GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:15:10, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_005269               3972 bp    mRNA    linear   PRI 07-SEP-2020
DEFINITION  Homo sapiens GLI family zinc finger 1 (GLI1), transcript variant 1,
            mRNA.
ACCESSION   NM_005269
VERSION     NM_005269.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3972)
  AUTHORS   Qin Y, Jiang M, Tuerxung N, Wang H, Zhao F, Zhen Y and Hao J.
  TITLE     Sonic hedgehog signaling pathway in Myelodysplastic Syndrome:
            Abnormal activation and jervine intervention
  JOURNAL   Gene 754, 144881 (2020)
   PUBMED   32526259
  REMARK    GeneRIF: High GLI1 expression is associated with Myelodysplastic
            Syndrome.
REFERENCE   2  (bases 1 to 3972)
  AUTHORS   Guan W, Zhang J and Chen J.
  TITLE     Connection of GLI1 variants to congenital heart disease
            susceptibility: A case-control study
  JOURNAL   Medicine (Baltimore) 99 (27), e19868 (2020)
   PUBMED   32629623
  REMARK    GeneRIF: rs2228226 polymorphism may be a risk factor for congenital
            heart disease in Chinese Han population, but not rs10783826
REFERENCE   3  (bases 1 to 3972)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   4  (bases 1 to 3972)
  AUTHORS   Sirkisoon SR, Carpenter RL, Rimkus T, Doheny D, Zhu D, Aguayo NR,
            Xing F, Chan M, Ruiz J, Metheny-Barlow LJ, Strowd R, Lin J, Regua
            AT, Arrigo A, Anguelov M, Pasche B, Debinski W, Watabe K and Lo HW.
  TITLE     TGLI1 transcription factor mediates breast cancer brain metastasis
            via activating metastasis-initiating cancer stem cells and
            astrocytes in the tumor microenvironment
  JOURNAL   Oncogene 39 (1), 64-78 (2020)
   PUBMED   31462709
  REMARK    GeneRIF: Since cancer stem cells (CSCs) are radioresistant and
            metastasis-initiating cells, we examined TGLI1 for its involvement
            in breast CSCs and found TGLI1 to transcriptionally activate
            stemness genes CD44, Nanog, Sox2, and OCT4 leading to CSC renewal,
            and TGLI1 outcompetes with GLI1 for binding to target promoters.
REFERENCE   5  (bases 1 to 3972)
  AUTHORS   Kerr DA, Pinto A, Subhawong TK, Wilky BA, Schlumbrecht MP,
            Antonescu CR, Nielsen GP and Rosenberg AE.
  TITLE     Pericytoma With t(7;12) and ACTB-GLI1 Fusion: Reevaluation of an
            Unusual Entity and its Relationship to the Spectrum of GLI1
            Fusion-related Neoplasms
  JOURNAL   Am. J. Surg. Pathol. 43 (12), 1682-1692 (2019)
   PUBMED   31567194
  REMARK    GeneRIF: Pericytoma with t(7;12) and ACTB-GLI1 fusion could be
            classified as malignant myopericytoma variants or an emerging
            translocation-associated sarcoma of uncertain differentiation.
REFERENCE   6  (bases 1 to 3972)
  AUTHORS   Chung RY and Seizinger BR.
  TITLE     Molecular genetics of neurological tumours
  JOURNAL   J. Med. Genet. 29 (6), 361-367 (1992)
   PUBMED   1320124
  REMARK    Review article
REFERENCE   7  (bases 1 to 3972)
  AUTHORS   Arheden K, Ronne M, Mandahl N, Heim S, Kinzler KW, Vogelstein B and
            Mitelman F.
  TITLE     In situ hybridization localizes the human putative oncogene GLI to
            chromosome subbands 12q13.3-14.1
  JOURNAL   Hum. Genet. 82 (1), 1-2 (1989)
   PUBMED   2497059
REFERENCE   8  (bases 1 to 3972)
  AUTHORS   Ruppert JM, Kinzler KW, Wong AJ, Bigner SH, Kao FT, Law ML, Seuanez
            HN, O'Brien SJ and Vogelstein B.
  TITLE     The GLI-Kruppel family of human genes
  JOURNAL   Mol. Cell. Biol. 8 (8), 3104-3113 (1988)
   PUBMED   2850480
REFERENCE   9  (bases 1 to 3972)
  AUTHORS   Kinzler KW, Ruppert JM, Bigner SH and Vogelstein B.
  TITLE     The GLI gene is a member of the Kruppel family of zinc finger
            proteins
  JOURNAL   Nature 332 (6162), 371-374 (1988)
   PUBMED   2832761
REFERENCE   10 (bases 1 to 3972)
  AUTHORS   Kinzler,K.W., Bigner,S.H., Bigner,D.D., Trent,J.M., Law,M.L.,
            O'Brien,S.J., Wong,A.J. and Vogelstein,B.
  TITLE     Identification of an amplified, highly expressed gene in a human
            glioma
  JOURNAL   Science 236 (4797), 70-73 (1987)
   PUBMED   3563490
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC022506.38, X07384.1 and
            BC013000.2.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 22, 2018 this sequence version replaced NM_005269.2.
            
            Summary: This gene encodes a member of the Kruppel family of zinc
            finger proteins. The encoded transcription factor is activated by
            the sonic hedgehog signal transduction cascade and regulates stem
            cell proliferation. The activity and nuclear localization of this
            protein is negatively regulated by p53 in an inhibitory loop.
            Multiple transcript variants encoding different isoforms have been
            found for this gene. [provided by RefSeq, May 2009].
            
            Transcript Variant: This variant (1) encodes the full length
            protein (isoform 1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC013000.2, X07384.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2142348
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000228682.7/ ENSP00000228682.2
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-366               AC022506.38        147936-148301       c
            367-3848            X07384.1           1-3482
            3849-3849           AC022506.38        135941-135941       c
            3850-3972           BC013000.2         3444-3566
FEATURES             Location/Qualifiers
     source          1..3972
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.3"
     gene            1..3972
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="GLI family zinc finger 1"
                     /db_xref="GeneID:2735"
                     /db_xref="HGNC:HGNC:4317"
                     /db_xref="MIM:165220"
     exon            1..417
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563257939"
     variation       5
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220926546"
     variation       9
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442382453"
     variation       10
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273692718"
     variation       11
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1433687098"
     variation       12
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301924976"
     variation       16
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370846684"
     variation       24
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022617516"
     variation       27
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241481317"
     variation       28
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435373088"
     variation       29
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963651365"
     variation       31
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190619963"
     variation       32
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:118054983"
     variation       33
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183216767"
     variation       34
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482594138"
     variation       36
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594737909"
     variation       39
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315500627"
     variation       40
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594737915"
     variation       43
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053341640"
     variation       46
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594737922"
     variation       49
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594737926"
     variation       50..54
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1215408212"
     variation       52
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312639471"
     variation       55
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026601133"
     variation       56
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950561121"
     variation       58
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987226669"
     variation       59
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288552432"
     variation       64
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891777653"
     variation       67
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011560408"
     variation       70
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:990190555"
     variation       73
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296770382"
     variation       81
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467905679"
     variation       89
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1360238624"
     variation       92
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914554013"
     variation       93
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043461766"
     variation       97
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468271877"
     variation       100
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414347760"
     variation       101
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889851791"
     variation       103
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211851205"
     variation       107
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965420091"
     variation       110
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58578540"
     variation       121
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551897439"
     variation       122
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975407716"
     variation       125
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752592037"
     variation       127
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207981466"
     variation       131
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564027328"
     variation       134..135
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1177708641"
     variation       136
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268150992"
     variation       138
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019409876"
     variation       138
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="gcg"
                     /db_xref="dbSNP:1409965842"
     variation       140
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="gcgggtgaggg"
                     /db_xref="dbSNP:1417024285"
     variation       146
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227277959"
     variation       147
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965622089"
     variation       153
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326559916"
     variation       154
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157926469"
     variation       158
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380401521"
     variation       166
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394719894"
     variation       176
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1594738047"
     variation       177
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462584664"
     variation       178
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391513530"
     variation       180
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947658909"
     variation       181
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566556183"
     variation       182..189
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:879536638"
     variation       183
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943498994"
     variation       184
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994081553"
     variation       201
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1555326143"
     variation       202
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167250465"
     variation       205
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924816504"
     variation       206
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323370063"
     variation       207
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412858556"
     variation       208
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1555326146"
     variation       209..217
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /replace="aaaaaaaaaa"
