GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 02:38:38, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_012581               1634 bp    mRNA    linear   ROD 22-JUN-2021
DEFINITION  Rattus norvegicus homeo box A2 (Hoxa2), mRNA.
ACCESSION   NM_012581
VERSION     NM_012581.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1634)
  AUTHORS   Wang M, Doucette JR and Nazarali AJ.
  TITLE     Conditional Tet-regulated over-expression of Hoxa2 in CG4 cells
            increases their proliferation and delays their differentiation into
            oligodendrocyte-like cells expressing myelin basic protein
  JOURNAL   Cell Mol Neurobiol 31 (6), 875-886 (2011)
   PUBMED   21479584
  REMARK    GeneRIF: The impact of Hoxa2 over-expression on the proliferation
            and differentiation of CG4-SHoxa2 cells was investigated.
REFERENCE   2  (bases 1 to 1634)
  AUTHORS   Alasti F, Sadeghi A, Sanati MH, Farhadi M, Stollar E, Somers T and
            Van Camp G.
  TITLE     A mutation in HOXA2 is responsible for autosomal-recessive microtia
            in an Iranian family
  JOURNAL   Am J Hum Genet 82 (4), 982-991 (2008)
   PUBMED   18394579
  REMARK    Erratum:[Am J Hum Genet. 2008 Sep;83(3):424]
REFERENCE   3  (bases 1 to 1634)
  AUTHORS   Florea L, Di Francesco V, Miller J, Turner R, Yao A, Harris M,
            Walenz B, Mobarry C, Merkulov GV, Charlab R, Dew I, Deng Z, Istrail
            S, Li P and Sutton G.
  TITLE     Gene and alternative splicing annotation with AIR
  JOURNAL   Genome Res 15 (1), 54-66 (2005)
   PUBMED   15632090
REFERENCE   4  (bases 1 to 1634)
  AUTHORS   Gorski DH, LePage DF and Walsh K.
  TITLE     Cloning and sequence analysis of homeobox transcription factor
            cDNAs with an inosine-containing probe
  JOURNAL   Biotechniques 16 (5), 856-858 (1994)
   PUBMED   7915120
REFERENCE   5  (bases 1 to 1634)
  AUTHORS   Patel CV, Gorski DH, LePage DF, Lincecum J and Walsh K.
  TITLE     Molecular cloning of a homeobox transcription factor from adult
            aortic smooth muscle
  JOURNAL   J Biol Chem 267 (36), 26085-26090 (1992)
   PUBMED   1361191
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            M91802.1 and AC122669.6.
            On Jan 24, 2008 this sequence version replaced NM_012581.1.
            
            Summary: homeobox transcription factor; may be involved in control
            of vascular smooth muscle differentiation and proliferation [RGD,
            Feb 2006].
            
            ##Evidence-Data-START##
            Transcript exon combination :: M91802.1, AW251417.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN16676784, SAMN16676806
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-16                M91802.1           38-53
            17-138              AC122669.6         34873-34994         c
            139-1190            M91802.1           176-1227
            1191-1191           AC122669.6         33177-33177         c
            1192-1328           M91802.1           1229-1365
            1329-1634           AC122669.6         32734-33039         c
FEATURES             Location/Qualifiers
     source          1..1634
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q24"
     gene            1..1634
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="homeo box A2"
                     /db_xref="GeneID:103690123"
                     /db_xref="RGD:2813"
     exon            1..536
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /inference="alignment:Splign:2.1.0"
     STS             24..1339
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /db_xref="UniSTS:491328"
     misc_feature    53..55
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="upstream in-frame stop codon"
     CDS             158..1276
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="Homeobox gene A11; Homeobox gene A2; homeobox
                     protein Hox-1.11"
                     /codon_start=1
                     /product="homeobox protein Hox-A2"
                     /protein_id="NP_036713.2"
