GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:16:05, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_003380               2154 bp    mRNA    linear   PRI 29-FEB-2020
DEFINITION  Homo sapiens vimentin (VIM), mRNA.
ACCESSION   NM_003380
VERSION     NM_003380.5
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2154)
  AUTHORS   Fragoza R, Das J, Wierbowski SD, Liang J, Tran TN, Liang S, Beltran
            JF, Rivera-Erick CA, Ye K, Wang TY, Yao L, Mort M, Stenson PD,
            Cooper DN, Wei X, Keinan A, Schimenti JC, Clark AG and Yu H.
  TITLE     Extensive disruption of protein interactions by genetic variants
            across the allele frequency spectrum in human populations
  JOURNAL   Nat Commun 10 (1), 4141 (2019)
   PUBMED   31515488
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2154)
  AUTHORS   Lin H, Hong Y, Huang B, Liu X, Zheng J and Qiu S.
  TITLE     Vimentin Overexpressions Induced by Cell Hypoxia Promote
            Vasculogenic Mimicry by Renal Cell Carcinoma Cells
  JOURNAL   Biomed Res Int 2019, 7259691 (2019)
   PUBMED   31428643
  REMARK    GeneRIF: Vimentin plays an important role in hypoxia induced
            Vasculogenic mimicry formation of renal cell carcinoma (RCC) cells
            and targeted Vimentin might be beneficial for RCC therapy
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2154)
  AUTHORS   Karamagkiolas S, Giotakis I, Kyrodimos E, Giotakis EI, Kataki A,
            Karagianni F and Lazaris AM.
  TITLE     Expression of vimentin (VIM) and metastasis-associated 1 (MTA1)
            protein in laryngeal squamous cell carcinoma are associated with
            prognostic outcome of patients
  JOURNAL   Am J Otolaryngol 40 (4), 487-493 (2019)
   PUBMED   30979652
  REMARK    GeneRIF: VIM constitutes potential tumor biomarkers in LSCC and
            could be integrated into a multiparametric prognostic model.
REFERENCE   4  (bases 1 to 2154)
  AUTHORS   Matsubara T, Toyokawa G, Takada K, Kinoshita F, Kozuma Y, Akamine
            T, Shimokawa M, Haro A, Osoegawa A, Tagawa T and Mori M.
  TITLE     The association and prognostic impact of enhancer of zeste
            homologue 2 expression and epithelial-mesenchymal transition in
            resected lung adenocarcinoma
  JOURNAL   PLoS ONE 14 (5), e0215103 (2019)
   PUBMED   31042721
  REMARK    GeneRIF: Results find that VIM overexpression was significantly
            correlated with poor disease-free and overall survival of patients
            with lung adenocarcinoma. Vimentin is a key factor linking EMT and
            EZH2 in lung adenocarcinoma.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2154)
  AUTHORS   Naumova LA, Osipova ON and Klinnikova MG.
  TITLE     Immunistochemical Analysis of the Expression of TGFbeta,
            Galectin-1, Vimentin, and Thrombospondin in Gastric Cancer
            Associated with Systemic Undifferentiated Connective Tissue
            Dysplasia
  JOURNAL   Bull. Exp. Biol. Med. 166 (6), 774-778 (2019)
   PUBMED   31028580
  REMARK    GeneRIF: Intestinal type of gastric cancer associated with
            connective tissue dysplasia is characterized by a high level of
            expression of galectin-1 and vimentin in the perifocal zone and
            TGF-beta in the tumor zone.
REFERENCE   6  (bases 1 to 2154)
  AUTHORS   Brunkener M and Georgatos SD.
  TITLE     Membrane-binding properties of filensin, a cytoskeletal protein of
            the lens fiber cells
  JOURNAL   J. Cell. Sci. 103 (Pt 3), 709-718 (1992)
   PUBMED   1478967
REFERENCE   7  (bases 1 to 2154)
  AUTHORS   Norwitz ER, Fernandez-Shaw S, Barlow DH and Starkey PM.
  TITLE     Expression of intermediate filament in endometrial glands changes
            with the onset of pregnancy and in endometriosis
  JOURNAL   Hum. Reprod. 6 (10), 1470-1473 (1991)
   PUBMED   1722806
REFERENCE   8  (bases 1 to 2154)
  AUTHORS   Merdes A, Brunkener M, Horstmann H and Georgatos SD.