                     /db_xref="dbSNP:1393053934"
     variation       209
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934836302"
     variation       211
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281765321"
     variation       220
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207486512"
     variation       223
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566556206"
     variation       227
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057295125"
     variation       233..260
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gg"
                     /replace="gggtggtccgggcttgcggcccggcggg"
                     /db_xref="dbSNP:1594738110"
     variation       234
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025597308"
     variation       237..259
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gg"
                     /replace="ggtccgggcttgcggcccggcgg"
                     /db_xref="dbSNP:1371642726"
     variation       241..262
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cgggct"
                     /replace="cgggcttgcggcccggcgggct"
                     /db_xref="dbSNP:1223509759"
     variation       249..270
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cggc"
                     /replace="cggcccggcgggctgggccggc"
                     /db_xref="dbSNP:1055474966"
     variation       250
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952621453"
     variation       252
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594738137"
     variation       253..273
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ccggcggg"
                     /replace="ccggcgggctgggccggcggg"
                     /db_xref="dbSNP:1337159748"
     variation       254
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983764569"
     variation       255
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916235282"
     variation       258..282
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gggctggg"
                     /replace="gggctgggccggcgggagggctggg"
                     /db_xref="dbSNP:1434453975"
     variation       258
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969132647"
     variation       266
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:982305215"
     variation       267
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295480691"
     variation       270
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1594738162"
     variation       272..293
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gg"
                     /replace="ggagggctgggggccaggttgg"
                     /db_xref="dbSNP:1458260277"
     variation       274..291
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="agggctgggggccaggtt"
                     /db_xref="dbSNP:745569580"
     variation       274
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039099754"
     variation       275..277
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1555326152"
     variation       278
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:923453258"
     variation       279
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933447238"
     variation       279
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1368144645"
     variation       283
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898824355"
     variation       285..291
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="ccaggtt"
                     /db_xref="dbSNP:1205154642"
     variation       285
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1047912216"
     variation       287
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886719170"
     variation       288
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187895829"
     variation       289
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594738201"
     variation       290
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006883764"
     variation       291
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037408048"
     variation       292..298
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1487917896"
     variation       293
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263331129"
     variation       294
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220706391"
     variation       298
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344835466"
     variation       299
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:762605862"
     variation       299
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867143377"
     variation       300..304
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ggggg"
                     /replace="ggggggggggggggggggggggggggg"
                     /db_xref="dbSNP:1594738226"
     variation       301
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479556427"
     variation       303
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228372332"
     variation       305
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176365666"
     variation       309
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303445954"
     variation       310
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528091034"
     variation       312
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431368368"
     variation       317
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370992030"
     variation       319
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167750628"
     variation       322
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1026234156"
     variation       325
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886329066"
     variation       328
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928818611"
     variation       337
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008713500"
     variation       338
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594738271"
     variation       339..345
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:533933914"
     variation       339
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484230505"
     variation       340
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938877300"
     variation       341
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053284807"
     variation       343
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965472351"
     variation       344
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281588122"
     variation       346
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566556322"
     variation       347..362
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ccccaccgcacacccc"
                     /replace="ccccaccgcacaccccaccgcacacccc"
                     /db_xref="dbSNP:1411845164"
     variation       349
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975513323"
     variation       353
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441960769"
     variation       358
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594738301"
     variation       360
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313921288"
     variation       365
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1357756461"
     variation       365
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028790908"
     variation       366
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404246447"
     variation       370
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173153601"
     variation       371
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292841778"
     variation       374
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318701751"
     variation       381
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160778151"
     variation       382
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1472692682"
     variation       383
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216367847"
     variation       387
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377330434"
     variation       388
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594738342"
     variation       394
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258867529"
     variation       397
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201579532"
     variation       404
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323479867"
     variation       405
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261292791"
     variation       406
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330019985"
     variation       409..416
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="caga"
                     /replace="cagacaga"
                     /db_xref="dbSNP:1288023013"
     variation       409
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439743257"
     variation       413
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979145228"
     variation       416
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594738387"
     exon            418..544
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       422
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271933266"
     variation       426
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387608656"
     variation       427
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594742192"
     variation       428
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325797084"
     variation       432
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318039088"
     variation       433
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866637296"
     variation       434
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368603625"
     misc_feature    436..438
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="upstream in-frame stop codon"
     variation       439
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753107628"
     variation       441
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756597374"
     variation       442
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372716016"
     variation       443
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341947953"
     variation       444
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749798054"
     CDS             445..3765
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="isoform 1 is encoded by transcript variant 1;
                     glioma-associated oncogene homolog 1 (zinc finger
                     protein); oncogene GLI; glioma-associated oncogene 1;
                     GLI-Kruppel family member GLI1"
                     /codon_start=1
                     /product="zinc finger protein GLI1 isoform 1"
                     /protein_id="NP_005260.1"
                     /db_xref="CCDS:CCDS8940.1"
                     /db_xref="GeneID:2735"
                     /db_xref="HGNC:HGNC:4317"
                     /db_xref="MIM:165220"
                     /translation="
MFNSMTPPPISSYGEPCCLRPLPSQGAPSVGTEGLSGPPFCHQANLMSGPHSYGPARETNSCTEGPLFSSPRSAVKLTKKRALSISPLSDASLDLQTVIRTSPSSLVAFINSRCTSPGGSYGHLSIGTMSPSLGFPAQMNHQKGPSPSFGVQPCGPHDSARGGMIPHPQSRGPFPTCQLKSELDMLVGKCREEPLEGDMSSPNSTGIQDPLLGMLDGREDLEREEKREPESVYETDCRWDGCSQEFDSQEQLVHHINSEHIHGERKEFVCHWGGCSRELRPFKAQYMLVVHMRRHTGEKPHKCTFEGCRKSYSRLENLKTHLRSHTGEKPYMCEHEGCSKAFSNASDRAKHQNRTHSNEKPYVCKLPGCTKRYTDPSSLRKHVKTVHGPDAHVTKRHRGDGPLPRAPSISTVEPKREREGGPIREESRLTVPEGAMKPQPSPGAQSSCSSDHSPAGSAANTDSGVEMTGNAGGSTEDLSSLDEGPCIAGTGLSTLRRLENLRLDQLHQLRPIGTRGLKLPSLSHTGTTVSRRVGPPVSLERRSSSSSSISSAYTVSRRSSLASPFPPGSPPENGASSLPGLMPAQHYLLRARYASARGGGTSPTAASSLDRIGGLPMPPWRSRAEYPGYNPNAGVTRRASDPAQAADRPAPARVQRFKSLGCVHTPPTVAGGGQNFDPYLPTSVYSPQPPSITENAAMDARGLQEEPEVGTSMVGSGLNPYMDFPPTDTLGYGGPEGAAAEPYGARGPGSLPLGPGPPTNYGPNPCPQQASYPDPTQETWGEFPSHSGLYPGPKALGGTYSQCPRLEHYGQVQVKPEQGCPVGSDSTGLAPCLNAHPSEGPPHPQPLFSHYPQPSPPQYLQSGPYTQPPPDYLPSEPRPCLDFDSPTHSTGQLKAQLVCNYVQSQQELLWEGGGREDAPAQEPSYQSPKFLGGSQVSPSRAKAPVNTYGPGFGPNLPNHKSGSYPTPSPCHENFVVGANRASHRAAAPPRLLPPLPTCYGPLKVGGTNPSCGHPEVGRLGGGPALYPPPEGQVCNPLDSLDLDNTQLDFVAILDEPQGLSPPPSHDQRGSSGHTPPPSGPPNMAVGNMSVLLRSLPGETEFLNSSA"
     misc_feature    445..504
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="propagated from UniProtKB/Swiss-Prot (P08151.1);
                     Region: SNAG domain. /evidence=ECO:0000250"
     misc_feature    802..816
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="propagated from UniProtKB/Swiss-Prot (P08151.1);
                     Region: Interaction with SUFU.
