359319"
     variation       569
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750476114"
     variation       570
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531931374"
     variation       571
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916070659"
     variation       572
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757211278"
     variation       580
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172750431"
     variation       583
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1408470316"
     variation       584
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422985242"
     variation       589
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751507324"
     variation       594
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924892477"
     variation       595
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11540435"
     variation       596
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476471051"
     variation       597
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255942874"
     variation       598
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372580849"
     variation       606
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764108669"
     variation       611
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481138422"
     variation       618..621
                     /gene="SIX2"
                     /replace="c"
                     /replace="catc"
                     /db_xref="dbSNP:1449178426"
     variation       619
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762591882"
     variation       622
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202091722"
     variation       624
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201197395"
     variation       625
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256860344"
     variation       627
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233289347"
     variation       630
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759311436"
     variation       632
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201927647"
     variation       633
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956734375"
     variation       634
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370882250"
     variation       640
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563107358"
     variation       643
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1373747192"
     variation       644
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474185385"
     variation       649
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760243444"
     variation       654
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387079577"
     variation       655
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403498689"
     variation       657
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444824729"
     variation       660
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399929699"
     variation       663
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148660332"
     variation       666
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546453073"
     variation       672
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415802630"
     variation       676
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164647831"
     variation       679
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558440805"
     variation       684
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200549810"
     variation       690
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410594313"
     variation       693
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175913242"
     variation       696
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457601978"
     variation       702
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237123333"
     variation       705
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213947892"
     variation       708
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469386806"
     variation       711
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263210272"
     variation       712
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243948703"
     variation       714
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:554460571"
     variation       717
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572649959"
     variation       720
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780441973"
     variation       725
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769968755"
     variation       737
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558440775"
     variation       741
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237609240"
     variation       742
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375897164"
     variation       747
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304382860"
     variation       753
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443425620"
     variation       754
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746152954"
     variation       763
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781233805"
     variation       765
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454756698"
     variation       771
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757228133"
     variation       772
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353506423"
     variation       773
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774627372"
     variation       774
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747117944"
     variation       775
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777532216"
     variation       781
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758383352"
     variation       783
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291660988"
     variation       785
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572649912"
     variation       793..796
                     /gene="SIX2"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1558440737"
     variation       794
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752521871"
     variation       795
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765167749"
     variation       796
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208795514"
     variation       797
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369994485"
     variation       799
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485912555"
     variation       808
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753606261"
     variation       814
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17856709"
     variation       816
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248702754"
     variation       818
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214390648"
     variation       819
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352666591"
     variation       820
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4143307"
     variation       821
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766057817"
     variation       824
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365366403"
     variation       825
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760060428"
     variation       827
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329630486"
     variation       828
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162921750"
     variation       833
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772796826"
     variation       834
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764482147"
     variation       836
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382789688"
     variation       837
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364194158"
     variation       842
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763491151"
     variation       844
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419665425"
     variation       847
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775827253"
     variation       849
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175981095"
     variation       852
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770200234"
     variation       856
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375503887"
     variation       864
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558440685"
     variation       866
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426004280"
     variation       879
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746242850"
     variation       880
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776652900"
     variation       881
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263265447"
     variation       883
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191384463"
     variation       885
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487951253"
     variation       886
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280768384"
     variation       888
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149963762"
     variation       889
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777958524"
     variation       896
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758241331"