  TITLE     Filensin: a new vimentin-binding, polymerization-competent, and
            membrane-associated protein of the lens fiber cell
  JOURNAL   J. Cell Biol. 115 (2), 397-410 (1991)
   PUBMED   1918147
REFERENCE   9  (bases 1 to 2154)
  AUTHORS   Honore B, Madsen P, Basse B, Andersen A, Walbum E, Celis JE and
            Leffers H.
  TITLE     Nucleotide sequence of cDNA covering the complete coding part of
            the human vimentin gene
  JOURNAL   Nucleic Acids Res. 18 (22), 6692 (1990)
   PUBMED   2251132
REFERENCE   10 (bases 1 to 2154)
  AUTHORS   Gupta AK, Aubin JE and Waye MM.
  TITLE     Isolation of a human vimentin cDNA with a long 3'-noncoding region
            from a human osteosarcoma cell line (MG-63)
  JOURNAL   Gene 86 (2), 303-304 (1990)
   PUBMED   2323579
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA980400.1, BQ050765.1 and
            BC000163.2.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 23, 2018 this sequence version replaced NM_003380.4.
            
            Summary: This gene encodes a type III intermediate filament
            protein. Intermediate filaments, along with microtubules and actin
            microfilaments, make up the cytoskeleton. The encoded protein is
            responsible for maintaining cell shape and integrity of the
            cytoplasm, and stabilizing cytoskeletal interactions. This protein
            is involved in neuritogenesis and cholesterol transport and
            functions as an organizer of a number of other critical proteins
            involved in cell attachment, migration, and signaling. Bacterial
            and viral pathogens have been shown to attach to this protein on
            the host cell surface. Mutations in this gene are associated with
            congenital cataracts in human patients. [provided by RefSeq, Aug
            2017].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC066956.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2144120, SAMEA2148093
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000544301.7/ ENSP00000446007.1
            RefSeq Select criteria :: based on conservation, longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-18                DA980400.1         32-49
            19-307              BQ050765.1         1-289
            308-2154            BC000163.2         1-1847
FEATURES             Location/Qualifiers
     source          1..2154
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10p13"
     gene            1..2154
                     /gene="VIM"
                     /note="vimentin"
                     /db_xref="GeneID:7431"
                     /db_xref="HGNC:HGNC:12692"
                     /db_xref="MIM:193060"
     exon            1..284
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223721867"
     variation       3
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775749306"
     variation       8
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908246744"
     variation       9
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:572292530"
     variation       11..12
                     /gene="VIM"
                     /replace=""
                     /replace="aaaagccttt"
                     /db_xref="dbSNP:1227947811"
     variation       12
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1354773757"
     variation       13
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311528182"
     variation       15
                     /gene="VIM"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1237988428"
     variation       15
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1248203642"
     variation       18
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376291953"
     variation       22
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294561131"
     variation       23
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940913896"
     variation       24
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1348483114"
     variation       25
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037985306"
     variation       27
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1400893821"
     variation       31
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362124167"
     variation       43
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1156485523"
     variation       46
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438502445"
     variation       47
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481546276"
     variation       48
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920740551"
     variation       49
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200338833"
     variation       52
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428843880"
     variation       57
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:932144102"
     variation       62
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150634167"
     variation       65
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216295707"
     variation       67
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049137359"
     variation       69
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890509009"
     variation       70
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772637318"
     variation       72
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888683375"
     variation       82
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1001947317"
     variation       89
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536007471"
     variation       90
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366161111"
     variation       91
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405918294"
     variation       94
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371486210"
     variation       97
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342812399"
     variation       99
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:903222283"
     variation       111
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000052726"
     variation       112
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418730821"
     variation       113
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032868502"
     variation       114
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014370330"
     variation       118
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412657565"
     variation       120
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:958886648"
     variation       121
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343216755"
     variation       126
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763122823"
     variation       130
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219986383"
     variation       131
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024561754"
     variation       146
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1191759564"
     variation       149
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971167990"
     variation       151
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190287996"
     variation       155..156
                     /gene="VIM"
                     /replace=""
                     /replace="gg"
                     /db_xref="dbSNP:1256628899"
     variation       158
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338705775"
     variation       160
                     /gene="VIM"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:201668694"
     variation       160
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278494509"
     variation       163
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:908194238"
     variation       164..169
                     /gene="VIM"
                     /replace="gtaagt"
                     /replace="gtaagtaagt"
                     /db_xref="dbSNP:1291780866"
     variation       166..167
                     /gene="VIM"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1342710687"
     variation       169
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490468889"
     variation       170
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80339700"
     variation       185
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115005130"
     variation       186
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489915515"
     variation       187
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910930778"
     variation       191..199
                     /gene="VIM"
                     /replace="gcgcgcg"
                     /replace="gcgcgcgcg"
                     /replace="gcgcgcgcgcg"