                     /evidence=ECO:0000269|PubMed:24217340,
                     ECO:0000269|PubMed:24311597"
     misc_feature    1153..>1239
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="FOXP coiled-coil domain; Region: FOXP-CC;
                     pfam16159"
                     /db_xref="CDD:292777"
     misc_feature    1291..1317
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="propagated from UniProtKB/Swiss-Prot (P08151.1);
                     Region: Interaction with DNA.
                     /evidence=ECO:0000269|PubMed:8378770"
     misc_feature    1303..1386
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1351..1419
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1351..1353,1366..1368,1405..1407,1417..1419)
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    order(1372..1374,1378..1380,1384..1386,1390..1395,
                     1402..1407,1414..1416,1462..1464,1468..1470,1480..1485,
                     1492..1497,1507..1509,1555..1557,1561..1563,1567..1569,
                     1573..1578,1585..1590,1597..1599)
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="putative nucleic acid binding site [nucleotide
                     binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1393..1476
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1441..1512
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1441..1443,1456..1458,1495..1497,1510..1512)
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1477..1494
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="propagated from UniProtKB/Swiss-Prot (P08151.1);
                     Region: Interaction with DNA.
                     /evidence=ECO:0000269|PubMed:8378770"
     misc_feature    1534..1599
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    1567..1587
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="propagated from UniProtKB/Swiss-Prot (P08151.1);
                     Region: Interaction with DNA.
                     /evidence=ECO:0000269|PubMed:8378770"
     misc_feature    1996..1998
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000269|PubMed:20081843; propagated from
                     UniProtKB/Swiss-Prot (P08151.1); acetylation site"
     variation       446
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476283594"
     variation       450
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771552323"
     variation       452
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779451445"
     variation       455
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141757554"
     variation       456
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768242494"
     variation       460
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594742252"
     variation       470
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311532229"
     variation       472
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748024303"
     variation       474
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533354109"
     variation       476
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010940668"
     variation       482
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313805644"
     variation       484
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377673984"
     variation       485
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773228040"
     variation       486
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375023995"
     variation       487
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890327478"
     variation       488
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766446724"
     variation       491
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552135928"
     variation       499
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759777434"
     variation       501
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338589420"
     variation       502
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767782645"
     variation       503
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199861974"
     variation       504
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484552010"
     variation       507
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594742323"
     variation       510
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209954594"
     variation       511
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756402955"
     variation       512
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429409127"
     variation       513
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195338225"
     variation       516
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371419015"
     variation       518
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566558142"
     variation       519..537
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gggg"
                     /replace="gggggcccccagtgtgggg"
                     /db_xref="dbSNP:754712240"
     variation       521
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764455953"
     variation       524
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754294090"
     variation       526
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200183475"
     variation       536
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757744788"
     variation       539
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779593964"
     variation       540..544
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:762121846"
     variation       541
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035246842"
     variation       542
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746560370"
     variation       544
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383562588"
     exon            545..637
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       545
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440421197"
     variation       547
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936956795"
     variation       549
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150582481"
     variation       553
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165299385"
     variation       557
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392573638"
     variation       558
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200909709"
     variation       559
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418545492"
     variation       569
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594742645"
     variation       571
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236664410"
     variation       579
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780874033"
     variation       580
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328811148"
     variation       584
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594742670"
     variation       588
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764276220"
     variation       589
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537495636"
     variation       591
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239688467"
     variation       598
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749091656"
     variation       601
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566558325"
     variation       603
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544554516"
     variation       606
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932046248"
     variation       607
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566558352"
     variation       611
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770894336"
     variation       614
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272787826"
     variation       615
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778646808"
     variation       616
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362862333"
     variation       620
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375170232"
     variation       630
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166399163"
     variation       632
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772090740"
     variation       633
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774592251"
     variation       634
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760866050"
     variation       636
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768924234"
     variation       637
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389442591"
     exon            638..833
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       642
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486183942"
     variation       643
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770016487"
     variation       645
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254939801"
     variation       646..649
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:778175957"
     variation       649
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773669041"
     variation       650
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763536538"
     variation       655..658
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:749351793"
     variation       657
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206451119"
     variation       658
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199685332"
     variation       659
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760192848"
     variation       664
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395670869"
     variation       667
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436341580"
     variation       672
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267603602"
     variation       676
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310917004"
     variation       683
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763670345"
     variation       685
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753380800"
     variation       686
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1289476480"
     variation       694
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364213000"
     variation       695
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144785382"
     variation       696
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297477990"
     variation       697
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750276505"
     variation       701
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758328227"
     variation       702
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594743411"
     variation       703
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779901915"
     variation       707
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415914630"
     variation       710
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746964085"
     variation       711
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139988338"
     variation       713
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781367133"
     variation       715
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748291467"
     variation       719
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770107383"
     variation       723
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232404933"
     variation       725
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1253544916"
     variation       726
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455536375"
     variation       734
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143548857"
     variation       735
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117426148"
     variation       738
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414085726"
     variation       741
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377645048"
     variation       742
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760141461"
     variation       743
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763470494"
     variation       746
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419694903"
     variation       748
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320048458"
     variation       751
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029168886"
     variation       754
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889338993"
     variation       755
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776244778"
     variation       756
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566558833"
     variation       757
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018955380"
     variation       758
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139570630"
     variation       760
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344789388"
     variation       762
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224725764"
     variation       763
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285900168"
     variation       766
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765007750"
     variation       767
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011225180"
     variation       768
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750081911"
     variation       769
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758132104"
     variation       772
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766185741"
     variation       773
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260473262"
     variation       776
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202951566"
     variation       779
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751461298"
     variation       780
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371273350"
     variation       781
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748321474"
     variation       782
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756282060"
     variation       787
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375940413"
     variation       789
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749531780"
     variation       792
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771370874"
     variation       793
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774885952"
     variation       800
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243003218"
     variation       801
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746329155"
     variation       803
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772683970"
     variation       807
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150011919"
     variation       808
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367757660"
     variation       816..823
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="ctccattg"
                     /db_xref="dbSNP:757407368"
     variation       816
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227429035"
     variation       819
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762627665"
     variation       821
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317745506"
     variation       823
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766134206"
     variation       824
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751408248"
     variation       825
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759381999"
     exon            834..978
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       834
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272855214"
     variation       841
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476006703"
     variation       847
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889329214"
     variation       850
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368173104"
     variation       851
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298522895"
     variation       854
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145283539"
     variation       855
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429500924"
     variation       858
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019239130"
     variation       859
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199696648"
     variation       860
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:898082922"
     variation       864
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764236015"
     variation       868..869
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="ggtg"
                     /db_xref="dbSNP:1281162936"
     variation       868
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393937734"
     variation       874
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233812896"
     variation       881
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754019701"
     variation       882
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148571068"
     variation       883
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371590132"
     variation       886
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758741662"
     variation       890
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780316234"
     variation       892
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554594367"
     variation       894
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769197999"
     variation       895
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773331571"
     variation       897
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267603603"
     variation       902
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777248037"
     variation       903
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952128611"
     variation       904
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202066753"
     variation       905..908
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="gtgg"
                     /db_xref="dbSNP:1566559140"
     variation       905
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1255791245"
     variation       910
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774001028"
     variation       911
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944167135"
     variation       913
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867870031"
     variation       914
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039477087"
     variation       918
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566559160"
     variation       922
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022750237"
     variation       925
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142957882"
     variation       926
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149185944"
     variation       927
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775190327"
     variation       928
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397293500"
     variation       929
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464194780"
     variation       930
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171606761"
     variation       932
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385280044"