     variation       898
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391568042"
     variation       901
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748167157"
     exon            903..2206
                     /gene="SIX2"
                     /inference="alignment:Splign:2.1.0"
     variation       907..912
                     /gene="SIX2"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:748324030"
     variation       907
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200344733"
     variation       910
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194969033"
     variation       911
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356335988"
     variation       912
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754121582"
     variation       913
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766837477"
     variation       916
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1241543297"
     variation       918
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760797511"
     variation       921
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400896843"
     variation       923
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572648555"
     variation       924
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306574028"
     variation       925
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773427889"
     variation       929
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200287647"
     variation       930
                     /gene="SIX2"
                     /replace="c"
                     /replace="ccccccc"
                     /db_xref="dbSNP:142902677"
     variation       931
                     /gene="SIX2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1325017131"
     variation       936
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403529250"
     variation       938
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761932667"
     variation       940
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389842225"
     variation       941
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768678682"
     variation       942
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749314865"
     variation       944
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779699277"
     variation       947
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301911629"
     variation       948
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1572648511"
     variation       950
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313834146"
     variation       951
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769572731"
     variation       953
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274235733"
     variation       954
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368466313"
     variation       955..956
                     /gene="SIX2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:781427073"
     variation       955
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780785395"
     variation       956..975
                     /gene="SIX2"
                     /replace="gc"
                     /replace="gcaagtcggtgttaggcagc"
                     /db_xref="dbSNP:754988977"
     variation       956
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353780152"
     variation       962
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756926148"
     variation       963
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142758861"
     variation       964
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190926704"
     variation       968
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777305156"
     variation       971
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755475328"
     variation       973
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351919311"
     variation       976
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285812583"
     variation       977
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375228554"
     variation       978
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371909390"
     variation       979
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276252658"
     variation       984
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1441777211"
     variation       985
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202035375"
     variation       987
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767822221"
     variation       989..998
                     /gene="SIX2"
                     /replace="agactccatc"
                     /replace="agactccatcagactccatc"
                     /db_xref="dbSNP:1558439864"
     variation       990
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762163556"
     variation       991
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199560829"
     variation       993
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358368001"
     variation       994
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267599390"
     variation       995
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267599389"
     variation       996
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1435570189"
     variation       998
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762954429"
     variation       999
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150846320"
     variation       1001
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368309754"
     variation       1003
                     /gene="SIX2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:751621252"
     variation       1004
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929368932"
     variation       1005
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899341905"
     variation       1006
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770541388"
     variation       1013
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572648392"
     variation       1019
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196438825"
     variation       1020
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1553342116"
     variation       1029
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746731462"
     variation       1030
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777256147"
     variation       1032
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938159059"
     variation       1033
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757871683"
     variation       1034
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747619226"
     variation       1036
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148356487"
     variation       1037
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374628970"
     variation       1042
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750781834"
     variation       1044
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572648360"
     variation       1045
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278334054"
     variation       1046
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143323460"
     variation       1047..1065
                     /gene="SIX2"
                     /replace="gccgccccctgggctgccg"
                     /replace="gccgccccctgggctgccgccccctgggctgccg"
                     /db_xref="dbSNP:1476883933"
     variation       1047
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146943650"
     variation       1048
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751772244"
     variation       1049
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372153489"
     variation       1051
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763047709"
     variation       1053
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572648338"
     variation       1055
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74473757"
     variation       1056
                     /gene="SIX2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1174176185"
     variation       1056
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78925885"
     variation       1057
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178977297"
     variation       1058
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368542610"
     variation       1062..1078
                     /gene="SIX2"
                     /replace="gccgtccctgcacagcc"
                     /replace="gccgtccctgcacagccgtccctgcacagcc"
                     /db_xref="dbSNP:1481942706"
     variation       1064
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147806994"
     variation       1065
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776407664"
     variation       1071
                     /gene="SIX2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1423461915"
     variation       1072
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955789502"
     variation       1073
                     /gene="SIX2"
                     /replace="a"
                     /replace="agga"
                     /db_xref="dbSNP:1189298257"
     variation       1075
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770774500"
     variation       1080
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748746905"
     variation       1081
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267599388"
     variation       1083