                     /db_xref="dbSNP:1237425386"
     variation       196
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537015100"
     variation       197
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932231626"
     variation       199
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467171653"
     variation       202
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745419154"
     variation       209
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529428223"
     variation       214
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477603770"
     variation       217
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257068573"
     variation       224
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425731042"
     variation       229
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163315350"
     variation       233
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363353369"
     variation       234
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912082460"
     variation       235
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236993750"
     misc_feature    243..245
                     /gene="VIM"
                     /note="upstream in-frame stop codon"
     variation       248
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547895152"
     variation       253
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041809363"
     variation       254
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320705789"
     variation       255
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1048517924"
     variation       259..261
                     /gene="VIM"
                     /replace="ctc"
                     /replace="ctctc"
                     /db_xref="dbSNP:910031805"
     variation       265
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937645221"
     variation       266
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056430328"
     variation       268
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226269338"
     variation       269
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903295814"
     variation       272
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560417230"
     variation       280
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041841777"
     variation       281
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903228052"
     variation       282
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285958440"
     variation       284
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000124528"
     exon            285..994
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       285
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111294049"
     variation       287
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933795596"
     variation       291
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046983690"
     variation       293
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886984871"
     variation       307
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259634473"
     variation       310
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266777155"
     variation       314
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192867529"
     variation       319..323
                     /gene="VIM"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1358085542"
     variation       320
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184010176"
     variation       327
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1242186290"
     variation       329
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564372017"
     variation       333
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384309722"
     variation       336
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306231626"
     variation       337
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038477001"
     variation       338
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369476895"
     variation       344
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894139166"
     variation       350
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574354033"
     variation       351
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:915951014"
     variation       353
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545555"
     variation       359
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365033399"
     variation       363
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970174530"
     variation       369
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564372042"
     variation       371
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981807495"
     variation       374
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347149833"
     variation       375
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373139864"
     variation       377
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288308548"
     variation       378
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434066779"
     variation       380
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939907502"
     variation       382
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1365067614"
     variation       383
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375938720"
     variation       386
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768955645"
     variation       388
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559734613"
     variation       389
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564372079"
     variation       390
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374772089"
     variation       391..394
                     /gene="VIM"
                     /replace="cgcc"
                     /replace="cgccgcc"
                     /db_xref="dbSNP:780490354"
     variation       395
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564372087"
     variation       398
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300093636"
     variation       399
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931113731"
     variation       400
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748278063"
     variation       401
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773418308"
     variation       403
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760750553"
     variation       404
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766395068"
     variation       405
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200253669"
     variation       407
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764964401"
     variation       410
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3758410"
     variation       411
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478357437"
     variation       412
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190892630"
     variation       416
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758065868"
     variation       418
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473802054"
     variation       420
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:564342704"
     variation       421
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902216410"
     variation       424
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403305145"
     variation       429
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751048382"
     variation       430
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1326037440"
     CDS             432..1832
                     /gene="VIM"
                     /note="epididymis secretory sperm binding protein"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_003371.2"
                     /db_xref="CCDS:CCDS7120.1"
                     /db_xref="GeneID:7431"
                     /db_xref="HGNC:HGNC:12692"
                     /db_xref="MIM:193060"
                     /translation="
MSTRSVSSSSYRRMFGGPGTASRPSSSRSYVTTSTRTYSLGSALRPSTSRSLYASSPGGVYATRSSAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHEEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESTEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPNFSSLNLRETNLDSLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    435..716
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Head"
     misc_feature    435..437
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylserine. {ECO:0000269|Ref.13}; propagated
                     from UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    444..446
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    450..452
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="O-linked (GlcNAc) serine, alternate.