     variation       933
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383399081"
     variation       935
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486969055"
     variation       943
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971226763"
     variation       947
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542007910"
     variation       951
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310655005"
     variation       955
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776846382"
     variation       956
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765428970"
     variation       958
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750617572"
     variation       959
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224544686"
     variation       960
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329110680"
     variation       962
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1232329180"
     variation       963
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758586625"
     variation       968
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766741235"
     variation       970
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956153433"
     variation       972
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751923359"
     variation       974
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193921005"
     exon            979..1068
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       987
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:947111400"
     variation       989
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1179532652"
     variation       991
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763221313"
     variation       992
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766573156"
     variation       999
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751780759"
     variation       1002
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536652034"
     variation       1010
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755282838"
     variation       1012
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281870068"
     variation       1013
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767895421"
     variation       1014
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753165199"
     variation       1015
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756656703"
     variation       1016
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151317566"
     variation       1018
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375756845"
     variation       1020
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2228225"
     variation       1021
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867823477"
     variation       1024
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779506563"
     variation       1034
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314946688"
     variation       1036
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320393599"
     variation       1037
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746681579"
     variation       1041
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953723851"
     variation       1042
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768531179"
     variation       1044
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484229448"
     variation       1049
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776606983"
     variation       1054
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748075302"
     variation       1056
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267603604"
     variation       1061
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868274692"
     variation       1062
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485799389"
     variation       1066
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769675836"
     variation       1068
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409773154"
     exon            1069..1206
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1070
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769632060"
     variation       1072..1075
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:35259058"
     variation       1074
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319057096"
     variation       1075..1076
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:765551090"
     variation       1075
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297268547"
     variation       1077
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943769649"
     variation       1078..1079
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1228287808"
     variation       1080
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777509564"
     variation       1081
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1221339030"
     variation       1085
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200793383"
     variation       1090
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145720544"
     variation       1091
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138672716"
     variation       1096
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215799189"
     variation       1097
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040509893"
     variation       1098
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774457842"
     variation       1099
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759734150"
     variation       1102
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455558333"
     variation       1103
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929570412"
     variation       1104
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253601449"
     variation       1105
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478880212"
     variation       1106
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772340309"
     variation       1107
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751422534"
     variation       1108..1116
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gagagagag"
                     /replace="gagagagagag"
                     /db_xref="dbSNP:1566559797"
     variation       1108
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369404558"
     variation       1112
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760883025"
     variation       1114..1119
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gag"
                     /replace="gaggag"
                     /db_xref="dbSNP:551702105"
     variation       1116
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420007538"
     variation       1117
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764532761"
     variation       1119
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754258666"
     variation       1120
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762421780"
     variation       1122
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757173437"
     variation       1123
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200097138"
     variation       1124
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202128734"
     variation       1129
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755812887"
     variation       1134
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224014610"
     variation       1136
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777659251"
     variation       1138
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749153176"
     variation       1139
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770953450"
     variation       1148
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1273736602"
     variation       1149
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778953216"
     variation       1150
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295583467"
     variation       1154
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234477341"
     variation       1156
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746017407"
     variation       1157
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548133983"
     variation       1158
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200970693"
     variation       1164
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384101876"
     variation       1169
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183121569"
     variation       1173
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414522837"
     variation       1175
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471642360"
     variation       1180
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747277465"
     variation       1184
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594744867"
     variation       1185
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867676131"
     variation       1187
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768871917"
     variation       1188
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777102193"
     variation       1191
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1321934189"
     variation       1193
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349631593"
     variation       1194
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762210448"
     variation       1197
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141172443"
     variation       1198
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773857943"
     variation       1202
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227177051"
     variation       1206
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202244680"
     exon            1207..1356
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1207
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773802622"
     variation       1209
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763581365"
     variation       1210
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113210621"
     variation       1218
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150321991"
     variation       1219
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775119859"
     variation       1221
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972497346"
     variation       1230
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7973381"
     variation       1231
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574196970"
     variation       1232
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594745250"
     variation       1237
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200444628"
     variation       1238
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201621277"
     variation       1242
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429563880"
     variation       1245
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412421532"
     variation       1248
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200253557"
     variation       1249
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758378363"
     variation       1255
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412253333"
     variation       1256
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332932674"
     variation       1259..1265
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:759448855"
     variation       1259
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368789621"
     variation       1260
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547877619"
     variation       1261
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770240474"
     variation       1262
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486673896"
     variation       1263
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364157130"
     variation       1264
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563340967"
     variation       1268
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774861127"
     variation       1269
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760165946"
     variation       1272
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440952727"
     variation       1276
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768066916"
     variation       1277
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776298132"
     variation       1278
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:569102560"
     variation       1280
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948970008"
     variation       1299
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465714577"
     variation       1309
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761485628"
     variation       1317
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372783357"
     variation       1319
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:928625407"
     variation       1330
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1449223777"
     variation       1335
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149505567"
     variation       1336
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374948623"
     variation       1342
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476843535"
     variation       1345
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053141462"
     variation       1346
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765329581"
     variation       1347
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766271134"
     variation       1353
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751462222"
     variation       1355
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755035040"
     variation       1356
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781158659"
     exon            1357..1521
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1357
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754128019"
     variation       1362
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879212259"
     variation       1364
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376773615"
     variation       1366
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779176901"
     variation       1369
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369128119"
     variation       1370
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767216717"
     variation       1371
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780675361"
     variation       1376
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144052713"
     variation       1378
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168996924"
     variation       1380
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145633975"
     variation       1384
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772799269"
     variation       1385
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373249560"
     variation       1386
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372663036"
     variation       1389
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545825775"
     variation       1390
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774058977"
     variation       1392
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759508068"
     variation       1394
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594746365"
     variation       1403
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564027387"
     variation       1404
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275825411"
     variation       1406
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594746378"
     variation       1407
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775575516"
     variation       1410
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377325662"
     variation       1411
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764293116"
     variation       1415..1421
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cacac"
                     /replace="cacacac"
                     /db_xref="dbSNP:1483280901"
     variation       1419
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157564500"
     variation       1421
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754075170"
     variation       1422
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141285593"
     variation       1426
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423191974"
     variation       1428
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594746428"
     variation       1430
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018269403"
     variation       1436
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765613579"
     variation       1439
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162872976"
     variation       1440
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774006233"
     variation       1445
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1443049195"
     variation       1447
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427628204"
     variation       1449
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141854128"
     variation       1450
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913242901"
     variation       1454
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466556322"
     variation       1455
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304673813"
     variation       1458
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780481000"
     variation       1459
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452587369"
     variation       1460
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779647343"
     variation       1465
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753096494"
     variation       1467
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299042662"
     variation       1472
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201283310"
     variation       1473
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747536601"
     variation       1477
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200802561"
     variation       1478
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748944886"
     variation       1482
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770550363"
     variation       1483
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357736300"
     variation       1485
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761530684"
     variation       1486
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460787785"
     variation       1487
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745587766"
     variation       1489
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772010511"
     variation       1497
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288588785"
     variation       1504
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447419974"
     variation       1516
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775520299"
     variation       1518
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419002793"
     variation       1519
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760726253"
