GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:26:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_003508               2343 bp    mRNA    linear   PRI 02-JAN-2020
DEFINITION  Homo sapiens frizzled class receptor 9 (FZD9), mRNA.
ACCESSION   NM_003508
VERSION     NM_003508.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2343)
  AUTHORS   Wang Q, Liu H, Wang Q, Zhou F, Liu Y, Zhang Y, Ding H, Yuan M, Li F
            and Chen Y.
  TITLE     Involvement of c-Fos in cell proliferation, migration, and invasion
            in osteosarcoma cells accompanied by altered expression of Wnt2 and
            Fzd9
  JOURNAL   PLoS ONE 12 (6), e0180558 (2017)
   PUBMED   28665975
  REMARK    GeneRIF: data enforced the evidence that knockdown of c-Fos
            inhibited cell proliferation, migration, and invasion, and promoted
            the apoptosis of OS cells accompanied by altered expression of Wnt2
            and Fzd9
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2343)
  AUTHORS   Chailangkarn,T., Trujillo,C.A., Freitas,B.C., Hrvoj-Mihic,B.,
            Herai,R.H., Yu,D.X., Brown,T.T., Marchetto,M.C., Bardy,C.,
            McHenry,L., Stefanacci,L., Jarvinen,A., Searcy,Y.M., DeWitt,M.,
            Wong,W., Lai,P., Ard,M.C., Hanson,K.L., Romero,S., Jacobs,B.,
            Dale,A.M., Dai,L., Korenberg,J.R., Gage,F.H., Bellugi,U.,
            Halgren,E., Semendeferi,K. and Muotri,A.R.
  TITLE     A human neurodevelopmental model for Williams syndrome
  JOURNAL   Nature 536 (7616), 338-343 (2016)
   PUBMED   27509850
REFERENCE   3  (bases 1 to 2343)
  AUTHORS   Zhang Y, Jiang Q, Kong X, Yang L, Hu W, Lv C and Li Y.
  TITLE     Methylation status of the promoter region of the human frizzled 9
            gene in acute myeloid leukemia
  JOURNAL   Mol Med Rep 14 (2), 1339-1344 (2016)
   PUBMED   27314612
  REMARK    GeneRIF: the present study indicated that the methylation profile
            of the FZD9 gene corresponded to that of a candidate
            tumorsuppressor gene in acute myeloid leukemia.
REFERENCE   4  (bases 1 to 2343)
  AUTHORS   Trubiani O, Zalzal SF, Paganelli R, Marchisio M, Giancola R,
            Pizzicannella J, Buhring HJ, Piattelli M, Caputi S and Nanci A.
  TITLE     Expression profile of the embryonic markers nanog, OCT-4, SSEA-1,
            SSEA-4, and frizzled-9 receptor in human periodontal ligament
            mesenchymal stem cells
  JOURNAL   J. Cell. Physiol. 225 (1), 123-131 (2010)
   PUBMED   20458727
  REMARK    GeneRIF: The presence of nanog, Oct-4, SSEA-1, and SSEA-4 suggests
            that periodontal ligament mesenchymal stem cells are less
            differentiated than bone marrow-derived MSCs, and that the
            frizzled-9/Wnt pathway is important in proliferation and
            differentiation.
            GeneRIF: The presence of nanog, Oct-4, SSEA-1, and SSEA-4 suggests
            that periodontal ligament mesenchymal stem cells are less
            differentiated than bone marrow-derived MSCs, and the
            frizzled-9/Wnt pathway is important in proliferation and
            differentiation.
REFERENCE   5  (bases 1 to 2343)
  AUTHORS   Tennis MA, Van Scoyk MM, Freeman SV, Vandervest KM, Nemenoff RA and
            Winn RA.
  TITLE     Sprouty-4 inhibits transformed cell growth, migration and invasion,
            and epithelial-mesenchymal transition, and is regulated by Wnt7A
            through PPARgamma in non-small cell lung cancer
  JOURNAL   Mol. Cancer Res. 8 (6), 833-843 (2010)
   PUBMED   20501643
  REMARK    GeneRIF: The activity of the Sprouty4 promoter is increased by
            Wnt7A/Fzd9 signaling through peroxisome proliferator-activated
            receptor gamma in lung cancer cells.
REFERENCE   6  (bases 1 to 2343)
  AUTHORS   Wang YK, Sporle R, Paperna T, Schughart K and Francke U.
  TITLE     Characterization and expression pattern of the frizzled gene Fzd9,
            the mouse homolog of FZD9 which is deleted in Williams-Beuren
            syndrome
  JOURNAL   Genomics 57 (2), 235-248 (1999)
   PUBMED   10198163
REFERENCE   7  (bases 1 to 2343)
  AUTHORS   Tanaka S, Akiyoshi T, Mori M, Wands JR and Sugimachi K.
  TITLE     A novel frizzled gene identified in human esophageal carcinoma
            mediates APC/beta-catenin signals
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 95 (17), 10164-10169 (1998)
   PUBMED   9707618
REFERENCE   8  (bases 1 to 2343)
  AUTHORS   Finch PW, He X, Kelley MJ, Uren A, Schaudies RP, Popescu NC,
            Rudikoff S, Aaronson SA, Varmus HE and Rubin JS.
  TITLE     Purification and molecular cloning of a secreted, Frizzled-related
            antagonist of Wnt action
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 94 (13), 6770-6775 (1997)
   PUBMED   9192640
REFERENCE   9  (bases 1 to 2343)
  AUTHORS   Wang YK, Samos CH, Peoples R, Perez-Jurado LA, Nusse R and Francke
            U.