                     {ECO:0000269|PubMed:20068230}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); glycosylation site"
     misc_feature    450..452
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKA and PKC, alternate.
                     {ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    453..455
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    456..458
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKC.
                     {ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    459..461
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKC.
                     {ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    471..734
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:309741"
     misc_feature    489..491
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:24275569}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    504..506
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:23186163, ECO:0000244|PubMed:24275569};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    507..509
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    528..530
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="O-linked (GlcNAc) threonine.
                     {ECO:0000269|PubMed:20068230}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); glycosylation site"
     misc_feature    531..533
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="O-linked (GlcNAc) serine, alternate.
                     {ECO:0000269|PubMed:20068230}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); glycosylation site"
     misc_feature    531..533
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKC, alternate.
                     {ECO:0000244|PubMed:18669648}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    546..548
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CaMK2, PKA, PKC and ROCK2.
                     {ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:23186163,
                     ECO:0000244|PubMed:24275569, ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    555..557
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKC.
                     {ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163, ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    570..572
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    576..578
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    582..584
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:19690332, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    588..590
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000250|UniProtKB:P20152};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    594..596
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:P31000};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    597..599
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CDK5 and CDK1.
                     {ECO:0000244|PubMed:16964243, ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:19690332, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163, ECO:0000269|PubMed:21465480,
                     ECO:0000269|Ref.14}; propagated from UniProtKB/Swiss-Prot
                     (P08670.4); phosphorylation site"
     misc_feature    612..614
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:19690332, ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    627..629
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    645..647
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by AURKB and ROCK2.
                     {ECO:0000244|PubMed:18669648, ECO:0000269|PubMed:12458200,
                     ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    648..650
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:23186163,
                     ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    678..680
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:24275569};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    690..692
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:24275569};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    717..824
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Coil 1A"
     misc_feature    735..1661
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:306535"
     misc_feature    780..782
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000244|PubMed:15592455};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    789..791
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000244|PubMed:19608861}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    789..791
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); modified site"
     misc_feature    816..818
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    816..818
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); modified site"
     misc_feature    825..890
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Linker 1"
     misc_feature    846..848
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000244|PubMed:19608861}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    861..863
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:21406692};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    891..1166
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Coil 1B"
     misc_feature    933..935
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:P20152};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     acetylation site"
     misc_feature    993..995
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    993..995
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); modified site"
     misc_feature    1071..1073
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:17081983,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:23186163,
                     ECO:0000244|PubMed:24275569}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1098..1100
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    1107..1109
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1134..1136
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:P20152};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     acetylation site"
     misc_feature    1167..1235
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Linker 12"
     misc_feature    1236..1652
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Coil 2"
     misc_feature    1311..1313
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    1311..1313
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); modified site"
     misc_feature    1326..1328
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1404..1406
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:P20152};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1407..1418
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: [IL]-x-C-x-x-[DE] motif.
                     {ECO:0000305|PubMed:25417112}"
     misc_feature    1482..1484
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Stutter; propagated from UniProtKB/Swiss-Prot
                     (P08670.4); other site"
     misc_feature    1548..1550
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000244|PubMed:19608861}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    1653..1829
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P08670.4);
                     Region: Tail"
     misc_feature    1656..1658
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1665..1667
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:17081983,
                     ECO:0000244|PubMed:17924679, ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:18691976, ECO:0000244|PubMed:20068231};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1686..1688
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163, ECO:0000244|PubMed:24275569};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1689..1691
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163, ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1707..1709
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:24275569}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1719..1721
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163, ECO:0000244|PubMed:24275569,
                     ECO:0000269|PubMed:14762106}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1737..1739
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); phosphorylation site"
     misc_feature    1743..1745
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1764..1766
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine, alternate.
                     {ECO:0000244|PubMed:19608861}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); acetylation site"
     misc_feature    1764..1766
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine, alternate.
