GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:04:20, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_004178               1448 bp    mRNA    linear   PRI 03-FEB-2020
DEFINITION  Homo sapiens TARBP2 subunit of RISC loading complex (TARBP2),
            transcript variant 3, mRNA.
ACCESSION   NM_004178
VERSION     NM_004178.4
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1448)
  AUTHORS   Fish L, Navickas A, Culbertson B, Xu Y, Nguyen HCB, Zhang S,
            Hochman M, Okimoto R, Dill BD, Molina H, Najafabadi HS, Alarcon C,
            Ruggero D and Goodarzi H.
  TITLE     Nuclear TARBP2 Drives Oncogenic Dysregulation of RNA Splicing and
            Decay
  JOURNAL   Mol. Cell 75 (5), 967-981 (2019)
   PUBMED   31300274
  REMARK    GeneRIF: TARBP2 affects tumor growth in the lung and that this is
            dependent on TARBP2-mediated destabilization of ABCA3 and FOXN3.
            Finally, we establish ZNF143 as an upstream regulator of TARBP2
            expression.
REFERENCE   2  (bases 1 to 1448)
  AUTHORS   Ling T, Weng GX, Li J, Li C, Wang W, Cao L, Rao H, Ju C and Xu LG.
  TITLE     TARBP2 inhibits IRF7 activation by suppressing TRAF6-mediated
            K63-linked ubiquitination of IRF7
  JOURNAL   Mol. Immunol. 109, 116-125 (2019)
   PUBMED   30927622
  REMARK    GeneRIF: TARBP2 participates in the interaction between IRF7 and
            TRAF6, thereby suppressing TRAF6-mediated K63-linked ubiquitination
            of IRF7.
REFERENCE   3  (bases 1 to 1448)
  AUTHORS   Lai HH, Li CW, Hong CC, Sun HY, Chiu CF, Ou DL and Chen PS.
  TITLE     TARBP2-mediated destabilization of Nanog overcomes sorafenib
            resistance in hepatocellular carcinoma
  JOURNAL   Mol Oncol 13 (4), 928-945 (2019)
   PUBMED   30657254
  REMARK    GeneRIF: The TARBP2 protein was destabilized through
            autophagic-lysosomal proteolysis, thereby stabilizing the
            expression of the cancer stem cell marker protein Nanog, which
            facilitates sorafenib resistance in Hepatocellular carcinoma cells.
REFERENCE   4  (bases 1 to 1448)
  AUTHORS   Ling T, Li SN, Weng GX, Wang W, Li C, Cao L, Rao H, Shu HB and Xu
            LG.
  TITLE     TARBP2 negatively regulates IFN-beta production and innate
            antiviral response by targeting MAVS
  JOURNAL   Mol. Immunol. 104, 1-10 (2018)
   PUBMED   30390472
  REMARK    GeneRIF: studies demonstrated that TARBP2 interacted with MAVS and
            targeted MAVS to abrogate MAVS-RIG-I and MAVS-TRAF3 association.
REFERENCE   5  (bases 1 to 1448)
  AUTHORS   Takahashi T, Nakano Y, Onomoto K, Murakami F, Komori C, Suzuki Y,
            Yoneyama M and Ui-Tei K.
  TITLE     LGP2 virus sensor regulates gene expression network mediated by
            TRBP-bound microRNAs
  JOURNAL   Nucleic Acids Res. 46 (17), 9134-9147 (2018)
   PUBMED   29939295
  REMARK    GeneRIF: LGP2 represses specific miRNA activities by interacting
            with TRBP, resulting in selective regulation of target genes. This
            novel function of LGP2 is to modulate RNA silencing, indicating the
            crosstalk between RNA silencing and RLR signaling in mammalian
            cells.
REFERENCE   6  (bases 1 to 1448)
  AUTHORS   Gatignol A, Duarte M, Daviet L, Chang YN and Jeang KT.
  TITLE     Sequential steps in Tat trans-activation of HIV-1 mediated through
            cellular DNA, RNA, and protein binding factors
  JOURNAL   Gene Expr. 5 (4-5), 217-228 (1996)
   PUBMED   8723388
REFERENCE   7  (bases 1 to 1448)
  AUTHORS   Cosentino GP, Venkatesan S, Serluca FC, Green SR, Mathews MB and
            Sonenberg N.