  TITLE     A novel human homologue of the Drosophila frizzled wnt receptor
            gene binds wingless protein and is in the Williams syndrome
            deletion at 7q11.23
  JOURNAL   Hum. Mol. Genet. 6 (3), 465-472 (1997)
   PUBMED   9147651
REFERENCE   10 (bases 1 to 2343)
  AUTHORS   Datta,D.V.
  TITLE     Viral hepatitis (Chandigarh study)
  JOURNAL   J Assoc Physicians India 25 (5), 325-330 (1977)
   PUBMED   914765
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC005049.2 and U82169.1.
            This sequence is a reference standard in the RefSeqGene project.
            On May 17, 2019 this sequence version replaced NM_003508.2.
            
            Summary:  Members of the 'frizzled' gene family encode
            7-transmembrane domain proteins that are receptors for Wnt
            signaling proteins.  The FZD9 gene is located within the Williams
            syndrome common deletion region of chromosome 7, and heterozygous
            deletion of the FZD9 gene may contribute to the Williams syndrome
            phenotype.  FZD9 is expressed predominantly in brain, testis, eye,
            skeletal muscle, and kidney. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: BC026333.1, U82169.1 [ECO:0000345]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000344575.5/ ENSP00000345785.3
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1                 AC005049.2         2939-2939           c
            2-205               AC005049.2         2735-2938           c
            206-2343            U82169.1           1-2138
FEATURES             Location/Qualifiers
     source          1..2343
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q11.23"
     gene            1..2343
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="frizzled class receptor 9"
                     /db_xref="GeneID:8326"
                     /db_xref="HGNC:HGNC:4047"
                     /db_xref="MIM:601766"
     exon            1..2343
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:575658095"
     variation       6
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156469642"
     variation       7..9
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:1418191624"
     variation       8
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380076693"
     variation       10..27
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="tcagcggcggctccggtg"
                     /replace="tcagcggcggctccggtgtcagcggcggctccggtg"
                     /db_xref="dbSNP:1179723518"
     variation       11
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442011083"
     variation       12
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241861936"
     variation       13
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483604724"
     variation       14
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563093"
     variation       15
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257874873"
     variation       17
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316613681"
     variation       21
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286392673"
     variation       23..41
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cggtggc"
                     /replace="cggtggcagcggcggtggc"
                     /db_xref="dbSNP:1242058142"
     variation       33
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380440125"
     variation       35
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314323996"
     variation       39..44
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ggc"
                     /replace="ggcggc"
                     /db_xref="dbSNP:1396588010"
     variation       42
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380671978"
     misc_feature    45..47
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="upstream in-frame stop codon"
     variation       52
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286682889"
     variation       55
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1452596038"
     variation       55
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360786539"
     variation       57
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563353664"
     variation       58
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159583864"
     variation       61
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421924059"
     variation       63
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113536073"
     variation       73
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383827588"
     variation       76
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187416643"
     variation       78
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424964395"
     variation       82
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258332504"
     variation       84
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184870260"
     variation       85
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264208996"
     variation       87
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218458703"
     variation       88
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356980068"
     variation       95
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245428104"
     variation       97
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:55668598"
     variation       101
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323494106"
     variation       106
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1292755113"
     variation       114
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543107821"
     variation       116
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299626235"
     variation       117
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:13234437"
     variation       120
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402760546"
     variation       126
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563117"
     variation       127
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364094315"
     variation       132..144
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cccgcgccccgcg"
                     /replace="cccgcgccccgcgccccgcg"
                     /db_xref="dbSNP:1163097221"
     variation       133
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1458813640"
     variation       142
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1370707063"
     variation       144
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147093317"
     variation       146
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477549982"
     variation       147
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264059627"
     variation       151
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:532115159"
     variation       158
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563119"
     variation       160
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1554563120"
     variation       161
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489940988"
     variation       165
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266397236"
     variation       166
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1210230312"
     variation       167
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249563378"
     variation       169
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217984183"
     variation       185
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563122"
     variation       191
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317955623"
     variation       197
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279613850"
     variation       200
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221288492"
     variation       205
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344489062"
     variation       207
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323228702"
     variation       213
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387740590"
     variation       215
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393452794"
     variation       218
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296935432"
     variation       224
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541194753"
     variation       225
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563132"
     variation       227
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424425253"
     variation       229
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172987821"
     CDS             231..2006
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="frizzled 9, seven transmembrane spanning receptor;
                     fz-9; fzE6; hFz9; frizzled homolog 9; frizzled family
                     receptor 9"
                     /codon_start=1
                     /product="frizzled-9 precursor"
                     /protein_id="NP_003499.1"
                     /db_xref="CCDS:CCDS5548.1"
                     /db_xref="GeneID:8326"
                     /db_xref="HGNC:HGNC:4047"
                     /db_xref="MIM:601766"
                     /translation="
MAVAPLRGALLLWQLLAAGGAALEIGRFDPERGRGAAPCQAVEIPMCRGIGYNLTRMPNLLGHTSQGEAAAELAEFAPLVQYGCHSHLRFFLCSLYAPMCTDQVSTPIPACRPMCEQARLRCAPIMEQFNFGWPDSLDCARLPTRNDPHALCMEAPENATAGPAEPHKGLGMLPVAPRPARPPGDLGPGAGGSGTCENPEKFQYVEKSRSCAPRCGPGVEVFWSRRDKDFALVWMAVWSALCFFSTAFTVLTFLLEPHRFQYPERPIIFLSMCYNVYSLAFLIRAVAGAQSVACDQEAGALYVIQEGLENTGCTLVFLLLYYFGMASSLWWVVLTLTWFLAAGKKWGHEAIEAHGSYFHMAAWGLPALKTIVILTLRKVAGDELTGLCYVASTDAAALTGFVLVPLSGYLVLGSSFLLTGFVALFHIRKIMKTGGTNTEKLEKLMVKIGVFSILYTVPATCVIVCYVYERLNMDFWRLRATEQPCAAAAGPGGRRDCSLPGGSVPTVAVFMLKIFMSLVVGITSGVWVWSSKTFQTWQSLCYRKIAAGRARAKACRAPGSYGRGTHCHYKAPTVVLHMTKTDPSLENPTHL"
     sig_peptide     231..296
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     297..2003
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /product="Frizzled-9"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1)"
     misc_feature    333..713
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="CRD_domain cysteine-rich domain, also known as Fz
                     (frizzled) domain; Region: CRD_FZ; cl02447"
                     /db_xref="CDD:321937"
     misc_feature    order(366..368,372..377,384..392)
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="putative Wnt binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:143549"
     misc_feature    387..389
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-linked (GlcNAc...) asparagine. {ECO:0000255};
                     propagated from UniProtKB/Swiss-Prot (O00144.1);
                     glycosylation site"
     misc_feature    402..746
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     Region: Required for Wnt-activated receptor activity.