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1209865352"
     variation       1086
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1207562028"
     variation       1087
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772787033"
     variation       1091
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258142065"
     variation       1092
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771656233"
     variation       1093
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747669139"
     variation       1094
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558439771"
     variation       1095
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400875587"
     variation       1099
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558439766"
     variation       1101
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191828218"
     variation       1102
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756635283"
     variation       1103
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201764520"
     variation       1104
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781767774"
     variation       1105..1123
                     /gene="SIX2"
                     /replace="gtgccag"
                     /replace="gtgccagtgccggtgccag"
                     /db_xref="dbSNP:780245216"
     variation       1106
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140763514"
     variation       1109
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752002260"
     variation       1111
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764326435"
     variation       1113
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353037134"
     variation       1115
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373961258"
     variation       1116
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150988696"
     variation       1122
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166247596"
     variation       1123
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426126643"
     variation       1125
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371349704"
     variation       1126
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766312512"
     variation       1129
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182666595"
     variation       1131
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760424819"
     variation       1133
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146753226"
     variation       1134
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476728744"
     variation       1135
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771722023"
     variation       1136
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761435514"
     variation       1137
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76298925"
     variation       1138
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038178246"
     variation       1139
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323497287"
     variation       1140
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767993033"
     variation       1148
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227471715"
     variation       1149
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552099678"
     variation       1152
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938226527"
     variation       1155
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781749684"
     variation       1156
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399615363"
     variation       1157
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332096871"
     variation       1158
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905364797"
     variation       1160
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370231701"
     variation       1162
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459896408"
     variation       1164
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747357830"
     variation       1167
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200867142"
     variation       1168
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201675842"
     variation       1171
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752920874"
     variation       1172
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779212821"
     variation       1176
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437494866"
     variation       1177
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754988790"
     variation       1180
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751880162"
     variation       1181
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753952589"
     variation       1183
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156338487"
     variation       1186
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489182063"
     variation       1193
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766259257"
     variation       1195
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572648156"
     variation       1196
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544354787"
     variation       1197
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750226051"
     variation       1200
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767269171"
     variation       1201
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773807534"
     variation       1203
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421332463"
     variation       1205
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768385373"
     variation       1206
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278011609"
     variation       1208
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302254296"
     variation       1210
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388536611"
     variation       1214
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988414365"
     variation       1222
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762501206"
     variation       1224
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775188449"
     variation       1225
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362829026"
     variation       1226
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934304430"
     variation       1236
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277040930"
     variation       1237
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771534603"
     variation       1242
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211622314"
     variation       1243
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1419483689"
     variation       1255
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362798887"
     variation       1257
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377630153"
     variation       1260
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778187471"
     variation       1262
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889588075"
     variation       1263
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053608184"
     variation       1265
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772268991"
     variation       1266
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748554219"
     variation       1267
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778967739"
     variation       1268
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923861384"
     variation       1269
                     /gene="SIX2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1170749332"
     variation       1273
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978911179"
     variation       1274
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174929041"
     variation       1277
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964615164"
     variation       1278..1279
                     /gene="SIX2"
                     /replace="gg"
                     /replace="ggggg"
                     /db_xref="dbSNP:370801335"
     variation       1278
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149640128"
     variation       1280
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1572648084"
     variation       1281
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244478341"
     variation       1283
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327458294"
     variation       1285
                     /gene="SIX2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1382645360"
     variation       1290
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992839609"
     variation       1291
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551787454"
     variation       1293
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273600779"
     variation       1295
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558439542"
     variation       1296
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:954585720"
     variation       1301
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572648059"
     variation       1303
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034520440"
     variation       1304
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572648056"
     variation       1306
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282623527"
     variation       1308
