GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 14:30:30, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_013109               1229 bp    mRNA    linear   ROD 22-JUN-2021
DEFINITION  Rattus norvegicus orthodenticle homeobox 1 (Otx1), mRNA.
ACCESSION   NM_013109
VERSION     NM_013109.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1229)
  AUTHORS   Sakurai Y, Kurokawa D, Kiyonari H, Kajikawa E, Suda Y and Aizawa S.
  TITLE     Otx2 and Otx1 protect diencephalon and mesencephalon from
            caudalization into metencephalon during early brain regionalization
  JOURNAL   Dev Biol 347 (2), 392-403 (2010)
   PUBMED   20816794
REFERENCE   2  (bases 1 to 1229)
  AUTHORS   Esumi N, Kachi S, Hackler L Jr, Masuda T, Yang Z, Campochiaro PA
            and Zack DJ.
  TITLE     BEST1 expression in the retinal pigment epithelium is modulated by
            OTX family members
  JOURNAL   Hum Mol Genet 18 (1), 128-141 (2009)
   PUBMED   18849347
REFERENCE   3  (bases 1 to 1229)
  AUTHORS   Kimura J, Suda Y, Kurokawa D, Hossain ZM, Nakamura M, Takahashi M,
            Hara A and Aizawa S.
  TITLE     Emx2 and Pax6 function in cooperation with Otx2 and Otx1 to develop
            caudal forebrain primordium that includes future archipallium
  JOURNAL   J Neurosci 25 (21), 5097-5108 (2005)
   PUBMED   15917450
REFERENCE   4  (bases 1 to 1229)
  AUTHORS   Kurokawa D, Kiyonari H, Nakayama R, Kimura-Yoshida C, Matsuo I and
            Aizawa S.
  TITLE     Regulation of Otx2 expression and its functions in mouse forebrain
            and midbrain
  JOURNAL   Development 131 (14), 3319-3331 (2004)
   PUBMED   15201224
REFERENCE   5  (bases 1 to 1229)
  AUTHORS   Puelles E, Annino A, Tuorto F, Usiello A, Acampora D, Czerny T,
            Brodski C, Ang SL, Wurst W and Simeone A.
  TITLE     Otx2 regulates the extent, identity and fate of neuronal progenitor
            domains in the ventral midbrain
  JOURNAL   Development 131 (9), 2037-2048 (2004)
   PUBMED   15105370
REFERENCE   6  (bases 1 to 1229)
  AUTHORS   Zhang YA, Okada A, Lew CH and McConnell SK.
  TITLE     Regulated nuclear trafficking of the homeodomain protein otx1 in
            cortical neurons
  JOURNAL   Mol Cell Neurosci 19 (3), 430-446 (2002)
   PUBMED   11906214
  REMARK    GeneRIF: ventricular cells actively sequester Otx1 in the
            cytoplasm, either by preventing nuclear import or by promoting a
            balance of export over import signals.
REFERENCE   7  (bases 1 to 1229)
  AUTHORS   Morsli H, Tuorto F, Choo D, Postiglione MP, Simeone A and Wu DK.
  TITLE     Otx1 and Otx2 activities are required for the normal development of
            the mouse inner ear
  JOURNAL   Development 126 (11), 2335-2343 (1999)
   PUBMED   10225993
REFERENCE   8  (bases 1 to 1229)
  AUTHORS   Robel L, Ding M, James AJ, Lin X, Simeone A, Leckman JF and
            Vaccarino FM.
  TITLE     Fibroblast growth factor 2 increases Otx2 expression in precursor
            cells from mammalian telencephalon
  JOURNAL   J Neurosci 15 (12), 7879-7891 (1995)
   PUBMED   8613727
REFERENCE   9  (bases 1 to 1229)
  AUTHORS   Frantz GD, Weimann JM, Levin ME and McConnell SK.
  TITLE     Otx1 and Otx2 define layers and regions in developing cerebral
            cortex and cerebellum
  JOURNAL   J Neurosci 14 (10), 5725-5740 (1994)
   PUBMED   7931541
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from L32602.1.
            On Aug 30, 2012 this sequence version replaced NM_013109.1.
            
            Summary: homeodomain transcription factor protein; involved in
            cerebral cortex development [RGD, Feb 2006].