                     {ECO:0000250|UniProtKB:Q8K4C8}"
     misc_feature    702..704
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-linked (GlcNAc...) asparagine. {ECO:0000255};
                     propagated from UniProtKB/Swiss-Prot (O00144.1);
                     glycosylation site"
     misc_feature    891..1856
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="class F frizzled subfamily 9, member of
                     7-transmembrane G protein-coupled receptors; Region:
                     7tmF_FZD9; cd15036"
                     /db_xref="CDD:320164"
     misc_feature    order(894..896,921..923,1071..1073,1128..1130,1374..1376,
                     1389..1391,1395..1397,1404..1409,1422..1424,1647..1649,
                     1656..1661,1743..1745,1758..1760,1767..1772)
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="putative ligand binding site [chemical binding];
                     other site"
                     /db_xref="CDD:320164"
     misc_feature    918..995
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 1 [structural motif]; Region: TM helix 1"
                     /db_xref="CDD:320164"
     misc_feature    918..980
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1020..1085
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:320164"
     misc_feature    1029..1091
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1170..1250
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:320164"
     misc_feature    1176..1238
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1296..1358
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1299..1349
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:320164"
     misc_feature    1413..1505
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:320164"
     misc_feature    1431..1493
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1560..1643
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 6 [structural motif]; Region: TM helix 6"
                     /db_xref="CDD:320164"
     misc_feature    1572..1634
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1737..1814
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /note="TM helix 7 [structural motif]; Region: TM helix 7"
                     /db_xref="CDD:320164"
     misc_feature    1755..1817
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     transmembrane region"
     misc_feature    1824..1841
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     Region: Lys-Thr-X-X-X-Trp motif, mediates interaction with
                     the PDZ domain of Dvl family members. {ECO:0000250}"
     misc_feature    1890..2003
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00144.1);
                     Region: Required for CTNNB1 accumulation and TCF
                     transcription factor activity.
                     {ECO:0000250|UniProtKB:Q8K4C8}"
     variation       237
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479547992"
     variation       242
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377293515"
     variation       250
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199239605"
     variation       251
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248195095"
     variation       256
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197927604"
     variation       268..276
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ggcagctgc"
                     /replace="ggcagctgcggcagctgc"
                     /db_xref="dbSNP:1458202473"
     variation       283
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563136"
     variation       284
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259363732"
     variation       287
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563139"
     variation       288
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782003819"
     variation       290
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782156074"
     variation       298
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201234496"
     variation       300
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343799030"
     variation       301
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275096178"
     variation       302
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782438219"
     variation       310
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781927126"
     variation       311
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782070915"
     variation       314
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782731406"
     variation       315
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781851365"
     variation       316
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868937985"
     variation       317
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563145"
     variation       318
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563146"
     variation       322
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333160658"
     variation       323
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563149"
     variation       325
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305398764"
     variation       329
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446682127"
     variation       331
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782128581"
     variation       332
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563151"
     variation       333
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333375420"
     variation       334
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563155"
     variation       336
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563156"
     variation       337
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563158"
     variation       340
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782793152"
     variation       341
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563160"
     variation       343..347
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="cgtgc"
                     /db_xref="dbSNP:1554563163"
     variation       343
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559302614"
     variation       344
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1173341222"
     variation       347
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782432802"
     variation       352
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361834097"
     variation       353
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138518770"
     variation       357
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781822452"
     variation       362
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440163665"
     variation       364
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239975749"
     variation       366
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563167"
     variation       371..398
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ccgcggcatcggctacaacctgacccgc"
                     /replace="ccgcggcatcggctacaacctgacccgcggcatcggctacaacctgac
                     ccgc"
                     /db_xref="dbSNP:782014172"
     variation       371
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563172"
     variation       372
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181159872"
     variation       373
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782497063"
     variation       374
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782640739"
     variation       381
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201817320"
     variation       385
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563179"
     variation       386
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200757525"
     variation       389
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782410069"
     variation       390
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782689397"
     variation       392
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61749861"
     variation       395
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782328376"
     variation       397
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781964820"
     variation       399
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1284253602"
     variation       400
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782103545"
     variation       401
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782389995"
     variation       404
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239887240"
     variation       409
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563194"
     variation       411
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563196"
     variation       414
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782015381"
     variation       422
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782164298"
     variation       424
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563201"
     variation       425
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1563353966"
     variation       426
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563353972"
     variation       429
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782695258"
     variation       434
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563204"
     variation       437
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114148192"
     variation       443
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563205"
     variation       452
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446508317"
     variation       453
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339937594"
     variation       454
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1563353996"
     variation       459
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334996848"
     variation       460
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782079145"
     variation       461
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782739522"
     variation       462
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781854794"
     variation       468
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782798543"
     variation       470
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563210"
     variation       473
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781911724"
     variation       474
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416324972"
     variation       475
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372060832"
     variation       477
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563213"
     variation       478
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201878512"
     variation       488
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563218"
     variation       491
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157785488"
     variation       492
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563221"
     variation       494
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782213538"
     variation       495
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782634341"
     variation       507
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563225"
     variation       509
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782268651"
     variation       512
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550209901"
     variation       517
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782199592"
     variation       518
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782343653"
     variation       520
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563229"
     variation       524
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781972430"
     variation       527
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563235"
     variation       534
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782111677"
     variation       536
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237539018"
     variation       537
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563240"
     variation       538
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782797612"
     variation       540
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189038348"
     variation       543
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782016785"