  TITLE     Double-stranded-RNA-dependent protein kinase and TAR RNA-binding
            protein form homo- and heterodimers in vivo
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (21), 9445-9449 (1995)
   PUBMED   7568151
REFERENCE   8  (bases 1 to 1448)
  AUTHORS   Kozak CA, Gatignol A, Graham K, Jeang KT and McBride OW.
  TITLE     Genetic mapping in human and mouse of the locus encoding TRBP, a
            protein that binds the TAR region of the human immunodeficiency
            virus (HIV-1)
  JOURNAL   Genomics 25 (1), 66-72 (1995)
   PUBMED   7774957
REFERENCE   9  (bases 1 to 1448)
  AUTHORS   Gatignol A, Buckler C and Jeang KT.
  TITLE     Relatedness of an RNA-binding motif in human immunodeficiency virus
            type 1 TAR RNA-binding protein TRBP to human P1/dsI kinase and
            Drosophila staufen
  JOURNAL   Mol. Cell. Biol. 13 (4), 2193-2202 (1993)
   PUBMED   8455607
REFERENCE   10 (bases 1 to 1448)
  AUTHORS   Gatignol A, Buckler-White A, Berkhout B and Jeang KT.
  TITLE     Characterization of a human TAR RNA-binding protein that activates
            the HIV-1 LTR
  JOURNAL   Science 251 (5001), 1597-1600 (1991)
   PUBMED   2011739
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC002419.2 and M60801.1.
            On Jan 18, 2006 this sequence version replaced NM_004178.3.
            
            Summary: HIV-1, the causative agent of acquired immunodeficiency
            syndrome (AIDS), contains an RNA genome that produces a
            chromosomally integrated DNA during the replicative cycle.
            Activation of HIV-1 gene expression by the transactivator Tat is
            dependent on an RNA regulatory element (TAR) located downstream of
            the transcription initiation site. The protein encoded by this gene
            binds between the bulge and the loop of the HIV-1 TAR RNA
            regulatory element and activates HIV-1 gene expression in synergy
            with the viral Tat protein. Alternative splicing results in
            multiple transcript variants encoding different isoforms. This gene
            also has a pseudogene. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (3) lacks an internal segment in
            the 5' region, and uses a downstream AUG codon for translation, as
            compared to variant 1. The encoded isoform (b) thus has a shorter
            N-terminus, as compared to isoform a.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M60801.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2148874, SAMEA2161674
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-32                BC002419.2         1-32
            33-452              M60801.1           1-420
            453-1448            BC002419.2         901-1896
FEATURES             Location/Qualifiers
     source          1..1448
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..1448
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="TARBP2 subunit of RISC loading complex"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
     exon            1..81
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382993327"
     variation       2
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388160787"
     variation       4
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457893755"
     variation       8
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436405261"
     variation       12
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:571814346"
     variation       19
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173000692"
     variation       29
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022881732"
     variation       30
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:965070175"
     variation       32
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976572287"
     variation       35
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:921066983"
     variation       43
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565896660"
     variation       46
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969993341"
     variation       48
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427579885"
     variation       67
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403942637"
     variation       69
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980750242"
     variation       70
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565896675"
     variation       73
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447988098"
     variation       75
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285235645"
     variation       76
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:954106731"
     variation       77
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565896694"
     variation       78
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1222411039"
     variation       81
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175123103"
     exon            82..246
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       82
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954159306"
     variation       83
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776121643"
     CDS             87..1124
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="isoform b is encoded by transcript variant 3; TAR
                     (HIV) RNA-binding protein 2; trans-activation responsive
                     RNA-binding protein; TAR RNA binding protein 2;
                     RISC-loading complex subunit TARBP2; TAR (HIV) RNA-binding
                     protein TRBP1; TAR (HIV-1) RNA binding protein 2; TARBP2,
                     RISC loading complex RNA binding subunit"
                     /codon_start=1
                     /product="RISC-loading complex subunit TARBP2 isoform b"
                     /protein_id="NP_004169.3"
                     /db_xref="CCDS:CCDS41791.1"
                     /db_xref="GeneID:6895"
                     /db_xref="HGNC:HGNC:11569"
                     /db_xref="MIM:605053"
                     /translation="
MLAANPGKTPISLLQEYGTRIGKTPVYDLLKAEGQAHQPNFTFRVTVGDTSCTGQGPSKKAAKHKAAEVALKHLKGGSMLEPALEDSSSFSPLDSSLPEDIPVFTAAAAATPVPSVVLTRSPPMELQPPVSPQQSECNPVGALQELVVQKGWRLPEYTVTQESGPAHRKEFTMTCRVERFIEIGSGTSKKLAKRNAAAKMLLRVHTVPLDARDGNEVEPDDDHFSIGVGSRLDGLRNRGPGCTWDSLRNSVGEKILSLRSCSLGSLGALGPACCRVLSELSEEQAFHVSYLDIEELSLSGLCQCLVELSTQPATVCHGSATTREAARGEAARRALQYLKIMAGSK"
     misc_feature    order(111..113,129..134,255..266,273..275)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     misc_feature    114..>260
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif; Region: DSRM;
                     smart00358"
                     /db_xref="CDD:214634"
     misc_feature    498..689
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="Double-stranded RNA binding motif. Binding is not
                     sequence specific but is highly specific for double
                     stranded RNA. Found in a variety of proteins including
                     dsRNA dependent protein kinase PKR, RNA helicases,
                     Drosophila staufen protein, E. coli RNase III; Region:
                     DSRM; cd00048"
                     /db_xref="CDD:238007"
     misc_feature    order(498..500,516..521,645..656,663..665)
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     variation       93
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309859516"
     variation       95
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771057883"
     variation       97
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690659"
     variation       99
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262810724"
     variation       102
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201806294"
     variation       107
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138314225"
     variation       113
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758015411"
     variation       115
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372439760"
     variation       116
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767974443"
     variation       126
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192856939"
     variation       147
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200955588"
     variation       152
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391904346"
     variation       157
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162993139"
     variation       158
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472107347"
     variation       167
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429327123"
     variation       169
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750705674"
     variation       174
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382746266"
     variation       182
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143814054"
     variation       185
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439231897"
     variation       191