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535011890"
     variation       1310
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572648051"
     variation       1313
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216246166"
     variation       1315
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285140111"
     variation       1316
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1572648044"
     variation       1318
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327844717"
     variation       1320
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:993541518"
     variation       1326
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448535237"
     variation       1328
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899153734"
     variation       1329
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016386689"
     variation       1330
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002658879"
     variation       1335
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378012195"
     variation       1339
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905376170"
     variation       1340
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386615006"
     variation       1342
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402835353"
     variation       1350
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161407477"
     variation       1351
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046518675"
     variation       1352
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385726088"
     variation       1353
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184292215"
     variation       1354
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239445839"
     variation       1356
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1572648009"
     variation       1358..1360
                     /gene="SIX2"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1558439497"
     variation       1360
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572648006"
     variation       1365
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261553188"
     variation       1374
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565977038"
     variation       1380..1388
                     /gene="SIX2"
                     /replace="gtt"
                     /replace="gttcttgtt"
                     /db_xref="dbSNP:1288943753"
     variation       1380
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208256820"
     variation       1386
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1572647992"
     variation       1404
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468743151"
     variation       1406
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892745927"
     variation       1408
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900799435"
     variation       1412
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1438561711"
     variation       1422
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231240255"
     variation       1429
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364993486"
     variation       1436
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549480240"
     variation       1439
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471632055"
     variation       1440
                     /gene="SIX2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1162269075"
     variation       1443
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390547054"
     variation       1452
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053105528"
     variation       1453
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006676401"
     variation       1461
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204155428"
     variation       1473
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438582273"
     variation       1475
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446172892"
     variation       1480
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572647967"
     variation       1485..1494
                     /gene="SIX2"
                     /replace="tctctc"
                     /replace="tctctctc"
                     /replace="tctctctctc"
                     /db_xref="dbSNP:1234850291"
     variation       1487
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61203820"
     variation       1490
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1242965817"
     variation       1494
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563791208"
     variation       1496..1499
                     /gene="SIX2"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1359362660"
     variation       1496
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572647951"
     variation       1502
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316261626"
     variation       1504
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558439431"
     variation       1507
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936504015"
     variation       1511
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902441582"
     variation       1512
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252119530"
     variation       1513..1514
                     /gene="SIX2"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1440191521"
     variation       1517
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186405824"
     variation       1521..1522
                     /gene="SIX2"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1418051994"
     variation       1523
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550756140"
     variation       1534
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167502902"
     variation       1535
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421896998"
     variation       1537
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530623156"
     variation       1540
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753012009"
     variation       1541
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278421692"
     variation       1547
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572647912"
     variation       1550
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442537119"
     variation       1560
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356290933"
     variation       1562
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371978004"
     variation       1563
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563778918"
     variation       1564
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545015870"
     variation       1565
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937451294"
     variation       1571..1576
                     /gene="SIX2"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1317053837"
     variation       1579
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228147435"
     variation       1580..1585
                     /gene="SIX2"
                     /replace="ct"
                     /replace="ctttct"
                     /db_xref="dbSNP:927369814"
     variation       1583..1589
                     /gene="SIX2"
                     /replace="tct"
                     /replace="tctgtct"
                     /db_xref="dbSNP:560138698"
     variation       1585
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572780563"
     variation       1586
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984268679"
     variation       1592
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987324522"
     variation       1594
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:954513960"
     variation       1596
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919209803"
     variation       1597
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257827796"
     variation       1600
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:972978295"
     variation       1601
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966003346"
     variation       1606
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759715907"
     variation       1614
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963410309"
     variation       1625
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376367697"
     variation       1629
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171739611"
     variation       1634
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417217218"
     variation       1638
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542236271"
     variation       1639
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867265685"
     variation       1644
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032064619"
     variation       1647
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001124272"
     variation       1651..1655
                     /gene="SIX2"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1558439356"
     variation       1652
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470650026"
     variation       1656
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296576915"
     variation       1657
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339600463"
     variation       1660
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776735982"
     variation       1664