            
            ##Evidence-Data-START##
            Transcript exon combination :: L32602.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00132262, SAMD00132263
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1229              L32602.1           2-1230
FEATURES             Location/Qualifiers
     source          1..1229
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="14"
                     /map="14q22"
     gene            1..1229
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="orthodenticle homeobox 1"
                     /db_xref="GeneID:25646"
                     /db_xref="RGD:3237"
     exon            1..138
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /inference="alignment:Splign:2.1.0"
     CDS             42..1109
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="homeobox protein OTX1-like"
                     /codon_start=1
                     /product="homeobox protein OTX1"
                     /protein_id="NP_037241.1"
                     /db_xref="GeneID:25646"
                     /db_xref="RGD:3237"
                     /translation="
MMSYLKQPPYGMNGLGLAGPAMDLLHPSVGYPATPRKQRRERTTFTRSQLDVLEALFAKTRYPDIFMREEVALKINLPESRVQVWFKNRRAKCRQQQQSGNGTKSRPVKKKSSPVRESSGSESSGQFTPPAVSSSASSSSSASSASANPAAAAAAGLGGNPVAAASSLSTPTASSIWSPASISPGSAPASVSVPEPLGAPSNASCMQRSVAAGAATAATSYPMSYGQGRSYGQGYPAPSSSYFGGVDCSSYLAPMHSHHHPHQLSPMAPSSMAGHHHHHPHAHHPLSQSSGHHHHHHHHHHHQGYGGSGLAFNSADCLDYKEPAAAAASSAWKLNFNSPDCLDYKDQASWRFQVL"
     misc_feature    order(156..170,174..176,225..227,243..245,282..284,
                     288..293,300..305,309..317,321..326)
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(162..164,171..173,291..293,300..305,312..314)
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    165..323
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    315..473
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63410.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    573..863
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="Otx1 transcription factor; Region: TF_Otx;
                     pfam03529"
                     /db_xref="CDD:281521"
     misc_feature    810..959
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63410.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     STS             42..1109
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /standard_name="Otx1"
                     /db_xref="UniSTS:507882"
     STS             42..185
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /standard_name="Otx1"
                     /db_xref="UniSTS:144102"
     exon            139..290
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /inference="alignment:Splign:2.1.0"
     STS             168..254
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /standard_name="Otx1"
                     /db_xref="UniSTS:164914"
     STS             171..548
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /standard_name="Otx1"
                     /db_xref="UniSTS:530693"
     exon            291..1229
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /inference="alignment:Splign:2.1.0"
     STS             1090..1189
                     /gene="Otx1"
                     /gene_synonym="OTX1X"
                     /standard_name="RH94705"
                     /db_xref="UniSTS:119952"
ORIGIN      
gccccctggatccgtcggggcgcctccacccggctgttagcatgatgtcttacctcaaacaacccccatacggcatgaacgggctgggcctagctggccctgccatggacctcctgcacccttccgtgggctaccctgccaccccgcggaagcagcgacgggagcgcaccaccttcacgcgctcacagctggacgtgctcgaggcgctgttcgcaaagactcgctacccagacatcttcatgcgcgaggaggtggctctcaagatcaacctgcccgagtccagagtccaggtttggttcaagaaccgccgagccaagtgccgccagcagcagcagagcgggaatggaacgaaaagccggccggtcaagaagaagtcgtctccggtgcgcgagagctcgggttccgagagcagcggccagttcacgccgcccgccgtatctagctctgcgtcttcgtctagctcagcgtccagtgcctccgctaacccggcggctgctgcggccgcgggcctgggtgggaacccggtggcagccgcgtcctctctgagcacgcctactgcttcgtccatctggagcccggcctccatctctcccggctcagcgccggcatccgtatcagtgccagagccattaggcgctccgagcaacgcctcatgcatgcagcgctcggtagccgcaggtgcggccactgccgcgacctcctaccctatgtcctatggccagggcagaagctatggccagggctaccccgcgccttcctcttcttactttggcggtgtagactgcagctcctaccttgcgcccatgcactctcatcaccacccgcaccagcttagccccatggcaccctcctccatggctggccaccaccaccaccacccgcacgcgcaccacccactgagccaatcttcaggccaccaccaccaccaccatcaccaccaccaccaccaaggttatggaggctctgggctcgccttcaactctgccgactgcttggattacaaggagcccgccgccgccgctgcttcctctgcctggaaactcaacttcaactctcccgactgtctggactataaggaccaagcctcatggcggttccaggtcttgtgagcccaggagggaaaggaagtggagaagaaacgcaactaccttcgccctccgtggtccctatcatgttgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]