     variation       545
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782165499"
     variation       546
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1563354103"
     variation       548
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563245"
     variation       549
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782704580"
     variation       550
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781814209"
     variation       552
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782476477"
     variation       556
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782757278"
     variation       557
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142125301"
     variation       564
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216288652"
     variation       565
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288678390"
     variation       566
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782523951"
     variation       567
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371558043"
     variation       568
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776325053"
     variation       570
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356269300"
     variation       573
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1284798043"
     variation       575..576
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34455338"
     variation       575
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782174254"
     variation       576
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563253"
     variation       578
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375005276"
     variation       580
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112773403"
     variation       582
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338658283"
     variation       587
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563255"
     variation       590..602
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="gcgctgcgcgccc"
                     /db_xref="dbSNP:1563354161"
     variation       590..602
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gcgctgcgcgccc"
                     /replace="gcgctgcgcgcccgcgctgcgcgccc"
                     /db_xref="dbSNP:782249737"
     variation       591
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563256"
     variation       592
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400893164"
     variation       593
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362204249"
     variation       596
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1161513152"
     variation       597
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782600769"
     variation       599
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782231665"
     variation       602
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782377030"
     variation       603
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404627103"
     variation       605
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563264"
     variation       606
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782000137"
     variation       611..649
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gc"
                     /replace="gcagttcaacttcggctggccggactcgctcgactgcgc"
                     /db_xref="dbSNP:782362851"
     variation       611
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164436895"
     variation       612
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563267"
     variation       619
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563269"
     variation       624
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782278157"
     variation       625
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782418729"
     variation       628
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782073205"
     variation       629
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782351404"
     variation       630
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563273"
     variation       631
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781972322"
     variation       632
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368682922"
     variation       633
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489107305"
     variation       638
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265714611"
     variation       642
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538778244"
     variation       647
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372342933"
     variation       649
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230570552"
     variation       651
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782047303"
     variation       652
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563281"
     variation       660
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782702023"
     variation       662
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202012985"
     variation       663
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563284"
     variation       664
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782636147"
     variation       668
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563286"
     variation       670
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563292"
     variation       673
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342614883"
     variation       674
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563293"
     variation       677
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781871788"
     variation       678
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291513232"
     variation       679
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435523202"
     variation       680
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782541209"
     variation       685
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350354391"
     variation       687
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563295"
     variation       690
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563297"
     variation       691
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563299"
     variation       695
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563300"
     variation       696
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325404653"
     variation       698
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201167285"
     variation       699
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170781570"
     variation       700
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1478566511"
     variation       704
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563305"
     variation       705
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563309"
     variation       709
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563310"
     variation       712
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563311"
     variation       713
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563312"
     variation       714
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426798842"
     variation       716
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563313"
     variation       719
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189804513"
     variation       720
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782692525"
     variation       722..723
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1477887653"
     variation       722
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247706975"
     variation       728
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782180751"
     variation       729
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782330628"
     variation       738
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257427741"
     variation       742
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563317"
     variation       743
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199362931"
     variation       745
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1320208988"
     variation       746..762
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gc"
                     /replace="gctgcccgtggcgccgc"
                     /db_xref="dbSNP:1299500182"
     variation       747
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536929629"
     variation       749
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563319"
     variation       751
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563320"
     variation       752
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570248551"
     variation       753
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563322"
     variation       755
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563323"
     variation       756
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563327"
     variation       757
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563330"
     variation       760
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563354348"
     variation       762
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563331"
     variation       766
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276469452"
     variation       768
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563332"
     variation       769
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444400608"
     variation       770
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782384125"
     variation       771
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563334"
     variation       775
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563335"
     variation       777
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331376416"
     variation       779
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1466761671"
     variation       780
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356972019"
     variation       785
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563338"
     variation       786
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138414411"
     variation       788..797
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gggcccgggc"
                     /replace="gggcccgggcccgggc"
                     /db_xref="dbSNP:1554563345"
     variation       790
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563346"
     variation       792
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414739487"
     variation       793
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426307014"
     variation       794
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195898711"
     variation       796
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769369970"
     variation       797
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563349"
     variation       798
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563350"
     variation       802
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563351"
     variation       803
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563352"
     variation       804
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782300865"
     variation       805
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575621716"
     variation       815
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781938252"
     variation       818
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563356"
     variation       819
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1459118499"
     variation       821..823
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gaa"
                     /replace="gaagttccagtggaa"
                     /db_xref="dbSNP:1554563360"
     variation       825
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782077630"
     variation       826
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:17852398"
     variation       827
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782760906"
     variation       828
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781853577"
     variation       829
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782136427"
     variation       830
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563364"
     variation       833