                     {ECO:0000250|UniProtKB:P20152}; propagated from
                     UniProtKB/Swiss-Prot (P08670.4); modified site"
     misc_feature    1767..1769
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1803..1805
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     misc_feature    1806..1808
                     /gene="VIM"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:21406692,
                     ECO:0000244|PubMed:23186163, ECO:0000269|PubMed:14762106};
                     propagated from UniProtKB/Swiss-Prot (P08670.4);
                     phosphorylation site"
     variation       435
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756656437"
     variation       437
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780501367"
     variation       441
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436554874"
     variation       445..446
                     /gene="VIM"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:864309690"
     variation       446
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377255736"
     variation       447
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755242950"
     variation       448
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230052576"
     variation       453
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1288770216"
     variation       454
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779204525"
     variation       456..462
                     /gene="VIM"
                     /replace="tcct"
                     /replace="tcctcct"
                     /db_xref="dbSNP:749805536"
     variation       461
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748381490"
     variation       463
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452327776"
     variation       465
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220895620"
     variation       466
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245254535"
     variation       467
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1484172325"
     variation       470
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031859925"
     variation       472
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278642875"
     variation       476
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772407997"
     variation       477
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773471865"
     variation       480
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747053288"
     variation       484
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545549"
     variation       485
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415150705"
     variation       486
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771023210"
     variation       488
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322281451"
     variation       491
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363106467"
     variation       493
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776383614"
     variation       494
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765009320"
     variation       497
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202092452"
     variation       498
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910563895"
     variation       499
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527439944"
     variation       500
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349662848"
     variation       503
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174783297"
     variation       506
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:957631225"
     variation       509
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439751541"
     variation       510
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775343323"
     variation       511
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356941925"
     variation       513
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194887764"
     variation       515
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259578413"
     variation       522
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762644216"
     variation       527
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260508481"
     variation       528
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763707422"
     variation       529
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344328729"
     variation       530
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531385322"
     variation       534
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756711607"
     variation       537
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766889315"
     variation       538
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754236131"
     variation       545
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238606775"
     variation       552
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755500924"
     variation       554
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779199559"
     variation       557
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382854843"
     variation       558
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748519640"
     variation       559
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758730926"
     variation       562
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318337726"
     variation       565
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778098458"
     variation       566
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771076339"
     variation       569
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279005584"
     variation       570..573
                     /gene="VIM"
                     /replace=""
                     /replace="agca"
                     /db_xref="dbSNP:1554775788"
     variation       571
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335964173"
     variation       573
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201189169"
     variation       574
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745851443"
     variation       576
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769749512"
     variation       577
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312761190"
     variation       578..579
                     /gene="VIM"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1229957937"
     variation       578
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367516245"
     variation       580
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11545553"
     variation       583
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775190116"
     variation       584
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274240494"
     variation       591
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294995968"
     variation       592
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337671316"
     variation       595
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762699034"
     variation       596
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408873660"
     variation       597
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768322635"
     variation       598
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773938980"
     variation       599
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761320242"
     variation       600
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767007282"
     variation       601
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749931833"
     variation       602
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760007125"
     variation       603
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215537817"
     variation       604
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564372278"
     variation       609..612
                     /gene="VIM"
                     /replace="gtgt"
                     /replace="gtgtgtgt"
                     /db_xref="dbSNP:1169271871"
     variation       609
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253533842"
     variation       611
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388964411"
     variation       613
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765742006"
     variation       622
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474263020"
     variation       623
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34171769"
     variation       625
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402661582"
     variation       630
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369470034"
     variation       631
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1445952624"
     variation       633
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778153530"
     variation       635
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11545547"
     variation       636
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435968814"
     variation       637
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:928603903"
     variation       639..667
                     /gene="VIM"
                     /replace="ct"
                     /replace="ctgcggagcagcgtgcccggggtgcggct"
                     /db_xref="dbSNP:755419803"
     variation       642
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235698818"
     variation       643
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777756098"
     variation       644
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344818407"
     variation       646
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202137863"
     variation       651
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270633135"
     variation       654
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757539736"
     variation       655
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402686254"
     variation       656
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564372335"
     variation       657
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972743635"
     variation       658
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781179445"
     variation       659
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111616371"
     variation       660
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184701100"
     variation       661
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11545548"
     variation       663
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865981174"
     variation       664
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325594598"
     variation       665
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480009625"
     variation       669
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173957268"
     variation       671
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564372376"
     variation       672
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867740022"
     variation       675
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413835853"
     variation       680
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779995083"
     variation       681
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050023359"
     variation       683
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382898134"
     variation       684
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749097460"