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780361324"
     variation       198
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014274919"
     variation       208
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374404200"
     variation       209
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753982762"
     variation       215
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755169835"
     variation       223
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368515319"
     variation       224
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542850740"
     variation       225
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347448032"
     variation       226
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772132398"
     variation       236
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777651228"
     variation       238
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023348175"
     variation       244
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970176065"
     variation       245
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746713420"
     exon            247..349
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       255
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164684860"
     variation       272
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387489855"
     variation       275
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866781136"
     variation       281
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423213318"
     variation       282
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323511961"
     variation       293
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554613712"
     variation       294
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355136438"
     variation       297
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467754312"
     variation       300
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402072069"
     variation       301
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170948533"
     variation       303
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478389003"
     variation       306
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444514983"
     variation       311
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565898900"
     variation       312
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296633887"
     variation       313
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146234229"
     variation       314
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138922911"
     variation       315
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010245473"
     variation       317
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361367468"
     variation       319
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029867627"
     variation       321
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289122609"
     variation       324
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565898979"
     variation       330
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307535361"
     variation       332
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206092363"
     variation       336
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230810380"
     variation       341
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457000872"
     exon            350..445
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       353
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760147843"
     variation       355
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460234051"
     variation       357
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761011672"
     variation       360
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243185624"
     variation       362
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415958345"
     variation       364
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752833291"
     variation       368
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375489701"
     variation       370
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764228291"
     variation       373
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745993749"
     variation       374
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141294828"
     variation       381
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457898855"
     variation       383
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780987963"
     variation       386
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412536394"
     variation       387
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745624083"
     variation       390
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756051687"
     variation       391
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770393984"
     variation       392
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776097598"
     variation       394..395
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gcaggttggag"
                     /replace="gcaggttggagtttgttgctcctctggttcttgggtacaaagataccc
                     tc"
                     /db_xref="dbSNP:767162268"
     variation       397..398
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gttgctcctctggttcttgggtacaaagataccctcttc"
                     /db_xref="dbSNP:1223635437"
     variation       400
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1248163777"
     variation       408
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768121847"
     variation       409
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183009410"
     variation       412
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773885391"
     variation       415
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199537568"
     variation       419
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747773992"
     variation       428
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449119698"
     variation       431
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371431074"
     variation       432
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777136581"
     variation       434
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759919100"
     variation       438
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765682240"
     variation       440
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775926522"
     exon            446..518
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       446
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471036080"
     variation       447
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156673068"
     variation       448
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365833083"
     variation       449..455
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750181498"
     variation       450
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767214517"
     variation       451
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150772647"
     variation       452
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374358069"
     variation       453
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126157"
     variation       454
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374557769"
     variation       455
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329118435"
     variation       463
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975785057"
     variation       464
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337225186"
     variation       466
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444143862"
     variation       469
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308904527"
     variation       472..473
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:758159322"
     variation       473
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761830924"
     variation       475..483
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tctcccctc"
                     /replace="tctcccctctcccctc"
                     /db_xref="dbSNP:1305242054"
     variation       475
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149488319"
     variation       478
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366777172"
     variation       484
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750681842"
     variation       485
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760878717"
     variation       488
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766141345"
     variation       503
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145961214"
     variation       504
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569814780"
     variation       506
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178260351"
     variation       509
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778864218"
     variation       510
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445068208"
     variation       513
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189495402"