     exon            1522..1752
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1524
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365704832"
     variation       1526
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373770232"
     variation       1527
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146290478"
     variation       1530
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61734545"
     variation       1534
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562388922"
     variation       1539
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182931922"
     variation       1547
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746732590"
     variation       1553
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768582577"
     variation       1554
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748147467"
     variation       1555
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415230750"
     variation       1558
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142822754"
     variation       1559
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913592640"
     variation       1563
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773386609"
     variation       1566..1568
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1374040698"
     variation       1566
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763145901"
     variation       1568
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377756221"
     variation       1570
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430036137"
     variation       1577
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774005775"
     variation       1578
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376198615"
     variation       1581
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774563719"
     variation       1582
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759838377"
     variation       1583
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381253752"
     variation       1584
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226340031"
     variation       1587
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767951729"
     variation       1588
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761649230"
     variation       1593
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753108698"
     variation       1600
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289816548"
     variation       1601
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206103248"
     variation       1614
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761285829"
     variation       1615
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764631331"
     variation       1618
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750013335"
     variation       1620
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225149370"
     variation       1624
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238490848"
     variation       1625
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332819968"
     variation       1627
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370035260"
     variation       1630
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374429707"
     variation       1631
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754780184"
     variation       1633
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374433509"
     variation       1634
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594747075"
     variation       1636
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374063272"
     variation       1637
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376293205"
     variation       1639
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749295894"
     variation       1640
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771013899"
     variation       1644
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360773328"
     variation       1648
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774512369"
     variation       1651
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772813225"
     variation       1652
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365637290"
     variation       1653
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397648095"
     variation       1654
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230414150"
     variation       1657
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925036184"
     variation       1658
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114543757"
     variation       1660
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195244430"
     variation       1669
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:76639319"
     variation       1675
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772293856"
     variation       1677
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207985566"
     variation       1680
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256538585"
     variation       1685
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775972834"
     variation       1691
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202305900"
     variation       1694
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761075652"
     variation       1696
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564218374"
     variation       1697
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777289743"
     variation       1703
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762501146"
     variation       1705
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200169408"
     variation       1708
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1184579144"
     variation       1710
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438678263"
     variation       1711
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272008775"
     variation       1714
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172618277"
     variation       1727
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1346897982"
     variation       1735
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:878961758"
     variation       1745..1746
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="cctggc"
                     /db_xref="dbSNP:1467821574"
     variation       1751
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751225573"
     exon            1753..2020
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       1755
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324448453"
     variation       1763
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347624463"
     variation       1767
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403117676"
     variation       1770
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768923096"
     variation       1773
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361543026"
     variation       1774
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777236611"
     variation       1775
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565600752"
     variation       1781
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241770121"
     variation       1793
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368194993"
     variation       1800
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385471691"
     variation       1801
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316321490"
     variation       1802..1805
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:771400496"
     variation       1802
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765965806"
     variation       1805
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149950420"
     variation       1806
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754004514"
     variation       1807
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198007042"
     variation       1808
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437303769"
     variation       1811
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305707895"
     variation       1812
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752303305"
     variation       1813
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594748345"
     variation       1816
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760472253"
     variation       1820
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763911800"
     variation       1823
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363221091"
     variation       1826
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924034005"
     variation       1827
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:536622160"
     variation       1832
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200730656"
     variation       1838
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360086366"
     variation       1839
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753749360"
     variation       1844
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164792355"
     variation       1850
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367624794"
     variation       1851
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423007254"
     variation       1852
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302817146"
     variation       1858..1862
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:757280991"
     variation       1860
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936467728"
     variation       1862
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374392091"
     variation       1863
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385672853"
     variation       1868
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757234675"
     variation       1876
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335695170"
     variation       1877
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890425801"
     variation       1880
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471801240"
     variation       1881
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594748437"
     variation       1890
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199949777"
     variation       1898
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778951240"
     variation       1901
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750584946"
     variation       1905
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221239451"
     variation       1907
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274977868"
     variation       1910
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368186732"
     variation       1912
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780272131"
     variation       1915
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185679191"
     variation       1916
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769033058"
     variation       1922
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445951282"
     variation       1923
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781723374"
     variation       1926
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748647850"
     variation       1927
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:12578516"
     variation       1929
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201902084"
     variation       1930
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139792497"
     variation       1931
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759027001"
     variation       1933
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533875222"
     variation       1934
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775171324"
     variation       1935
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565600916"
     variation       1936
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396343650"
     variation       1941
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757858450"
     variation       1945
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397157719"
     variation       1948
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890152411"
     variation       1949
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760289179"
     variation       1950
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381018330"
     variation       1951
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763858681"
     variation       1959
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372330353"
     variation       1960
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866686999"
     variation       1961
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753690500"
     variation       1971
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761735108"
     variation       1972
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149817893"
     variation       1973
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147931475"
     variation       1974
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551972267"
     variation       1977
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572499706"
     variation       1978
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566564028"
     variation       1980
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241265150"
     variation       1981
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963099490"
     variation       1983
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573996360"
     variation       1986
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188983269"
     variation       1987
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375428680"
     variation       1988
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781683841"
     variation       1990
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565600997"
     variation       2001
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113261025"
     variation       2002
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168450436"
     variation       2003
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372547639"
     variation       2004
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74607574"
     variation       2006
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990717142"
     variation       2010
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339260181"
     variation       2012
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565601019"
     variation       2016
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404539821"
     variation       2019
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756280054"
     variation       2020
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774916232"
     exon            2021..3972
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /inference="alignment:Splign:2.1.0"
     variation       2021
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440205364"
     variation       2025
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286322318"
     variation       2027
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314898459"
     variation       2028
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1193195281"
     variation       2033
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487397766"
     variation       2035
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756509884"
     variation       2036
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147758271"
     variation       2038
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749783306"
     variation       2039
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200306754"
     variation       2040
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201160292"
     variation       2041
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779612265"
     variation       2045
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746451282"
     variation       2046
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277549766"
     variation       2047
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144673003"
     variation       2054..2060
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="tctct"
                     /replace="tctctct"
                     /db_xref="dbSNP:1565601334"
     variation       2054
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529336310"
     variation       2055
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410893989"
     variation       2057
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747836770"
     variation       2058
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769607622"
     variation       2065
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544591554"
     variation       2066
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426197874"
     variation       2068
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143462399"
     variation       2069..2079
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gcagcagcagc"
                     /replace="gcagcagcagcagc"
                     /db_xref="dbSNP:1565601374"
     variation       2069
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766159479"
     variation       2079
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344298200"
     variation       2081..2125
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cc"
                     /replace="ccagcagcatcagctctgcctatactgtcagccgccgctcctccc"
                     /db_xref="dbSNP:1292282829"
     variation       2081
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372102723"
     variation       2090
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200128720"
     variation       2093
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756456896"
     variation       2100
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764510209"
     variation       2102
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424981970"
     variation       2103
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169976955"
     variation       2106
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368955379"
     variation       2109
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757646785"
     variation       2113
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201845227"
     variation       2114
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746398371"
     variation       2116
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371089900"
     variation       2117
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972690369"
     variation       2119
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029055257"
     variation       2123
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780728258"
     variation       2138
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594749403"
     variation       2139..2144
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1469076238"
     variation       2140
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747785448"
     variation       2141
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201050450"
     variation       2143