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782795346"
     variation       834
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313006296"
     variation       836
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781907051"
     variation       842
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563366"
     variation       843
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280407029"
     variation       849
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563370"
     variation       854
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563371"
     variation       855
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375403747"
     variation       856
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782580729"
     variation       858
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563378"
     variation       860
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376012216"
     variation       861
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563382"
     variation       863
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563384"
     variation       864
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309852211"
     variation       867
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781828087"
     variation       868
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376327965"
     variation       871
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360551989"
     variation       875
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782486490"
     variation       880
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563389"
     variation       881
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563391"
     variation       882
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175866183"
     variation       883
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782651060"
     variation       884
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147849239"
     variation       887
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159758061"
     variation       893
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782413002"
     variation       896
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254096830"
     variation       898
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015078235"
     variation       903
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563396"
     variation       904
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971589447"
     variation       905
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782562809"
     variation       907
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563399"
     variation       908
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782193718"
     variation       909
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782340783"
     variation       913
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563403"
     variation       920
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141168260"
     variation       921
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782243429"
     variation       923
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782385561"
     variation       926
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563405"
     variation       927
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782023448"
     variation       932
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563406"
     variation       937
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782170377"
     variation       938
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563408"
     variation       939
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782703347"
     variation       947
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781942977"
     variation       949
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563410"
     variation       956..963
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:781951458"
     variation       958
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782085952"
     variation       962
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782767239"
     variation       968
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781861224"
     variation       969
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782538318"
     variation       971
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563415"
     variation       975
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311312226"
     variation       976
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563421"
     variation       980
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782805481"
     variation       981
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558152721"
     variation       982
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563424"
     variation       984
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781785546"
     variation       987
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228416720"
     variation       993
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531718356"
     variation       996
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563429"
     variation       999
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563431"
     variation       1002
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373157288"
     variation       1003
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563432"
     variation       1004
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034602722"
     variation       1005
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563434"
     variation       1006
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563436"
     variation       1011
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782599690"
     variation       1012
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1295926214"
     variation       1013
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399061339"
     variation       1016
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782228364"
     variation       1019
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360270976"
     variation       1020
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376108024"
     variation       1022
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782659170"
     variation       1023
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376132966"
     variation       1024
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455756838"
     variation       1029
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563444"
     variation       1031
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781923345"
     variation       1032
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367262158"
     variation       1034
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164127954"
     variation       1040
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563448"
     variation       1045
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424442556"
     variation       1051
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563451"
     variation       1054
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420177208"
     variation       1055
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782203045"
     variation       1059
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563454"
     variation       1060
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563456"
     variation       1061
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191763746"
     variation       1064
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782349557"
     variation       1065
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115007009"
     variation       1070
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263548634"
     variation       1074
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782119421"
     variation       1079..1080
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1487435648"
     variation       1079
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264823996"
     variation       1081
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782778281"
     variation       1084
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245478277"
     variation       1085
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322973363"
     variation       1091
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782026570"
     variation       1093
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563354634"
     variation       1095
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1563354652"
     variation       1096
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782039651"
     variation       1097..1108
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gc"
                     /replace="gcagagcgtggc"
                     /db_xref="dbSNP:1563354669"
     variation       1097
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275816380"
     variation       1102
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563464"
     variation       1103
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782712314"
     variation       1104
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567917703"
     variation       1107
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782761805"
     variation       1109
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781869354"
     variation       1110
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217625707"
     variation       1113
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782546523"
     variation       1114
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73134914"
     variation       1117
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563466"
     variation       1119
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279188898"
     variation       1123
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781793071"
     variation       1124
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782459639"
     variation       1127
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782604885"
     variation       1128
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782237874"
     variation       1129
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781960801"
     variation       1130
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782382695"
     variation       1134
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946134081"
     variation       1135
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1168629728"
     variation       1136
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563472"
     variation       1137
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782657739"
     variation       1147
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563474"
     variation       1150
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782281964"
     variation       1151
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:977938373"
     variation       1152
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563476"
     variation       1153
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563477"
     variation       1162
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781928891"
     variation       1163
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782076832"
     variation       1167
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782357130"
     variation       1170
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781980067"
     variation       1171
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431198105"
     variation       1174
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563482"
     variation       1182
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782133022"
     variation       1183
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563485"
     variation       1187
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469817206"
     variation       1192
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563487"
     variation       1197
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782796354"
     variation       1199
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144961735"
     variation       1200
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782048293"