     variation       686
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385094399"
     variation       687
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324531976"
     variation       693
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330720517"
     variation       694
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221861802"
     variation       697
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290632621"
     variation       701
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330170107"
     variation       702
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228337366"
     variation       709
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259476721"
     variation       710
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484647461"
     variation       711
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452623960"
     variation       713
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144539901"
     variation       714
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868327359"
     variation       715
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1267669767"
     variation       716
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038272949"
     variation       717
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774132663"
     variation       723
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:529112487"
     variation       724
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253712799"
     variation       728
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472762224"
     variation       743
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158368392"
     variation       747
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361987967"
     variation       748
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1459555504"
     variation       750
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867113544"
     variation       752
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163932067"
     variation       753
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390058731"
     variation       754
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403341247"
     variation       758
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761507856"
     variation       765
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546992824"
     variation       767
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534064028"
     variation       768
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305547785"
     variation       770
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324002909"
     variation       771
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246101455"
     variation       776
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265543287"
     variation       779
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943771920"
     variation       780
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772634201"
     variation       801
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219813951"
     variation       803
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253507122"
     variation       806
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425939424"
     variation       808
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565243670"
     variation       810
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483298145"
     variation       811
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760190137"
     variation       812
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248095048"
     variation       815
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147857896"
     variation       820
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902288870"
     variation       821
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113013980"
     variation       823
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053391219"
     variation       825
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1216233618"
     variation       827
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11545554"
     variation       830
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565335496"
     variation       833
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045526760"
     variation       834
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532905834"
     variation       844
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437046531"
     variation       845
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461837697"
     variation       855
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296829264"
     variation       862
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757461918"
     variation       864
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781436766"
     variation       869
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042003"
     variation       872
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312562294"
     variation       873
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750493891"
     variation       875
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243129674"
     variation       876
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245849739"
     variation       882
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121917775"
     variation       884
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281806487"
     variation       885
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141319821"
     variation       889
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:999034093"
     variation       892
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323790047"
     variation       893
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779864520"
     variation       894
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749293841"
     variation       895
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778724394"
     variation       896
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201028257"
     variation       897
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747904058"
     variation       900
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406458665"
     variation       903
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457202484"
     variation       904
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442903146"
     variation       907
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771651752"
     variation       908
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390810752"
     variation       912
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772870142"
     variation       913
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746513281"
     variation       914
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361269617"
     variation       920
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201551781"
     variation       921
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377524590"
     variation       924
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:569704234"
     variation       929
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774888281"
     variation       930
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:267602430"
     variation       931
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762190767"
     variation       937
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767649276"
     variation       939
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361960709"
     variation       944
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750589084"
     variation       945
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11545550"
     variation       948
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756282194"
     variation       949
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766499205"
     variation       953
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746924511"
     variation       954
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313812412"
     variation       955
                     /gene="VIM"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:779272287"
     variation       956
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753896793"
     variation       961
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262487660"
     variation       962
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459941371"
     variation       966
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200409133"
     variation       968
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754952038"
     variation       969
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866834871"
     variation       971
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778785495"
     variation       973
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149942621"
     variation       974
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427520431"
     variation       975
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434157425"
     variation       976
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035750972"
     variation       977
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961464401"
     variation       978
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972689698"
     variation       979
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427593011"
     variation       981
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459289381"
     variation       982
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321743889"
     variation       983
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284367198"
     variation       984
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201325757"
     variation       985
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545551"
     variation       990
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777297315"
     variation       994
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343201036"
     exon            995..1055
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       995
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351847897"
     variation       1000..1007
                     /gene="VIM"
                     /replace="aggag"
                     /replace="aggaggag"
                     /db_xref="dbSNP:1281686142"
     variation       1001
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888498183"
     variation       1002
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373295180"
     variation       1006
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1334832994"
     variation       1008
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007423361"
     variation       1009
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005304137"
     variation       1010
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767474660"
     variation       1012
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228442247"
     variation       1014
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303380482"
     variation       1017
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269811567"
     variation       1023
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406182336"
     variation       1026
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363228886"