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368138761"
     variation       2148
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774389140"
     variation       2149
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325105370"
     variation       2154
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594749448"
     variation       2155
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275055587"
     variation       2158
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759589302"
     variation       2160
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409981398"
     variation       2163
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352577490"
     variation       2164
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267603605"
     variation       2165
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566991727"
     variation       2167
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775773783"
     variation       2169
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="agga"
                     /db_xref="dbSNP:750484015"
     variation       2170
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565601582"
     variation       2171
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367578462"
     variation       2174
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764155302"
     variation       2175
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393506116"
     variation       2179
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754106947"
     variation       2181
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298762614"
     variation       2182
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527900026"
     variation       2190
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200441300"
     variation       2195
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765668438"
     variation       2198
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464108125"
     variation       2204
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750904883"
     variation       2208
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275248871"
     variation       2212
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758959112"
     variation       2213
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199642258"
     variation       2222
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755663159"
     variation       2225
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541715256"
     variation       2230
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777242040"
     variation       2234
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1594749587"
     variation       2236..2240
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:758888293"
     variation       2236
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1183640785"
     variation       2237
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376908129"
     variation       2238
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169328437"
     variation       2239
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196728531"
     variation       2240
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416740082"
     variation       2242
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147997893"
     variation       2243
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199397071"
     variation       2245
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337303625"
     variation       2247
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745789057"
     variation       2249
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201538749"
     variation       2250
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775573332"
     variation       2253
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537462592"
     variation       2261
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262154436"
     variation       2262
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431720295"
     variation       2265
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768806308"
     variation       2269
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776679783"
     variation       2270
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309131329"
     variation       2273
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042660638"
     variation       2275
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368078339"
     variation       2276
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765569651"
     variation       2283
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594749714"
     variation       2286
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594749724"
     variation       2291
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202123173"
     variation       2293
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915631630"
     variation       2295
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750849875"
     variation       2296
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763307946"
     variation       2297
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766813817"
     variation       2299
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368007733"
     variation       2300
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372578437"
     variation       2303
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474754798"
     variation       2310
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375530514"
     variation       2311
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594749795"
     variation       2312
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753413155"
     variation       2314
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756993955"
     variation       2315
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370091854"
     variation       2316
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758285802"
     variation       2317
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768202810"
     variation       2319
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320531045"
     variation       2320
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772925983"
     variation       2327
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011961312"
     variation       2328
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324916083"
     variation       2329
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747001298"
     variation       2330
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200861277"
     variation       2331..2339
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="caaccccaa"
                     /replace="caaccccaaccccaa"
                     /db_xref="dbSNP:567028356"
     variation       2331
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216936106"
     variation       2334
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284034226"
     variation       2337
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046558361"
     variation       2339
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906720694"
     variation       2340
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140787723"
     variation       2342
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555698950"
     variation       2344
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359000505"
     variation       2346
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052659957"
     variation       2348
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594749920"
     variation       2351
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263121069"
     variation       2352
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773432190"
     variation       2353
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200606293"
     variation       2354
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538595523"
     variation       2358
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760136877"
     variation       2361
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1025589770"
     variation       2363
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192194289"
     variation       2365
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763500947"
     variation       2368
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753456662"
     variation       2374
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565601979"
     variation       2376
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479201313"
     variation       2385
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156535019"
     variation       2386
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756725183"
     variation       2387
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367789336"
     variation       2394
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750127418"
     variation       2396
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414375643"
     variation       2400
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156610504"
     variation       2409
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162641159"
     variation       2412
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758230546"
     variation       2413
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419295145"
     variation       2418
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374770255"
     variation       2419
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367515244"
     variation       2421
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199771479"
     variation       2425
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755006681"
     variation       2428
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336880663"
     variation       2431
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780992909"
     variation       2432
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748196652"
     variation       2433
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769883630"
     variation       2434
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150127797"
     variation       2435
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018123186"
     variation       2439
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749550712"
     variation       2440
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572181120"
     variation       2442
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759958035"
     variation       2443
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420836393"
     variation       2446
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768002671"
     variation       2447
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775875244"
     variation       2452
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138680284"
     variation       2454
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764875346"
     variation       2455
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460485464"
     variation       2458
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750072514"
     variation       2459
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961821733"
     variation       2460
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200832683"
     variation       2462
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766080250"
     variation       2463
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751298406"
     variation       2471
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200775132"
     variation       2480
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594750151"
     variation       2482
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166115603"
     variation       2484
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754739068"
     variation       2486
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974867444"
     variation       2487
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781130699"
     variation       2488
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594750178"
     variation       2490
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752607845"
     variation       2496
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350292114"
     variation       2501
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376612340"
     variation       2502
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754047324"
     variation       2503
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555605009"
     variation       2506
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356844630"
     variation       2507
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771211991"
     variation       2510
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971887652"
     variation       2512
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779008962"
     variation       2513
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193988375"
     variation       2514
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574150246"
     variation       2520
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:924226850"
     variation       2529..2534
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="tgctgc"
                     /replace="tgctgctgc"
                     /db_xref="dbSNP:1415181482"
     variation       2531
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185213050"
     variation       2532
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772346706"
     variation       2535
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443042358"
     variation       2537
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164399469"
     variation       2541
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186151497"
     variation       2545
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11553626"
     variation       2546
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372465556"
     variation       2553
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200049531"
     variation       2554
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920472026"
     variation       2560
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255413507"
     variation       2562
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772921336"
     variation       2564
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762554021"
     variation       2569
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339134061"
     variation       2570
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765994366"
     variation       2573
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141789719"
     variation       2579
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295917661"
     variation       2580
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148497133"
     variation       2582
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915604014"
     variation       2587
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450320226"
     variation       2590
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949814444"
     variation       2595
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895332687"
     variation       2596
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295739044"
     variation       2602
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767254882"
     variation       2607
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545410004"
     variation       2610
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276506226"
     variation       2614
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756100571"
     variation       2624
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241006818"
     variation       2628
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368023221"
     variation       2630
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1434036639"
     variation       2643
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594750411"
     variation       2645
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402320978"
     variation       2647
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331986744"
     variation       2649
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482834105"
     variation       2652
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181484660"
     variation       2658
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777827863"
     variation       2660
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430318516"
     variation       2661
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565602426"
     variation       2668
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753849741"
     variation       2669
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757297667"
     variation       2673
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779147398"
     variation       2677
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397557620"
     variation       2678
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138157845"
     variation       2679
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527901326"
     variation       2681
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465909682"
     variation       2684
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224563422"
     variation       2690
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924399161"
     variation       2695
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192168783"
     variation       2698
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747509020"
     variation       2699
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868283139"
     variation       2701
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769216016"
     variation       2702
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777287963"
     variation       2704
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377236422"
     variation       2707
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370486201"
     variation       2715
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052608281"
     variation       2716
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565602524"
     variation       2718
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311385347"
     variation       2720..2732
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cc"
                     /replace="ccaactatggccc"
                     /db_xref="dbSNP:1457367170"
     variation       2721
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373763385"
     variation       2729
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759160451"
     variation       2736
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486986666"
     variation       2738
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191551029"
     variation       2740
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201271317"
     variation       2742
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1565602554"
     variation       2742
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262535127"
     variation       2743