     variation       1203
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318124551"
     variation       1217
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563492"
     variation       1220
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782730610"
     variation       1222
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782101484"
     variation       1223
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230670622"
     variation       1224
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781824483"
     variation       1225
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563497"
     variation       1229
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782494286"
     variation       1230
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563354781"
     variation       1234
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329700001"
     variation       1235
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563499"
     variation       1251
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563501"
     variation       1254
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782640518"
     variation       1255
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563503"
     variation       1256
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781878078"
     variation       1257
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559231844"
     variation       1259
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373174806"
     variation       1274
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200096983"
     variation       1275
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782187612"
     variation       1276
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329341077"
     variation       1277
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782332524"
     variation       1279
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563508"
     variation       1292..1295
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cggc"
                     /replace="cggcggc"
                     /db_xref="dbSNP:1401173186"
     variation       1292
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200122023"
     variation       1293
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921189985"
     variation       1294
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782238168"
     variation       1306
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563509"
     variation       1307
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782388267"
     variation       1308
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782017831"
     variation       1312
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376847874"
     variation       1314
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563511"
     variation       1320
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199307584"
     variation       1322
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455498517"
     variation       1326
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782166013"
     variation       1327
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782311502"
     variation       1328
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781937154"
     variation       1329
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542138331"
     variation       1330
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369598057"
     variation       1331
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782140617"
     variation       1335
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563516"
     variation       1343
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563518"
     variation       1344
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930955244"
     variation       1345
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111619218"
     variation       1346
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563536385"
     variation       1348
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886801517"
     variation       1349
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563527"
     variation       1352
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781784393"
     variation       1354
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782449413"
     variation       1355
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782738625"
     variation       1356
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139225216"
     variation       1359
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782509182"
     variation       1360
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373485212"
     variation       1362
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782278695"
     variation       1364
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550169152"
     variation       1369
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563531"
     variation       1370
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046610661"
     variation       1372
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782569037"
     variation       1379
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563534"
     variation       1383
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235509743"
     variation       1385
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762475044"
     variation       1388
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782278676"
     variation       1389
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307667599"
     variation       1394
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782381628"
     variation       1396
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781982258"
     variation       1398
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782220417"
     variation       1404
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563538"
     variation       1408
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377721028"
     variation       1409
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61749862"
     variation       1410
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394440286"
     variation       1418
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563540"
     variation       1419
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781928707"
     variation       1420
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563541"
     variation       1421
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401799000"
     variation       1425
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172909758"
     variation       1426
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202037150"
     variation       1427
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116090716"
     variation       1429
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234047013"
     variation       1434
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563549"
     variation       1440
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145921800"
     variation       1441
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782741814"
     variation       1442
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781826044"
     variation       1446
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199961288"
     variation       1448
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441431141"
     variation       1449
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256459314"
     variation       1453
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868993339"
     variation       1454
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782450675"
     variation       1458
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563555"
     variation       1462
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532621192"
     variation       1465
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781906732"
     variation       1471
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212625563"
     variation       1487
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782534847"
     variation       1488
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563556"
     variation       1493
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563557"
     variation       1494
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547599913"
     variation       1497
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563559"
     variation       1498
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782243057"
     variation       1501..1569
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="tcttccacatccgcaagatcatgaagacgggcggcaccaacacagaga
                     agctggagaagctcatggtca"
                     /replace="tcttccacatccgcaagatcatgaagacgggcggcaccaacacagaga
                     agctggagaagctcatggtcatcttccacatccgcaagatcatgaagacgggcggcac
                     caacacagagaagctggagaagctcatggtca"
                     /db_xref="dbSNP:1563355008"
     variation       1502
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782152078"
     variation       1505
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563355015"
     variation       1506
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563562"
     variation       1512
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240049086"
     variation       1513
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782493264"
     variation       1518
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563563"
     variation       1519
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201244210"
     variation       1520
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352032979"
     variation       1521
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114980092"
     variation       1525
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201104999"
     variation       1528
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370867927"
     variation       1529
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782272876"
     variation       1530
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782381088"
     variation       1532
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199498649"
     variation       1533
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782088568"
     variation       1540
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563565"
     variation       1541
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563568"
     variation       1543
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202155373"
     variation       1547
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563571"
     variation       1550
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537364650"
     variation       1551
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782813094"
     variation       1556
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115041747"
     variation       1559
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782786443"
     variation       1563
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781874253"
     variation       1572
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17856756"
     variation       1574
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410097374"
     variation       1575
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1160908709"
     variation       1577
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377542235"
     variation       1578
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781794887"
     variation       1580
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782442040"
     variation       1586
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189604838"
     variation       1587
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782572116"
     variation       1589
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781893880"
     variation       1590
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487140215"
     variation       1594
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782536484"
     variation       1598
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448044448"
     variation       1599
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563582"
     variation       1600