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:902304080"
     variation       1665
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254172921"
     variation       1673
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:969420662"
     variation       1675..1679
                     /gene="SIX2"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1220721133"
     variation       1677..1681
                     /gene="SIX2"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:543337097"
     variation       1687
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572647828"
     variation       1689..1700
                     /gene="SIX2"
                     /replace="ctctc"
                     /replace="ctctcttctctc"
                     /db_xref="dbSNP:1224491039"
     variation       1689..1694
                     /gene="SIX2"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1013543149"
     variation       1699
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2290029"
     variation       1700
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349403100"
     variation       1701
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214088555"
     variation       1703
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1013737980"
     variation       1705
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937315559"
     variation       1712
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892629854"
     variation       1717
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1572647808"
     variation       1720..1724
                     /gene="SIX2"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:1264260785"
     variation       1720
                     /gene="SIX2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1282980933"
     variation       1729
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369709057"
     variation       1732
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223806666"
     variation       1735
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395836732"
     variation       1736
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1351955762"
     variation       1737
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052743031"
     variation       1740
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760603263"
     variation       1743..1744
                     /gene="SIX2"
                     /replace="ac"
                     /replace="acac"
                     /db_xref="dbSNP:1403939113"
     variation       1743
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572647789"
     variation       1747..1748
                     /gene="SIX2"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:150971507"
     variation       1748
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345970516"
     variation       1754
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365198497"
     variation       1755
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295042211"
     variation       1766
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77492481"
     variation       1770
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304067119"
     variation       1771
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372547829"
     variation       1773
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344489445"
     variation       1783..1786
                     /gene="SIX2"
                     /replace="c"
                     /replace="ctac"
                     /db_xref="dbSNP:1572647764"
     variation       1790
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904197908"
     variation       1791
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572647749"
     variation       1792
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401287298"
     variation       1798
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308111988"
     variation       1799
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043087734"
     variation       1801
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414268068"
     variation       1803
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1197603581"
     variation       1805
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048427800"
     variation       1806
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480219064"
     variation       1808
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942997245"
     variation       1812..1816
                     /gene="SIX2"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:931484268"
     variation       1818
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918794201"
     variation       1829
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254109565"
     variation       1835..1840
                     /gene="SIX2"
                     /replace="a"
                     /replace="agaaaa"
                     /db_xref="dbSNP:1572647699"
     variation       1841..1842
                     /gene="SIX2"
                     /replace=""
                     /replace="ttag"
                     /db_xref="dbSNP:965680025"
     variation       1841
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2290030"
     variation       1844
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912803911"
     variation       1845
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576383890"
     variation       1846
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985137336"
     variation       1847
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182325607"
     variation       1853
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953668789"
     variation       1860
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032096705"
     variation       1861
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572647669"
     variation       1864
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541416230"
     variation       1871
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966859968"
     variation       1877..1880
                     /gene="SIX2"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:751291798"
     variation       1883
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443978582"
     variation       1885
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747914560"
     variation       1886
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919043710"
     variation       1888
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225180677"
     variation       1893
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310048511"
     variation       1894
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566401400"
     variation       1907
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:963595066"
     variation       1912
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558439231"
     variation       1913
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1572647656"
     variation       1922
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774012414"
     variation       1926
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909231612"
     variation       1931
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:980763721"
     variation       1933
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1197279369"
     variation       1934
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232434132"
     variation       1937..1938
                     /gene="SIX2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:760856738"
     variation       1938..1943
                     /gene="SIX2"
                     /replace="a"
                     /replace="aagtga"
                     /db_xref="dbSNP:1179177970"
     variation       1944
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558439215"
     variation       1948
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1054944033"
     variation       1952
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474773255"
     variation       1953
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165333050"
     variation       1954
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969348883"
     variation       1959
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:80289874"
     variation       1965
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328093899"
     variation       1968
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354614380"
     variation       1969
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535861305"
     variation       1974
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905839922"
     variation       1976
                     /gene="SIX2"
                     /replace="a"
                     /replace="atta"
                     /db_xref="dbSNP:1294343348"
     variation       1977
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570118117"
     variation       1978
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213400640"
     variation       1981
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272842003"
     variation       1982..2004
                     /gene="SIX2"
                     /replace="cct"
                     /replace="cctcgtcatacgcccctcctcct"
                     /db_xref="dbSNP:1374297673"
     variation       1982..1999
                     /gene="SIX2"
                     /replace="cctc"
                     /replace="cctcgtcatacgcccctc"