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752553799"
     variation       2749
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1011202054"
     variation       2751
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760469531"
     variation       2756
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763963114"
     variation       2757
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753796349"
     variation       2758
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160315310"
     variation       2763
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025729201"
     variation       2766
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755169191"
     variation       2767
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200374961"
     variation       2769
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297252492"
     variation       2773
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365646325"
     variation       2774
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750640199"
     variation       2780
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187351940"
     variation       2784
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309855392"
     variation       2785
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758609027"
     variation       2786
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780426081"
     variation       2790
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747317169"
     variation       2797
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308922331"
     variation       2798
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778898048"
     variation       2801
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594750714"
     variation       2802
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890755485"
     variation       2810
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755412722"
     variation       2811
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285655914"
     variation       2825
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781748757"
     variation       2827
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224828144"
     variation       2831
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352740229"
     variation       2833
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748704866"
     variation       2840
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478005717"
     variation       2842
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74473582"
     variation       2846
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358164612"
     variation       2850
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410588505"
     variation       2853
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173576787"
     variation       2854
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264071704"
     variation       2857
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050431269"
     variation       2858
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376640247"
     variation       2866
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773789139"
     variation       2873
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745528986"
     variation       2878
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771559868"
     variation       2879
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179799404"
     variation       2882
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:889144124"
     variation       2891
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775139874"
     variation       2899
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760414385"
     variation       2900
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112209004"
     variation       2903
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299872008"
     variation       2904
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370901839"
     variation       2905
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763909577"
     variation       2907
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776521977"
     variation       2910
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019421164"
     variation       2912
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149553839"
     variation       2915
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993256018"
     variation       2924
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765349183"
     variation       2925
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144246236"
     variation       2931
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750538854"
     variation       2934
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235168447"
     variation       2935
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148731765"
     variation       2939
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766657731"
     variation       2945
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751857353"
     variation       2946
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991841227"
     variation       2949
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446119227"
     variation       2950
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351358957"
     variation       2951
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594750946"
     variation       2952
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022618991"
     variation       2953
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412421207"
     variation       2957
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758320112"
     variation       2959
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371534575"
     variation       2962
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396082920"
     variation       2964
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549463047"
     variation       2965..2969
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:138706434"
     variation       2965
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398037874"
     variation       2966
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748674893"
     variation       2968
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61734542"
     variation       2969
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778346951"
     variation       2971
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454760110"
     variation       2974
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745312143"
     variation       2976
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355726787"
     variation       2980
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771594350"
     variation       2981
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363551405"
     variation       2987
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1275653248"
     variation       2989
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775084642"
     variation       2990..2992
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1419514748"
     variation       2990
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198368567"
     variation       2992
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746704993"
     variation       2994
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924318741"
     variation       2996
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594751051"
     variation       2997..3001
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1462976482"
     variation       2997
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768421030"
     variation       2998
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236536860"
     variation       2999
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475421218"
     variation       3001
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:923953698"
     variation       3004
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178054958"
     variation       3006
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761808837"
     variation       3008..3014
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ctcc"
                     /replace="ctcctcc"
                     /db_xref="dbSNP:1296211279"
     variation       3012
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765021502"
     variation       3015
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594751123"
     variation       3018
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773220843"
     variation       3021
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199781192"
     variation       3029
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762897107"
     variation       3034
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408010708"
     variation       3035
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412611763"
     variation       3036
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489362555"
     variation       3038
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372410554"
     variation       3039
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332362969"
     variation       3040
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594751175"
     variation       3046
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215558059"
     variation       3048
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766602765"
     variation       3049..3053
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1565603031"
     variation       3049
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375975477"
     variation       3050
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759894568"
     variation       3052
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:564746380"
     variation       3054
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1338575157"
     variation       3054
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756516540"
     variation       3063
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1264372832"
     variation       3066
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326011304"
     variation       3067
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199105605"
     variation       3071
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277411648"
     variation       3074
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309887873"
     variation       3077..3088
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gg"
                     /replace="ggccttgcctgg"
                     /db_xref="dbSNP:1237111352"
     variation       3080
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219939562"
     variation       3085
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778095108"
     variation       3091
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565603075"
     variation       3095
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754400912"
     variation       3096
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142356674"
     variation       3098
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399761461"
     variation       3102
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779592638"
     variation       3106
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746655729"
     variation       3114
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1038936270"
     variation       3116
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768365951"
     variation       3120
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171805845"
     variation       3121
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780905505"
     variation       3122
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747845466"
     variation       3126
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769660379"
     variation       3128
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349827041"
     variation       3132
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777734120"
     variation       3133
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763029899"
     variation       3136
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147494642"
     variation       3138
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333350818"
     variation       3139
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1231469327"
     variation       3145
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274597002"
     variation       3146
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774638929"
     variation       3147
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201832885"
     variation       3148
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283519778"
     variation       3153
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752986838"
     variation       3157
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760909851"
     variation       3160
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764559524"
     variation       3164
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754279016"
     variation       3167
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371696253"
     variation       3171
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198130885"
     variation       3177
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364142518"
     variation       3178
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253674081"
     variation       3180
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471073782"
     variation       3181
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757823205"
     variation       3182
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269271138"
     variation       3184
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779539699"
     variation       3186
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378709837"
     variation       3187
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1419118110"
     variation       3196
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488078943"
     variation       3197
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201302136"
     variation       3199
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754500775"
     variation       3200
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393016876"
     variation       3201
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780665940"
     variation       3202
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368469814"
     variation       3206
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777679896"
     variation       3209
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749232881"
     variation       3215
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565603289"
     variation       3221..3224
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1325038172"
     variation       3224
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1303794084"
     variation       3229
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1306560005"
     variation       3233
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1051088256"
     variation       3237..3242
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:747342182"
     variation       3238
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246021821"
     variation       3240
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378552524"
     variation       3242
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2228224"
     variation       3246
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467218481"
     variation       3254
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353712383"
     variation       3256
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209154299"
     variation       3262
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536075646"
     variation       3263
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145582008"
     variation       3265
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594751574"
     variation       3271
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775544248"
     variation       3272
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147740622"
     variation       3275
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565603366"
     variation       3276
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764355608"
     variation       3277
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439280977"
     variation       3286
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554710046"
     variation       3289
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370254161"
     variation       3290
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456515400"
     variation       3293
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1594751640"
     variation       3296
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770718402"
     variation       3301
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594751650"
     variation       3306
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007873244"
     variation       3309
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556698293"
     variation       3315
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565603415"
     variation       3326
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765678067"
     variation       3328
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449397447"
     variation       3331
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866379238"
     variation       3339
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899732852"
     variation       3343
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750955978"
     variation       3351
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754449613"
     variation       3352
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314505880"
     variation       3357
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201892411"
     variation       3358
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867901056"
     variation       3359
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451174384"
     variation       3373
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243442634"
     variation       3376
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251765243"
     variation       3381
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180478056"
     variation       3386
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319949591"
     variation       3389
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752275003"
     variation       3391
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257165110"
     variation       3392
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461647143"
     variation       3397
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394608554"
     variation       3412
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184432538"
     variation       3413
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370413110"
     variation       3422
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442415390"
     variation       3424