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563583"
     variation       1602
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782640636"
     variation       1603
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201201261"
     variation       1604
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782349609"
     variation       1606..1607
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:782062705"
     variation       1606
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373097291"
     variation       1610
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782418455"
     variation       1613
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563587"
     variation       1614
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371067074"
     variation       1617
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782125902"
     variation       1619
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782078790"
     variation       1620
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781961539"
     variation       1626
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554563589"
     variation       1627
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355718028"
     variation       1630
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374521367"
     variation       1631
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782079517"
     variation       1632
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235297079"
     variation       1634
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782712279"
     variation       1639
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139948155"
     variation       1642
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277280245"
     variation       1643
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431242558"
     variation       1644
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552835695"
     variation       1645
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782778291"
     variation       1652
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321484661"
     variation       1656
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781860918"
     variation       1658
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563596"
     variation       1660
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921118075"
     variation       1661
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782484727"
     variation       1666
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390816222"
     variation       1668
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782604860"
     variation       1669
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166467049"
     variation       1674
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142802414"
     variation       1676..1677
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gc"
                     /replace="gcggc"
                     /db_xref="dbSNP:782316597"
     variation       1676
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782442994"
     variation       1678
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782684299"
     variation       1685
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193988828"
     variation       1686
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563601"
     variation       1687
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563602"
     variation       1689
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782273757"
     variation       1691
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475934670"
     variation       1694
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563603"
     variation       1695
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868913536"
     variation       1696
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574487516"
     variation       1697..1736
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ggggc"
                     /replace="ggggcccggaggccggagggactgctcgctgccagggggc"
                     /db_xref="dbSNP:782036628"
     variation       1697
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197369631"
     variation       1698
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451541821"
     variation       1700
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563606"
     variation       1703
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782393554"
     variation       1704
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776032343"
     variation       1706
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200330017"
     variation       1707
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563607"
     variation       1708
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563608"
     variation       1709
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563610"
     variation       1710
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563613"
     variation       1711
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782339488"
     variation       1712
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781932345"
     variation       1716
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563615"
     variation       1723
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257627061"
     variation       1724
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782046803"
     variation       1729
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563617"
     variation       1730
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908198639"
     variation       1731
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782413236"
     variation       1732
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367555625"
     variation       1735
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939684845"
     variation       1736
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782119543"
     variation       1742
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272920964"
     variation       1745
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563623"
     variation       1748
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782767367"
     variation       1749
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906293096"
     variation       1753
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781956465"
     variation       1754
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327270227"
     variation       1755
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782072490"
     variation       1758
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782703359"
     variation       1761
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781907193"
     variation       1766
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782779078"
     variation       1771
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200802560"
     variation       1775
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1003019704"
     variation       1777
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563493902"
     variation       1778
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150610032"
     variation       1781
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782186839"
     variation       1782
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782429594"
     variation       1784
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563631"
     variation       1788
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563634"
     variation       1801
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17856757"
     variation       1803
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055955184"
     variation       1806
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782677223"
     variation       1808
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782381947"
     variation       1812
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189855467"
     variation       1814
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781973320"
     variation       1820
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139673113"
     variation       1821
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575573500"
     variation       1822
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563643"
     variation       1823
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781922813"
     variation       1827
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782170224"
     variation       1831
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563646"
     variation       1832
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782795530"
     variation       1837
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782116233"
     variation       1838
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554563648"
     variation       1845
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782760881"
     variation       1847
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563651"
     variation       1854
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254214049"
     variation       1856
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894676304"
     variation       1857
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011824273"
     variation       1858
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546151479"
     variation       1861
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142246324"
     variation       1863
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563657"
     variation       1864
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782685746"
     variation       1865
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781899512"
     variation       1868
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782528556"
     variation       1869
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782645248"
     variation       1874..1875
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1554563658"
     variation       1875
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563661"
     variation       1876..1878
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:782149592"
     variation       1876
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237708463"
     variation       1879..1881
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:782774401"
     variation       1879
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022336403"
     variation       1880
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782237302"
     variation       1881
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782478821"
     variation       1882
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782597771"
     variation       1885
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782180681"
     variation       1886
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782436128"
     variation       1895
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782018513"
     variation       1896
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782264029"
     variation       1897
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17852397"
     variation       1898
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372016463"
     variation       1899
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375512086"
     variation       1900
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019630729"
     variation       1902
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554563676"
     variation       1903
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782320015"
     variation       1904
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781913004"
     variation       1905
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782156410"
     variation       1907
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563355449"
     variation       1910
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782801976"
     variation       1911
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563680"
     variation       1913
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115751996"
     variation       1914
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782108423"
     variation       1917
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782739024"