                     /db_xref="GeneID:103690123"
                     /db_xref="RGD:2813"
                     /translation="
MNYEFEREIGFINSQPSLAECLTSFPPVADTFQSSSIKTSTLSHSTLIPPPFEQTIPSLNPGSHPRQSAGAGGRPKSSPAGSRGSPVPARALQPPEYPWMKEKKAAKKTALPPAAASTGPACLGHKESLEIADGSGGGSRRLRTAYTNTQLLELEKEFHFNKYLCRPRRVEIAALLDLTERQVKVWFQNRRMKHKRQTQCKENQNSEGKFKNLEDSDKVEEDEEEKSLFEQALSVSGALLEREGYTFQQNALSQQQAPNGHNGDSQTFPVSPLTSNEKNLKHFQHQSPTVPNCLSTMGQNCGAGLNNDSPEALEVPSLQDFNVFSTDSCLQLSDALSPSLPGSLDSPVDISADSFDFFTDTLTTIDLQHLNY"
     misc_feature    281..445
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="propagated from UniProtKB/Swiss-Prot (P31246.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    443..460
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="propagated from UniProtKB/Swiss-Prot (P31246.1);
                     Region: Antp-type hexapeptide"
     misc_feature    584..745
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:395001"
     misc_feature    737..832
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="propagated from UniProtKB/Swiss-Prot (P31246.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     STS             210..284
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="Hoxa2"
                     /db_xref="UniSTS:536640"
     STS             212..466
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="REN100338"
                     /db_xref="UniSTS:425135"
     STS             450..1544
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="Hoxa9"
                     /db_xref="UniSTS:527391"
     exon            537..1634
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    569..751
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /note="homeobox"
     STS             587..984
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="MARC_12745-12746:1030738152:1"
                     /db_xref="UniSTS:267439"
     STS             683..766
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="AI324701"
                     /db_xref="UniSTS:165466"
     STS             882..1032
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="Hoxa2"
                     /db_xref="UniSTS:143365"
     STS             1241..1442
                     /gene="Hoxa2"
                     /gene_synonym="hox-1.11; Hoxa-2; Hoxa11; RATHOX111A"
                     /standard_name="RH132575"
                     /db_xref="UniSTS:215858"
ORIGIN      
ggctgtaatcagtgaattagaaaaaaaacaccccagcagcgatcttctatgatagatttttttttccttcgctctcgcctttttcctgggccttgcccccccaaagcccctccaaaagagggaacttttcctccgagggggctccaaggagaaggccatgaattacgaatttgagcgagagattggttttatcaatagccagccgtcgctcgctgagtgcctgacatcttttccccctgtcgctgatacatttcaaagttcatcaatcaagacctcgacgctttcacactcgacactgattcctcctccttttgagcagaccattcccagcctgaacccgggcagtcaccctcgccaaagcgctggcgctggcggccgccccaagtcgagccccgcgggcagtcgcggcagcccggtgcccgcccgcgccctgcagccgcctgagtacccctggatgaaggagaagaaggcggccaagaaaaccgcgctgccgcccgccgccgcctccacgggccctgcctgcctcggccacaaagaatccctggaaatagccgatggcagcggtgggggatccaggcgtctgagaactgcttacaccaacactcagcttttggaactggaaaaggaatttcatttcaacaagtacctctgcagaccccggagggtggaaatcgccgcgctgctggatttgaccgagagacaagtgaaagtgtggtttcagaaccggaggatgaagcataagaggcaaacccagtgcaaggagaaccaaaacagcgaagggaaatttaaaaacctggaggattcggacaaagtggaggaagacgaggaagagaagtcactctttgagcaagccctcagtgtctccggggcccttctggagagggaaggttacacttttcagcaaaacgcgctctctcaacagcaggctcccaatggacacaatggcgactcccaaactttcccagtttcgcctttaaccagcaatgagaaaaatttgaaacattttcagcaccagtcacccactgttcctaactgcttgtcaacaatgggccagaactgtggagctggcctaaacaatgacagtcccgaggccctcgaggtcccctctttgcaggactttaatgttttctccacagattcctgcctgcagctttcagacgcactgtcgcccagtttgccaggctccctggacagtcctgtagatatttcagctgacagctttgacttttttacagacacactcaccacaatcgacctacagcatctgaattactaagaacattaaagcaaaagaaagcttcacaaaacaaaacgcctttggccaggtggctttgccttcttttattccgggagttgattttcgttctattctcttctcgatctacccctgttctcttaaatgttcaggactttctgttttacacccagtttgaaagccatctcttccaaatgatgttggcgttctaagtgttttacaccgaacccaacaagcttctatgtgattttcctgaaaacaaaacacgaggcctgcaagaaagtgaccataagttgtcttgtcactttctttttatttttgtaccacattaggatgcattgtcatgcgtatttttggtagaataaactctcctctgcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]