                     /db_xref="dbSNP:1411183078"
     variation       1983
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1308169729"
     variation       1985
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361185618"
     variation       1986
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235981177"
     variation       1988
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112423728"
     variation       1992
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77956519"
     variation       1993
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530722485"
     variation       1996..2004
                     /gene="SIX2"
                     /replace="cctcct"
                     /replace="cctcctcct"
                     /db_xref="dbSNP:1435012573"
     variation       1996
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390982995"
     variation       1997
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018514277"
     variation       2001
                     /gene="SIX2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1173391978"
     variation       2003..2007
                     /gene="SIX2"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1357765727"
     variation       2005
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314328091"
     variation       2008
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1007265379"
     variation       2009
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174326067"
     variation       2013..2014
                     /gene="SIX2"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1363229259"
     variation       2016
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469509496"
     variation       2019
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:960840340"
     variation       2024
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564968120"
     variation       2026..2030
                     /gene="SIX2"
                     /replace="cac"
                     /replace="cacac"
                     /db_xref="dbSNP:912836008"
     variation       2028
                     /gene="SIX2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1378373658"
     variation       2028
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944157748"
     variation       2031..2035
                     /gene="SIX2"
                     /replace="cgcgc"
                     /replace="cgcgcgc"
                     /db_xref="dbSNP:1476378907"
     variation       2031
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369025364"
     variation       2032
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:888780857"
     variation       2033
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051512760"
     variation       2034
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242455822"
     variation       2045
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933020381"
     variation       2054
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1572647552"
     variation       2060
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394022009"
     variation       2068
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897669398"
     variation       2069
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434726981"
     variation       2070
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175143966"
     variation       2076
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358184460"
     variation       2078
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985670004"
     variation       2079
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036579508"
     variation       2080..2085
                     /gene="SIX2"
                     /replace="ccccc"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1261453257"
     variation       2084
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941853958"
     variation       2085
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909152479"
     variation       2088
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235046612"
     variation       2091
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932313110"
     variation       2093
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980649322"
     variation       2094
                     /gene="SIX2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1284764801"
     variation       2094
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204750628"
     variation       2095
                     /gene="SIX2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448516603"
     variation       2099
                     /gene="SIX2"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1466616697"
     variation       2101
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240765994"
     variation       2102
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748751565"
     variation       2104
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252237131"
     variation       2106
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454353211"
     variation       2109
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190846424"
     variation       2115
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368144979"
     variation       2123
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956978159"
     variation       2129
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469357200"
     variation       2132
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158777989"
     variation       2136
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031189106"
     variation       2141
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979489379"
     variation       2149
                     /gene="SIX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:980036426"
     variation       2150
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:878866616"
     variation       2152
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018981666"
     variation       2158
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559236812"
     variation       2161
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542175339"
     variation       2167
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1572647483"
     variation       2170
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394336237"
     variation       2172
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021095615"
     variation       2173..2175
                     /gene="SIX2"
                     /replace="aaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:573717307"
     variation       2176
                     /gene="SIX2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888789102"
     variation       2186
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029971434"
     variation       2189
                     /gene="SIX2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033566925"
     variation       2200
                     /gene="SIX2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773144593"
     variation       2204
                     /gene="SIX2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352591037"
ORIGIN      
aagaaagctgagagccagctagacgggagggagaacgagtgagaagcgagcgagggaacggcgggcgggcgcggagcatgcggagcggcgccccgggcggcccccgggcttgggcgagggcttgggccaggcgcgcgggccgttggggttcggagcttcgtgggacccgcggccggcgcggggacgtacggcagtgactcggggctcaccgggggccagtgccgggccagggggccagccccgcccgcgtctcggcccggacggcccggcgaggaagctcccatgcgggaccgcgcggcccggtgagggcgcgcgcgggcgggcggggacgcagccggcaccatgtccatgctgcccaccttcggcttcacgcaggagcaagtggcgtgcgtgtgcgaggtgctgcagcagggcggcaacatcgagcggctgggccgcttcctgtggtcgctgcccgcctgcgagcaccttcacaagaatgaaagcgtgctcaaggccaaggccgtggtggccttccaccgcggcaacttccgcgagctctacaagatcctggagagccaccagttctcgccgcacaaccacgccaagctgcagcagctgtggctcaaggcacactacatcgaggcggagaagctgcgcggccgacccctgggcgccgtgggcaaataccgcgtgcgccgcaaattcccgctgccgcgctccatctgggacggcgaggagaccagctactgcttcaaggaaaagagtcgcagcgtgctgcgcgagtggtacgcgcacaacccctacccttcaccccgcgagaagcgtgagctggcggaggccacgggcctcaccaccacacaggtcagcaactggttcaagaaccggcggcagcgcgaccgggcggccgaggccaaggaaagggagaacaacgagaactccaattctaacagccacaacccgctgaatggcagcggcaagtcggtgttaggcagctcggaggatgagaagactccatcggggacgccagaccactcatcatccagccccgcactgctcctcagcccgccgccccctgggctgccgtccctgcacagcctgggccaccctccgggccccagcgcagtgccagtgccggtgccaggcggaggtggagcggacccactgcaacaccaccatggcctgcaggactccatcctcaaccccatgtcagccaacctcgtggacctgggctcctagaacccatttgccttgatgagcttgccttttgtgacttgacactggggacgtggagtggcggtgtccaggggcgccccgcccctgcggccccaccaggtactgaaagacccgcaggctgagcgggtagaacagccgggtagggcagatagctgtctatgttggttcttgtttgggatttattttcaacaagttacttttaggatccttttggggctggagactgagtcttgaaccacagaagggaataaattatacaccactgtcattctctctctccctctgtctcttccttttaccctctcttgtcttgccttttccccctttcctcttcctttcccttccttctcttttcttttttctgctttctgtctttctccctctccttgtattgctttccttctagatttctagcttgccaccgttcattctctccttctgtctctccctttctctctccttctctgtttctcctctcttctctcctgccagtctcttgtactctgtgtcctggtccctccgtatgtacccctgtctttctcctcctgactggtggtctatctgcccctacctctggccctcgctttaccggagtagggggtgggagagggaagaggagagaaaatacagggactttgaacctaggccatctcctgaggccttttccctcgcccatgtgggtcagtgggagctgcaggtgtcagcttttcgtctagtaacttaagtgagagagaaagggcagcgccacagaagcccctaaacgccgcctcgtcatacgcccctcctccttctctcttggcgaggccccgccacaccgcgctcttcctcccgggactgtgactacagcgctcccggctgagcgcgccccccgagccgccgacttgccgtctccccgtaatgccctcatgtgaatgttcttcgggaaatatttctgcttttattttataataaaattagaaatcataaatatataaatggttatatgccacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]