     variation       1918
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921087014"
     variation       1920
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443851803"
     variation       1924
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781812011"
     variation       1928
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184697506"
     variation       1930
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764538094"
     variation       1931
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563689"
     variation       1933
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174351100"
     variation       1936
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1434455070"
     variation       1937
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563691"
     variation       1940
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781891508"
     variation       1941
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563355504"
     variation       1942
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782514203"
     variation       1946
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563693"
     variation       1947
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782644101"
     variation       1949
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176063495"
     variation       1950
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879962794"
     variation       1953
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563695"
     variation       1955
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952691379"
     variation       1957
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438458340"
     variation       1962
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149379186"
     variation       1973
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144706232"
     variation       1975
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1235973230"
     variation       1976
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563697"
     variation       1977
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368559421"
     variation       1990
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563701"
     variation       1991
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563703"
     variation       1993
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485869886"
     variation       1996
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782181076"
     variation       2006
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782427952"
     variation       2009
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1282290338"
     variation       2017
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782010349"
     variation       2021
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237788129"
     variation       2022
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782121372"
     variation       2023
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201753892"
     variation       2024
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537327658"
     variation       2029
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782075383"
     variation       2033
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563705"
     variation       2038
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554563706"
     variation       2040
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375855111"
     variation       2043
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982203598"
     variation       2046
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781911666"
     variation       2048
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782146330"
     variation       2055
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563710"
     variation       2056
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368686112"
     variation       2058
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927638540"
     variation       2071
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178947"
     variation       2072
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345136236"
     variation       2074
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159869832"
     variation       2079
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054916937"
     variation       2096
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574154028"
     variation       2103
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187494663"
     variation       2104
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554563717"
     variation       2113
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475663291"
     variation       2129
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259288548"
     variation       2130
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947545672"
     variation       2139
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487899434"
     variation       2140
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261208835"
     variation       2141
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217925116"
     variation       2144
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1319388801"
     variation       2148
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782211885"
     variation       2157
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:570421960"
     variation       2159
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233446685"
     variation       2163
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1356986432"
     variation       2165
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903449103"
     variation       2172
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398571273"
     variation       2178..2182
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1384747823"
     variation       2186
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289955963"
     variation       2187
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455869787"
     variation       2188
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178946"
     variation       2189
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019557484"
     variation       2191
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552938836"
     variation       2194
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568135369"
     variation       2195
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191828485"
     variation       2196
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262235859"
     variation       2198
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113683726"
     variation       2199
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487466781"
     variation       2200
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028366061"
     variation       2210
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952541980"
     variation       2211
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984373902"
     variation       2218
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271923836"
     variation       2219
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213789883"
     variation       2221
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1336436775"
     variation       2231
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255722903"
     variation       2233
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217689403"
     variation       2234
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326206495"
     variation       2238
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782632335"
     variation       2245
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384365384"
     variation       2251..2254
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1554563727"
     variation       2251
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563308060"
     variation       2260
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366149260"
     variation       2264
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372383503"
     variation       2268
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961572082"
     variation       2269
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1441691448"
     variation       2270
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151034742"
     variation       2272
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168780347"
     variation       2301
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461731573"
     variation       2302
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575772278"
     variation       2305
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172287536"
     variation       2306
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:927607632"
     variation       2308
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563355733"
     variation       2309
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252327198"
     variation       2313
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194225266"
     variation       2318
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937700444"
     variation       2319
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554563731"
     variation       2322
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235901133"
     variation       2330
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782266329"
     variation       2335
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914983937"
     variation       2336
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310853485"
     variation       2337
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303286182"
     variation       2341
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373279515"
     variation       2343
                     /gene="FZD9"
                     /gene_synonym="CD349; FZD3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1329400011"
ORIGIN      
ggctctggctcagcggcggctccggtggcagcggcggtggcggctaggcgggctcggcggctcctgtccctcgggcggctgcccgctcgctgcccagggcgcccggacacacgtgggcggctcagcgatggcccgcgccccgcgacgtggcgggcaggcaccggggcgcgggaccgctgagcccgagtgagccggggccgcgctcccgccttcggcccgggcctcccgggatggccgtggcgcctctgcggggggcgctgctgctgtggcagctgctggcggcgggcggcgcggcactggagatcggccgcttcgacccggagcgcgggcgcggggctgcgccgtgccaggcggtggagatccccatgtgccgcggcatcggctacaacctgacccgcatgcccaacctgctgggccacacgtcgcagggcgaggcggctgccgagctagcggagttcgcgccgctggtgcagtacggctgccacagccacctgcgcttcttcctgtgctcgctctacgcgcccatgtgcaccgaccaggtctcgacgcccattcccgcctgccggcccatgtgcgagcaggcgcgcctgcgctgcgcgcccatcatggagcagttcaacttcggctggccggactcgctcgactgcgcccggctgcccacgcgcaacgacccgcacgcgctgtgcatggaggcgcccgagaacgccacggccggccccgcggagccccacaagggcctgggcatgctgcccgtggcgccgcggcccgcgcgccctcccggagacctgggcccgggcgcgggcggcagtggcacctgcgagaaccccgagaagttccagtacgtggagaagagccgctcgtgcgcaccgcgctgcgggcccggcgtcgaggtgttctggtcccggcgcgacaaggacttcgcgctggtctggatggccgtgtggtcggcgctgtgcttcttctccaccgccttcactgtgctcaccttcttgctggagccccaccgcttccagtaccccgagcgccccatcatcttcctctccatgtgctacaacgtctactcgctggccttcctgatccgtgcggtggccggagcgcagagcgtggcctgtgaccaggaggcgggcgcgctctacgtgatccaggagggcctggagaacacgggctgcacgctggtcttcctactgctctactacttcggcatggccagctcgctctggtgggtggtcctgacgctcacctggttcctggctgccgggaagaaatggggccacgaggccatcgaggcccacggcagctatttccacatggctgcctggggcctgcccgcgctcaagaccatcgtcatcctgaccctgcgcaaggtggcgggtgatgagctgactgggctttgctacgtggccagcacggatgcagcagcgctcacgggcttcgtgctggtgcccctctctggctacctggtgctgggcagtagtttcctcctgaccggcttcgtggccctcttccacatccgcaagatcatgaagacgggcggcaccaacacagagaagctggagaagctcatggtcaagatcggggtcttctccatcctctacacggtgcccgccacctgcgtcatcgtttgctatgtctacgaacgcctcaacatggacttctggcgccttcgggccacagagcagccatgcgcagcggccgcggggcccggaggccggagggactgctcgctgccagggggctcggtgcccaccgtggcggtcttcatgctcaaaattttcatgtcactggtggtggggatcaccagcggcgtctgggtgtggagctccaagactttccagacctggcagagcctgtgctaccgcaagatagcagctggccgggcccgggccaaggcctgccgcgcccccgggagctacggacgtggcacgcactgccactataaggctcccaccgtggtcttgcacatgactaagacggacccctctttggagaaccccacacacctctagccacacaggcctggcgcggggtggctgctgccccctccttgccctccacgccctgccccctgcatcccctagagacagctgactagcagctgcccagctgtcaaggtcaggcaagtgagcaccggggactgaggatcagggcgggaccccgtgaggctcattaggggagatgggggtctcccctaatgcgggggctggaccaggctgagtccccacagggtcctagtggaggatgtggaggggcggggcagaggggtccagccggagtttatttaatgatgtaatttattgttgcgttcctctggaagctgtgactggaataaacccccgcgtggca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]