2024-03-29 18:33:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_009902 1263 bp mRNA linear ROD 06-SEP-2023 DEFINITION Mus musculus claudin 3 (Cldn3), mRNA. ACCESSION NM_009902 VERSION NM_009902.4 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1263) AUTHORS Maezawa S, Yukawa M, Hasegawa K, Sugiyama R, Iizuka M, Hu M, Sakashita A, Vidal M, Koseki H, Barski A, DeFalco T and Namekawa SH. TITLE PRC1 suppresses a female gene regulatory network to ensure testicular differentiation JOURNAL Cell Death Dis 14 (8), 501 (2023) PUBMED 37542070 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1263) AUTHORS Suzuki K, Yamaga K, Tokumasu R, Katsuno T, Tanaka H, Chiba S, Yagi T, Katayama I, Tamura A, Murota H and Tsukita S. TITLE Double mutation of claudin-1 and claudin-3 causes alopecia in infant mice JOURNAL Ann N Y Acad Sci 1523 (1), 51-61 (2023) PUBMED 37002535 REMARK GeneRIF: Double mutation of claudin-1 and claudin-3 causes alopecia in infant mice. REFERENCE 3 (bases 1 to 1263) AUTHORS Lei N, Cheng Y, Wan J, Blasig R, Li A, Bai Y, Haseloff RF, Blasig IE, Zhu L and Qin Z. TITLE Claudin-3 inhibits tumor-induced lymphangiogenesis via regulating the PI3K signaling pathway in lymphatic endothelial cells JOURNAL Sci Rep 12 (1), 17440 (2022) PUBMED 36261482 REMARK GeneRIF: Claudin-3 inhibits tumor-induced lymphangiogenesis via regulating the PI3K signaling pathway in lymphatic endothelial cells. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1263) AUTHORS Grund SC, Wu XX, Muller D, Wennemuth G and Grummer R. TITLE Impact of endometrial claudin-3 deletion on murine implantation, decidualization, and embryo developmentdagger JOURNAL Biol Reprod 107 (4), 984-997 (2022) PUBMED 35863769 REMARK GeneRIF: Impact of endometrial claudin-3 deletion on murine implantation, decidualization, and embryo developmentdagger. REFERENCE 5 (bases 1 to 1263) AUTHORS Higashi AY, Higashi T, Furuse K, Ozeki K, Furuse M and Chiba H. TITLE Claudin-9 constitutes tight junctions of folliculo-stellate cells in the anterior pituitary gland JOURNAL Sci Rep 11 (1), 21642 (2021) PUBMED 34737342 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1263) AUTHORS Furuse M, Sasaki H and Tsukita S. TITLE Manner of interaction of heterogeneous claudin species within and between tight junction strands JOURNAL J Cell Biol 147 (4), 891-903 (1999) PUBMED 10562289 REFERENCE 7 (bases 1 to 1263) AUTHORS Kubota K, Furuse M, Sasaki H, Sonoda N, Fujita K, Nagafuchi A and Tsukita S. TITLE Ca(2+)-independent cell-adhesion activity of claudins, a family of integral membrane proteins localized at tight junctions JOURNAL Curr Biol 9 (18), 1035-1038 (1999) PUBMED 10508613 REFERENCE 8 (bases 1 to 1263) AUTHORS Morita K, Furuse M, Fujimoto K and Tsukita S. TITLE Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands JOURNAL Proc Natl Acad Sci U S A 96 (2), 511-516 (1999) PUBMED 9892664 REFERENCE 9 (bases 1 to 1263) AUTHORS Paperna T, Peoples R, Wang YK, Kaplan P and Francke U. TITLE Genes for the CPE receptor (CPETR1) and the human homolog of RVP1 (CPETR2) are localized within the Williams-Beuren syndrome deletion JOURNAL Genomics 54 (3), 453-459 (1998) PUBMED 9878248 REFERENCE 10 (bases 1 to 1263) AUTHORS Katahira J, Sugiyama H, Inoue N, Horiguchi Y, Matsuda M and Sugimoto N. TITLE Clostridium perfringens enterotoxin utilizes two structurally related membrane proteins as functional receptors in vivo JOURNAL J Biol Chem 272 (42), 26652-26658 (1997) PUBMED 9334247 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK002672.1 and AV041302.2. On Aug 4, 2010 this sequence version replaced NM_009902.3. Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a low-affinity receptor for clostridium perfringens enterotoxin (CPE) produced by the bacterium Clostridium perfringens, and the interaction with CPE results in increased membrane permeability by forming small pores in plasma membrane. This protein is highly overexpressed in uterine carcinosarcoma. This protein is also predominantly present in brain endothelial cells, where it plays a specific role in the establishment and maintenance of blood brain barrier tight junction morphology. [provided by RefSeq, Aug 2012]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript is intronless :: AK002672.1 [ECO:0000345] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1199 AK002672.1 2-1200 1200-1263 AV041302.2 218-281 FEATURES Location/Qualifiers source 1..1263 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="5" /map="5 74.93 cM" gene 1..1263 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="claudin 3" /db_xref="GeneID:12739" /db_xref="MGI:MGI:1329044" exon 1..1263 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /inference="alignment:Splign:2.1.0" CDS 232..891 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="CPE-R 2; CPE-receptor 2; clostridium perfringens enterotoxin receptor 2" /codon_start=1 /product="claudin-3" /protein_id="NP_034032.1" /db_xref="CCDS:CCDS19729.1" /db_xref="GeneID:12739" /db_xref="MGI:MGI:1329044" /translation="
MSMGLEITGTSLAVLGWLCTIVCCALPMWRVSAFIGSSIITAQITWEGLWMNCVVQSTGQMQCKMYDSLLALPQDLQAARALIVVSILLAAFGLLVALVGAQCTNCVQDETAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPLVPEAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPRDKYAPTKILYSAPRSTGPGTGTGTAYDRKDYV"
misc_feature 238..732 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:451326" misc_feature 256..318 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); transmembrane region" misc_feature 472..534 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); transmembrane region" misc_feature 577..639 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); transmembrane region" misc_feature 709..771 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); transmembrane region" misc_feature 820..822 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="Phosphotyrosine. /evidence=ECO:0007744|PubMed:17242355; propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); phosphorylation site" misc_feature 823..825 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q63400; propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); phosphorylation site" misc_feature 883..888 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1); Region: Interactions with TJP1, TJP2 and TJP3. /evidence=ECO:0000250" regulatory 1237..1242 /regulatory_class="polyA_signal_sequence" /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" polyA_site 1260 /gene="Cldn3" /gene_synonym="Cpetr2; mRVP1" ORIGIN
agtctcagaagccagtctccaaagccacaggcaggtgcaggggcagtctctgtgcgagccccaggagaggagccgttaagcgcgctccgtcctttgccacccacccgtcgttcccggcgacagacgtccgtcagttttcgaagggcagttgattcccaggtccagcggccgcgatccctggtctcccagtcccctgagctgcccggccgagccggttcaagtccagcagccatgtccatgggcctggagatcaccggcacgtcgctggccgtgctgggctggctgtgcaccatcgtgtgctgcgcccttcccatgtggcgcgtttcggccttcatcggcagcagcatcatcacggcgcagatcacctgggagggcctgtggatgaactgcgtggtgcagagcaccggtcagatgcagtgcaaaatgtacgactcgctgctggccctgccgcaggacctgcaggccgcccgagccctcatcgtggtgtccatcctgctggccgccttcgggctcctcgtggcgctcgtgggcgcccagtgtaccaactgcgtacaagacgagacggccaaggccaagatcaccatcgtggcgggagtgcttttcctgttggcggctctgctcaccttagtaccggtgtcctggtcggccaacaccatcatcagggatttctataacccgttggtgcccgaggcccagaagcgggagatgggagctgggttgtacgtgggctgggctgccgccgcgctgcagttgctagggggcgccttgctgtgttgctcctgcccaccgcgcgacaagtatgcacccaccaagatcctctattctgcgccgcgatccaccggccctggcaccggtaccggcaccgcctacgaccgcaaggactacgtctgaggggccgggtgcacgcagaccgtaccgtcaccactaccagcagtcgatgaaccccacccgtccagcgtgcagcctcgcgtctgagaccaccccaccttccagatggtgacagacgacacacagtctgcttgctaggctggaagaggacagacaggctggcatctccccttctccggctgccacctgactaccgggcctaggaactgtccaagccgaatggacaaagaaacctcgcccttcccaagaactgggctggggtggccactgcagctacttgccagccccgcagaagctcacagtgggcagagacaggcaaaccatgaaacgggccatttcatatttttcaataaaagtctttcgttttttgcagtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]