LOCUS       NM_012149                594 bp    mRNA    linear   PRI 21-DEC-2022
DEFINITION  Homo sapiens double homeobox 5 (DUX5), mRNA.
ACCESSION   NM_012149
VERSION     NM_012149.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 594)
  AUTHORS   Ostlund C, Garcia-Carrasquillo RM, Belayew A and Worman HJ.
  TITLE     Intracellular trafficking and dynamics of double homeodomain
            proteins
  JOURNAL   Biochemistry 44 (7), 2378-2384 (2005)
   PUBMED   15709750
REFERENCE   2  (bases 1 to 594)
  AUTHORS   Beckers M, Gabriels J, van der Maarel S, De Vriese A, Frants RR,
            Collen D and Belayew A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   3  (bases 1 to 594)
  AUTHORS   Ding H, Beckers MC, Plaisance S, Marynen P, Collen D and Belayew A.
  TITLE     Characterization of a double homeodomain protein (DUX1) encoded by
            a cDNA homologous to 3.3 kb dispersed repeated elements
  JOURNAL   Hum Mol Genet 7 (11), 1681-1694 (1998)
   PUBMED   9736770
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF133131.1.
            
            On May 13, 2005 this sequence version replaced NM_012149.1.
            
            Summary: The human genome contains hundreds of repeats of the
            3.3-kb family in regions associated with heterochromatin. The DUX
            gene family, including DUX5, resides within these 3.3-kb repeated
            elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM
            606009).[supplied by OMIM, Mar 2008].
            
            Sequence Note: The 5'-most translation start codon is selected for
            this RefSeq. The use of an alternative downstream start codon would
            result in a protein that is 27 aa shorter at the N-terminus. In
            vitro translation studies in PMID:11245978 indicate that both the
            longer and shorter proteins can be produced from this transcript.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-594               AF133131.1         266-859
FEATURES             Location/Qualifiers
     source          1..594
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14"
     gene            1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="double homeobox 5"
                     /db_xref="GeneID:26581"
                     /db_xref="HGNC:HGNC:3083"
                     /db_xref="MIM:611444"
     CDS             1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="double homeobox protein; alternative translation
                     start site; double homeobox protein 1; epididymis
                     secretory sperm binding protein"
                     /codon_start=1
                     /product="double homeobox protein 5"
                     /protein_id="NP_036281.2"
                     /db_xref="GeneID:26581"
                     /db_xref="HGNC:HGNC:3083"
                     /db_xref="MIM:611444"
                     /translation="

MPAEVHGSPPASLCPCQSVKFRPGLPEMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG"

     misc_feature    160..297
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cl00084"
                     /db_xref="CDD:444687"
     misc_feature    301..381
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96PT3.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(364..378,382..384,433..435,451..453,490..492,
                     496..501,508..513,517..525,529..534)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    370..531
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(370..372,379..381,499..501,508..513,520..522)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtga

//