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777293425"
     variation       3427
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538381147"
     variation       3428
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757139167"
     variation       3431
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467617601"
     variation       3432
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169226311"
     variation       3437
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1346608298"
     variation       3441
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778954777"
     variation       3445
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470547300"
     variation       3447
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61734543"
     variation       3456
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745840526"
     variation       3457
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301885056"
     variation       3458
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772024116"
     variation       3460
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775698948"
     variation       3461
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295636010"
     variation       3475
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61739569"
     variation       3479
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2229300"
     variation       3484
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216707027"
     variation       3495
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768859183"
     variation       3498
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224740711"
     variation       3499
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776855654"
     variation       3504
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202139821"
     variation       3506
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257932005"
     variation       3509
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1482417398"
     variation       3510
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1594751995"
     variation       3513
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000032629"
     variation       3520
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762119826"
     variation       3521
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594752030"
     variation       3524
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765626709"
     variation       3527
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773683435"
     variation       3531
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766931594"
     variation       3532
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027428919"
     variation       3536
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887643010"
     variation       3542
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480937061"
     variation       3543
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752183280"
     variation       3544
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1357823068"
     variation       3545
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755592734"
     variation       3550
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763752118"
     variation       3552
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753577718"
     variation       3563..3564
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1397593307"
     variation       3564
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757087862"
     variation       3572..3577
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="aca"
                     /replace="acaaca"
                     /db_xref="dbSNP:769057123"
     variation       3574
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778903349"
     variation       3576
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745789152"
     variation       3580
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758432160"
     variation       3582
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232793267"
     variation       3586
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779862855"
     variation       3591
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747056747"
     variation       3594
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309595967"
     variation       3601
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768645054"
     variation       3605
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263043549"
     variation       3610..3613
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1489072730"
     variation       3612
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138630661"
     variation       3614
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:578089149"
     variation       3615
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776799753"
     variation       3618
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433035386"
     variation       3624..3633
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="tcctcct"
                     /replace="tcctcctcct"
                     /db_xref="dbSNP:777386845"
     variation       3628
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748413929"
     variation       3634
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237502199"
     variation       3635
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770128594"
     variation       3640
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371558176"
     variation       3643
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565604047"
     variation       3646
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149870317"
     variation       3647
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144893788"
     variation       3648
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763738465"
     variation       3650
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256380503"
     variation       3652
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761617989"
     variation       3653
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916865788"
     variation       3658
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765120932"
     variation       3660
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310193982"
     variation       3661
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278558735"
     variation       3664
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1594752465"
     variation       3665
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149048217"
     variation       3666
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200550278"
     variation       3671
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751486798"
     variation       3673
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144663837"
     variation       3676..3715
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="tctgggccccccaacatggctgtgggcaacatgagtgtct"
                     /replace="tctgggccccccaacatggctgtgggcaacatgagtgtctgggccccc
                     caacatggctgtgggcaacatgagtgtct"
                     /db_xref="dbSNP:1224419591"
     variation       3680
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781302385"
     variation       3682..3687
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1488325542"
     variation       3686
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748362709"
     variation       3689
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239576042"
     variation       3693
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342384762"
     variation       3707
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437404075"
     variation       3710
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769935841"
     variation       3711..3715
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="t"
                     /replace="tgtct"
                     /db_xref="dbSNP:1335100582"
     variation       3711
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146709610"
     variation       3712
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749615188"
     variation       3714
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162521928"
     variation       3717
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771230727"
     variation       3720
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1299740540"
     variation       3725
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267603606"
     variation       3726
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140333004"
     variation       3731
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561194556"
     variation       3732
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760011194"
     variation       3734
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768270155"
     variation       3735
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308886521"
     variation       3737
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368596205"
     variation       3740
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:749032566"
     variation       3741
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776347757"
     variation       3742
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2228226"
     variation       3747
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264920795"
     variation       3751..3752
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:770491031"
     variation       3757
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488849799"
     variation       3758
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914337244"
     variation       3760
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409856982"
     variation       3761
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764926851"
     variation       3762
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61734544"
     variation       3769
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368262823"
     variation       3771
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912295731"
     variation       3773
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986317249"
     variation       3774
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762773153"
     variation       3776
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353756846"
     variation       3778
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766133060"
     variation       3779..3782
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace=""
                     /replace="tcat"
                     /db_xref="dbSNP:1280364194"
     variation       3780
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142801047"
     variation       3782
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116063694"
     variation       3788
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316113626"
     variation       3791
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781108666"
     variation       3792
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391367853"
     variation       3794
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752715126"
     variation       3795
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756206910"
     variation       3801
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777932431"
     variation       3803
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040351455"
     variation       3810
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749512706"
     variation       3811
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397839147"
     variation       3814
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771305150"
     variation       3821
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425774581"
     variation       3824
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929381868"
     variation       3825
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453768104"
     variation       3829
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291264561"
     variation       3830
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213100157"
     variation       3839
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:35711680"
     variation       3846
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463990037"
     variation       3847
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332836764"
     variation       3849
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:474058"
     variation       3851
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887881680"
     variation       3858
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361541901"
     variation       3866
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762606910"
     variation       3875
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449823008"
     variation       3876
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565846806"
     variation       3878
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459385371"
     variation       3882
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401931465"
     variation       3887
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170934694"
     variation       3891..3893
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1565604804"
     variation       3893
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536501886"
     variation       3895..3898
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1416956836"
     variation       3899
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907108358"
     variation       3900
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1594753260"
     variation       3906
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002814196"
     variation       3908
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377946102"
     variation       3909
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031327628"
     variation       3921
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214711148"
     variation       3929
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297077229"
     variation       3931
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:955662457"
     variation       3933
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199352836"
     variation       3936
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013580920"
     variation       3946
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011265856"
     regulatory      3948..3953
                     /regulatory_class="polyA_signal_sequence"
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="hexamer: AATAAA"
     variation       3956
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271172659"
     variation       3961
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1220716721"
     variation       3961
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345501162"
     variation       3963
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1594753355"
     variation       3970
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218489935"
     polyA_site      3972
                     /gene="GLI1"
                     /gene_synonym="GLI; PAPA8; PPD1"
                     /note="major polyA site"
ORIGIN      
gtaagcagtatagggtccctcaagggagggggaggatcctgggggtcctgggggtgcaataagcccggcaccccttctcttgcttccagctaccccgcctcatcctccagaacggcaagagggagggaaatagaagggaggtgaggggcgagcgggaagagcggcggcgcgccagcggctggagagagaaaaagtttttgcaaaagggaaaaaaaaagtttgcgcttctcgcgggtggtccgggcttgcggcccggcgggctgggccggcgggagggctgggggccaggttgggggggtgggggtggcatcgaggctgcgctgccgtggccctctccgccccccctccccaccgcacaccccccagcccagactccagccctggaccgcgcatcccgagcccagcgcccagacagagtgtccccacaccctcctctgagacgccatgttcaactcgatgaccccaccaccaatcagtagctatggcgagccctgctgtctccggcccctccccagtcagggggcccccagtgtggggacagaaggactgtctggcccgcccttctgccaccaagctaacctcatgtccggcccccacagttatgggccagccagagagaccaacagctgcaccgagggcccactcttttcttctccccggagtgcagtcaagttgaccaagaagcgggcactgtccatctcacctctgtcggatgccagcctggacctgcagacggttatccgcacctcacccagctccctcgtagctttcatcaactcgcgatgcacatctccaggaggctcctacggtcatctctccattggcaccatgagcccatctctgggattcccagcccagatgaatcaccaaaaagggccctcgccttcctttggggtccagccttgtggtccccatgactctgcccggggtgggatgatcccacatcctcagtcccggggacccttcccaacttgccagctgaagtctgagctggacatgctggttggcaagtgccgggaggaacccttggaaggtgatatgtccagccccaactccacaggcatacaggatcccctgttggggatgctggatgggcgggaggacctcgagagagaggagaagcgtgagcctgaatctgtgtatgaaactgactgccgttgggatggctgcagccaggaatttgactcccaagagcagctggtgcaccacatcaacagcgagcacatccacggggagcggaaggagttcgtgtgccactgggggggctgctccagggagctgaggcccttcaaagcccagtacatgctggtggttcacatgcgcagacacactggcgagaagccacacaagtgcacgtttgaagggtgccggaagtcatactcacgcctcgaaaacctgaagacgcacctgcggtcacacacgggtgagaagccatacatgtgtgagcacgagggctgcagtaaagccttcagcaatgccagtgaccgagccaagcaccagaatcggacccattccaatgagaagccgtatgtatgtaagctccctggctgcaccaaacgctatacagatcctagctcgctgcgaaaacatgtcaagacagtgcatggtcctgacgcccatgtgaccaaacggcaccgtggggatggccccctgcctcgggcaccatccatttctacagtggagcccaagagggagcgggaaggaggtcccatcagggaggaaagcagactgactgtgccagagggtgccatgaagccacagccaagccctggggcccagtcatcctgcagcagtgaccactccccggcagggagtgcagccaatacagacagtggtgtggaaatgactggcaatgcagggggcagcactgaagacctctccagcttggacgagggaccttgcattgctggcactggtctgtccactcttcgccgccttgagaacctcaggctggaccagctacatcaactccggccaatagggacccggggtctcaaactgcccagcttgtcccacaccggtaccactgtgtcccgccgcgtgggccccccagtctctcttgaacgccgcagcagcagctccagcagcatcagctctgcctatactgtcagccgccgctcctccctggcctctcctttcccccctggctccccaccagagaatggagcatcctccctgcctggccttatgcctgcccagcactacctgcttcgggcaagatatgcttcagccagagggggtggtacttcgcccactgcagcatccagcctggatcggataggtggtcttcccatgcctccttggagaagccgagccgagtatccaggatacaaccccaatgcaggggtcacccggagggccagtgacccagcccaggctgctgaccgtcctgctccagctagagtccagaggttcaagagcctgggctgtgtccataccccacccactgtggcagggggaggacagaactttgatccttacctcccaacctctgtctactcaccacagccccccagcatcactgagaatgctgccatggatgctagagggctacaggaagagccagaagttgggacctccatggtgggcagtggtctgaacccctatatggacttcccacctactgatactctgggatatgggggacctgaaggggcagcagctgagccttatggagcgaggggtccaggctctctgcctcttgggcctggtccacccaccaactatggccccaacccctgtccccagcaggcctcatatcctgaccccacccaagaaacatggggtgagttcccttcccactctgggctgtacccaggccccaaggctctaggtggaacctacagccagtgtcctcgacttgaacattatggacaagtgcaagtcaagccagaacaggggtgcccagtggggtctgactccacaggactggcaccctgcctcaatgcccaccccagtgaggggcccccacatccacagcctctcttttcccattacccccagccctctcctccccaatatctccagtcaggcccctatacccagccaccccctgattatcttccttcagaacccaggccttgcctggactttgattcccccacccattccacagggcagctcaaggctcagcttgtgtgtaattatgttcaatctcaacaggagctactgtgggagggtgggggcagggaagatgcccccgcccaggaaccttcctaccagagtcccaagtttctggggggttcccaggttagcccaagccgtgctaaagctccagtgaacacatatggacctggctttggacccaacttgcccaatcacaagtcaggttcctatcccaccccttcaccatgccatgaaaattttgtagtgggggcaaatagggcttcacatagggcagcagcaccacctcgacttctgcccccattgcccacttgctatgggcctctcaaagtgggaggcacaaaccccagctgtggtcatcctgaggtgggcaggctaggagggggtcctgccttgtaccctcctcccgaaggacaggtatgtaaccccctggactctcttgatcttgacaacactcagctggactttgtggctattctggatgagccccaggggctgagtcctcctccttcccatgatcagcggggcagctctggacataccccacctccctctgggccccccaacatggctgtgggcaacatgagtgtcttactgagatccctacctggggaaacagaattcctcaactctagtgcctaaagagtagggaatctcatccatcacagatcgcatttcctaaggggtttctatccttccagaaaaattgggggagctgcagtcccatgcacaagatgccccagggatgggaggtatgggctgggggctatgtatagtctgtatacgttttgaggagaaatttgataatgacactgtttcctgataataaaggaactgcatcagaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]