     variation       1029
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1037734535"
     variation       1030
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145760831"
     variation       1031
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755867026"
     variation       1032
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461281372"
     variation       1033
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765911800"
     variation       1036
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866251474"
     variation       1038
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386842396"
     variation       1040
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148956484"
     variation       1043
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143636314"
     variation       1046
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778351047"
     variation       1054
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1085307141"
     exon            1056..1151
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1056
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448514100"
     variation       1061
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61761616"
     variation       1062
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455890040"
     variation       1064
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773230033"
     variation       1065
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760525619"
     variation       1066
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116800063"
     variation       1069
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776474793"
     variation       1070
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775483110"
     variation       1073
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759162591"
     variation       1077
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138235394"
     variation       1080
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752236825"
     variation       1081
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762391438"
     variation       1086
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1349809735"
     variation       1091
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768016203"
     variation       1094
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310277495"
     variation       1095
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304135302"
     variation       1096
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750994048"
     variation       1103
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236184497"
     variation       1104
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897144372"
     variation       1108
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301514675"
     variation       1112
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1305482290"
     variation       1114
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756629184"
     variation       1118
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780328725"
     variation       1121
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754196814"
     variation       1123
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358309285"
     variation       1141
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755181628"
     variation       1142
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252856204"
     variation       1145
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141244457"
     variation       1146
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748255267"
     variation       1148
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1248288717"
     variation       1149
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399047851"
     variation       1150
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:550798765"
     exon            1152..1313
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1159
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992484456"
     variation       1163
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775250376"
     variation       1172
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404795916"
     variation       1176
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445166789"
     variation       1179
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290316532"
     variation       1180
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145152785"
     variation       1181
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381266556"
     variation       1184
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314004123"
     variation       1186
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776147609"
     variation       1189
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773762488"
     variation       1190
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761334638"
     variation       1193
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777132960"
     variation       1196
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403926080"
     variation       1197
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139037306"
     variation       1199
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377349430"
     variation       1200
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753092108"
     variation       1203
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758735029"
     variation       1205
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141519986"
     variation       1208
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764331554"
     variation       1209
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985623715"
     variation       1212
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257540470"
     variation       1213
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480960201"
     variation       1227
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113576905"
     variation       1228
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150878383"
     variation       1229
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137961338"
     variation       1231
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402903305"
     variation       1237
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781127817"
     variation       1238
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745874397"
     variation       1240
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452626097"
     variation       1244
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4903"
     variation       1245
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199515026"
     variation       1248
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175193193"
     variation       1249
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371176373"
     variation       1256
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773992008"
     variation       1260
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747619298"
     variation       1261
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232637574"
     variation       1262
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225351627"
     variation       1264
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048526047"
     variation       1266
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356703491"
     variation       1267
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285046692"
     variation       1269
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147133187"
     variation       1273
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772585290"
     variation       1283
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760172409"
     variation       1286
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765809278"
     variation       1292
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199175580"
     variation       1293
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776031097"
     variation       1296
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471445445"
     variation       1302
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763360647"
     variation       1304
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201299921"
     variation       1309
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764236805"
     variation       1310
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11254467"
     exon            1314..1439
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1315
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747735685"
     variation       1317
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:578255169"
     variation       1330
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144238562"
     variation       1331
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327165886"
     variation       1332
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754861364"
     variation       1334
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1235352018"
     variation       1335
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778821394"
     variation       1339
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752407631"
     variation       1341
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758102529"
     variation       1342
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552165238"
     variation       1343
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965528949"
     variation       1348
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746534016"
     variation       1351
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393644707"
     variation       1352
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770500248"
     variation       1353
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11545546"
     variation       1356
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328451159"
     variation       1360
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780835078"
     variation       1363
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749857760"
     variation       1369
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316382347"
     variation       1374
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769012996"
     variation       1384
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264296526"
     variation       1390
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371431143"
     variation       1392
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762030566"
     variation       1401
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171701809"
     variation       1402
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779403092"
     variation       1403
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772347590"
     variation       1405
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773352810"
     variation       1411
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374235575"
     variation       1412
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193383296"
     variation       1414
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760880333"
     variation       1418
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147429387"
     variation       1425
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200772352"