     exon            519..636
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       519
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167249207"
     variation       521
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139830544"
     variation       522
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017529442"
     variation       524
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775368806"
     variation       530
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266282543"
     variation       538
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762989017"
     variation       550
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1468672830"
     variation       551
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200766710"
     variation       554
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378855936"
     variation       558
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199668545"
     variation       560
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1240848066"
     variation       560
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756838679"
     variation       563
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309616693"
     variation       567
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766905092"
     variation       569
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750154771"
     variation       573
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755706552"
     variation       581
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779260033"
     variation       584
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748440443"
     variation       586
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3203547"
     variation       588
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340168203"
     variation       589
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317193037"
     variation       607
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991539629"
     variation       612
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140420856"
     variation       613
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304703342"
     variation       617
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377165322"
     variation       621
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771112623"
     variation       622
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776561374"
     variation       628
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322966734"
     variation       633
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218815083"
     variation       634
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264363271"
     variation       635
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386990720"
     variation       636
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480716144"
     exon            637..764
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       638
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200876264"
     variation       640
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781338254"
     variation       644
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745896435"
     variation       658
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263471950"
     variation       666
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181823540"
     variation       667
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310414330"
     variation       669
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908630420"
     variation       671
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770162814"
     variation       672
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360596837"
     variation       673
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957530072"
     variation       674
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490292161"
     variation       676
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990309686"
     variation       677
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190258088"
     variation       678
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368267516"
     variation       679
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470432970"
     variation       683
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768637478"
     variation       684
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360713175"
     variation       687
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445665081"
     variation       693
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252922819"
     variation       694
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:562284475"
     variation       695
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370797559"
     variation       698
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771834045"
     variation       700
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772806614"
     variation       701
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146166955"
     variation       703
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765847634"
     variation       704
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112692079"
     variation       705
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764458087"
     variation       709
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751806180"
     variation       711
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757814657"
     variation       714
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565901417"
     variation       718
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243946764"
     variation       720
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148798022"
     variation       721
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769109279"
     variation       723
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253025169"
     variation       728
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227984426"
     variation       730
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306446661"
     variation       742
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914943975"
     variation       743
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480862877"
     variation       744
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:945051944"
     variation       748
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756301639"
     variation       749
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412582897"
     variation       752
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333420845"
     variation       754
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361150643"
     variation       756
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401786389"
     variation       758
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295741009"
     variation       759
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780275010"
     variation       760
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042406221"
     variation       762
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749578666"
     variation       763
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768939962"
     exon            765..966
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       772
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778949628"
     variation       775
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1126500"
     variation       777
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054935527"
     variation       778
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944494841"
     variation       779
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748374345"
     variation       783
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039189459"
     variation       792
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758198296"
     variation       793
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387986904"
     variation       794
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777612501"
     variation       797
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331675284"
     variation       798
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746965828"
     variation       799
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445111857"
     variation       800
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770788999"
     variation       802
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776152218"
     variation       806
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247627871"
     variation       809
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373114872"
     variation       812
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369459694"
     variation       817
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355764465"
     variation       819
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313561496"
     variation       823
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463307270"
     variation       828
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769325580"
     variation       829
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759508001"
     variation       832
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458924600"
     variation       837
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196590779"
     variation       838
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443341256"
     variation       839
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762662765"
     variation       844..849
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="aga"
                     /replace="agaaga"
                     /db_xref="dbSNP:775195616"
     variation       848
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374237346"
     variation       852
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046307879"
     variation       853
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341587285"
     variation       856
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773651708"
     variation       857
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761266200"
     variation       861
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766949070"
     variation       862
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753986429"
     variation       864
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463743576"
     variation       865
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331015937"
     variation       868..886
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gctccctggg"
                     /replace="gctccctgggctccctggg"
                     /replace="gctccctgggctccctgggctccctggg"
                     /db_xref="dbSNP:760313807"
     variation       873
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755056741"
     variation       875
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765359372"
     variation       877
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752922813"
     variation       880..895
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="ccctggg"
                     /replace="ccctgggtgccctggg"
                     /db_xref="dbSNP:776328245"
     variation       881
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758592168"
     variation       882
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902214"
     variation       884
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777436345"
     variation       887
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557863636"
     variation       888..896
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="gccctgggc"
                     /db_xref="dbSNP:1332154856"
     variation       893
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:994678523"
     variation       897
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411548962"
     variation       898
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573277126"
     variation       900
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781157651"
     variation       901
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557386671"
     variation       904
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483483059"
     variation       906
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1359444252"
     variation       909
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202227515"
     variation       910
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769254353"
     variation       915
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485049554"
     variation       917
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775050428"
     variation       919
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425150109"
     variation       920
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476611229"
     variation       927
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169339085"
     variation       932
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748904808"
     variation       941
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902388"
     variation       947
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370082621"
     variation       948
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773741239"
     variation       961
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402193215"
     variation       965
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61499963"
     exon            967..1407
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /inference="alignment:Splign:2.1.0"
     variation       967
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489219038"
     variation       969
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189130688"
     variation       970
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471926971"
     variation       976
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764128981"
     variation       978
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568264666"
     variation       980
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944361913"
     variation       1004
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762008935"
     variation       1006
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011575053"
     variation       1013
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902749"
     variation       1015
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245217899"
     variation       1021
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372769309"
     variation       1022
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750164824"
     variation       1023
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151303646"
     variation       1033
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325665386"
     variation       1035
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565902807"
     variation       1037
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779990767"
     variation       1038
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753692741"
     variation       1040
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393422620"
     variation       1042
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447334061"
     variation       1047
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754571823"
     variation       1049
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778556313"
     variation       1065
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747821228"
     variation       1066
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771785979"
     variation       1067
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290294258"
     variation       1073
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781716209"
     variation       1077
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387428580"
     variation       1080
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535268850"
     variation       1081
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573462744"
     variation       1083
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034727"
     variation       1084
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140535249"
     variation       1085
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770792947"
     variation       1086
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1177356537"
     variation       1088
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200848880"
     variation       1092
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763366180"
     variation       1095
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480566806"
     variation       1100
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182971982"
     variation       1102
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383312955"
     variation       1107
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416021586"
     variation       1110
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422180932"
     variation       1115
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768780952"
     variation       1117
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424684422"
     variation       1119
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774355466"
     variation       1125
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568796843"
     variation       1129
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767686359"
     variation       1130
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750204119"
     variation       1133
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1303409598"
     variation       1134
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380699334"
     variation       1136
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423088988"
     variation       1141
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539489466"
     variation       1142
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766053638"
     variation       1144
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753874744"
     variation       1145
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754908800"
     variation       1146
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247635221"
     variation       1148..1159
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tgc"
                     /replace="tgcaccctttgc"
                     /db_xref="dbSNP:750331078"
     variation       1149
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764848884"
     variation       1150
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376072604"
     variation       1152
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752218932"
     variation       1154
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758146970"
     variation       1155
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482312106"
     variation       1157
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462439135"
     variation       1158
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201937693"
     variation       1161..1176
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="cc"
                     /replace="ccctgctctttctgcc"
                     /db_xref="dbSNP:758150043"
     variation       1161
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371130451"
     variation       1162
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168828171"
     variation       1163
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756569872"
     variation       1164
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409223430"
     variation       1166
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015897163"
     variation       1167..1173
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tct"
                     /replace="tctttct"
                     /db_xref="dbSNP:766141270"
     variation       1168
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375653873"
     variation       1175
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990519804"
     variation       1179
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364100736"
     variation       1181
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241444633"
     variation       1182
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2531"
     variation       1187
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540730822"
     variation       1189..1191
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:1294930306"
     variation       1190
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433367946"
     variation       1195
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895247433"
     variation       1196
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865946250"
     variation       1200
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466021617"
     variation       1204
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022441650"
     variation       1208
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170635842"
     variation       1209
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450151580"
     variation       1214..1220
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gtg"
                     /replace="gtgggtg"
                     /db_xref="dbSNP:1474369753"
     variation       1214
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555550158"
     variation       1224
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186834640"
     variation       1225
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418677935"
     variation       1228
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978399323"
     variation       1230
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425362598"
     variation       1238
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463064142"
     variation       1239
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256531694"
     variation       1248
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923782799"
     variation       1250
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276688115"
     variation       1251
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345079403"
     variation       1253
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019620844"
     variation       1256
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340771541"
     variation       1258
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574204578"
     variation       1260
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935211665"
     variation       1261
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340677655"
     variation       1265
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780176078"
     variation       1270
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395803381"
     variation       1271
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377704001"
     variation       1278
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310325074"
     variation       1280
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430487808"
     variation       1287
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291021604"
     variation       1303
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544802344"
     variation       1307
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459687847"
     variation       1315
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138108626"
     variation       1316
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117830235"
     variation       1321
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:545668585"
     variation       1323
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947379214"
     variation       1331
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253906725"
     variation       1334
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143775286"
     variation       1342
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1182731496"
     variation       1355..1357
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:1248924891"
     variation       1355..1356
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1293515177"
     variation       1355
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336398738"
     variation       1356..1360
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1356691149"
     variation       1362
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185547953"
     variation       1367
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039469222"
     variation       1370
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:546700312"
     variation       1373
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907745713"
     regulatory      1379..1384
                     /regulatory_class="polyA_signal_sequence"
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
     variation       1387
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320216475"
     variation       1391
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73313239"
     variation       1397
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410921775"
     variation       1398
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045529392"
     variation       1400
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907133067"
     variation       1403
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306305760"
     polyA_site      1407
                     /gene="TARBP2"
                     /gene_synonym="LOQS; TRBP; TRBP1; TRBP2"
ORIGIN      
gcctctccagctgcgacacagatggcgcgcgggctcttgggttctgtagttttctcgcgatccaaaaggctccgtgcccaaagcaaatgctggccgccaacccaggcaagaccccgatcagccttctgcaggagtatgggaccagaatagggaagacgcctgtgtacgaccttctcaaagccgagggccaagcccaccagcctaatttcaccttccgggtcaccgttggcgacaccagctgcactggtcagggccccagcaagaaggcagccaagcacaaggcagctgaggtggccctcaaacacctcaaaggggggagcatgctggagccggccctggaggacagcagttctttttctcccctagactcttcactgcctgaggacattccggtttttactgctgcagcagctgctaccccagttccatctgtagtcctaaccaggagcccccccatggaactgcagccccctgtctcccctcagcagtctgagtgcaaccccgttggtgctctgcaggagctggtggtgcagaaaggctggcggttgccggagtacacagtgacccaggagtctgggccagcccaccgcaaagaattcaccatgacctgtcgagtggagcgtttcattgagattgggagtggcacttccaaaaaattggcaaagcggaatgcggcggccaaaatgctgcttcgagtgcacacggtgcctctggatgcccgggatggcaatgaggtggagcctgatgatgaccacttctccattggtgtgggctcccgcctggatggtcttcgaaaccggggcccaggttgcacctgggattctctacgaaattcagtaggagagaagatcctgtccctccgcagttgctccctgggctccctgggtgccctgggccctgcctgctgccgtgtcctcagtgagctctctgaggagcaggcctttcacgtcagctacctggatattgaggagctgagcctgagtggactctgccagtgcctggtggaactgtccacccagccggccactgtgtgtcatggctctgcaaccaccagggaggcagcccgtggtgaggctgcccgccgtgccctgcagtacctcaagatcatggcaggcagcaagtgaagccccagctggactcatggatgtgcaccctttgctccctgctctttctgcctctgggctcatgtatctgcgcagctctggtaccctctgtgggtgccatctctacctctgacacagactgcctgccttgaagctgagaaggcacagggcaaggagccaaggaccacagagcctcagccagcccaggatccgtcctcattttattggtgatgatgaatgggaatgaaatcagggggctgtctactagagcctggaataaatatgctgctttgtggatttttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]