     variation       1428
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753894774"
     variation       1435
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924667179"
     variation       1439
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111932484"
     exon            1440..1660
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1440
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369763215"
     variation       1441
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778153870"
     variation       1449
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456684069"
     variation       1452
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747338188"
     variation       1455
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771168882"
     variation       1456
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376802470"
     variation       1460
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745965859"
     variation       1463
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769833820"
     variation       1464
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775627643"
     variation       1465
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116370722"
     variation       1472
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049424533"
     variation       1478
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764080683"
     variation       1482
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200740172"
     variation       1486
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866598895"
     variation       1487
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531588660"
     variation       1488
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767278443"
     variation       1492
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766141377"
     variation       1495
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750107979"
     variation       1506
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197860827"
     variation       1507
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261710176"
     variation       1511
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139818786"
     variation       1512
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765859276"
     variation       1516
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114322672"
     variation       1517
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297590942"
     variation       1519
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778207118"
     variation       1520
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311257498"
     variation       1521
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751935909"
     variation       1522
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371054027"
     variation       1523
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116696668"
     variation       1535
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781618375"
     variation       1541
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465571388"
     variation       1546
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746135750"
     variation       1549
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770025384"
     variation       1550
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780026360"
     variation       1553
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749331181"
     variation       1554
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768727457"
     variation       1563
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201530534"
     variation       1564..1565
                     /gene="VIM"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:759564522"
     variation       1564
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761834421"
     variation       1565
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773034702"
     variation       1567
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760289106"
     variation       1569
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358822322"
     variation       1570
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218008674"
     variation       1571
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256043076"
     variation       1572
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749084801"
     variation       1573
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35157876"
     variation       1574
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758992086"
     variation       1577
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482400000"
     variation       1578
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188442437"
     variation       1580
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764590816"
     variation       1581
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267792443"
     variation       1586
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374050623"
     variation       1587
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752126893"
     variation       1602
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432057333"
     variation       1612
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1258626020"
     variation       1615
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470562734"
     variation       1616
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176198427"
     variation       1621
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357615634"
     variation       1631
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757749881"
     variation       1649
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023005847"
     variation       1652
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150986868"
     variation       1653
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564374858"
     variation       1658
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750758121"
     exon            1661..1704
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1661
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373859810"
     variation       1666
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750766626"
     variation       1674
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756434736"
     variation       1677
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564374995"
     variation       1678
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11545541"
     variation       1680
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276819494"
     variation       1688
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545556"
     variation       1690
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490612095"
     variation       1693
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038093456"
     variation       1694
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766644642"
     variation       1696
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754167157"
     variation       1697
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140482660"
     variation       1698
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760767925"
     exon            1705..1790
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1719
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955350530"
     variation       1722
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:982699474"
     variation       1724
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150003485"
     variation       1728
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768266467"
     variation       1731
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146586974"
     variation       1733
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1405354231"
     variation       1737
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467601802"
     variation       1738..1744
                     /gene="VIM"
                     /replace="cccactc"
                     /replace="cccactcccactc"
                     /db_xref="dbSNP:1171511721"
     variation       1739
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761281774"
     variation       1743
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442649286"
     variation       1746
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371902872"
     variation       1747
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372394023"
     variation       1756
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777161019"
     variation       1757
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759925135"
     variation       1758
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424831707"
     variation       1760
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371063888"
     variation       1762
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765564921"
     variation       1763
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753033876"
     variation       1768
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763073277"
     variation       1769
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764285210"
     variation       1778
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751564309"
     variation       1784
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460602699"
     variation       1786
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757220075"
     variation       1788
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414174359"
     exon            1791..2154
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     variation       1791
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214438836"
     variation       1793
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355411378"
     variation       1796
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756019006"
     variation       1797
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779935723"
     variation       1799
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753533838"
     variation       1800
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376668602"
     variation       1801
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754678758"
     variation       1802
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778375034"
     variation       1803
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747701399"
     variation       1804
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771777895"
     variation       1808
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278582700"
     variation       1813
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777412987"
     variation       1815
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158260463"
     variation       1816
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11545543"
     variation       1817
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368414175"
     variation       1818
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372258946"
     variation       1819
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775956508"
     variation       1820
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851316"
     variation       1821
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763181437"
     variation       1823
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781197884"
     variation       1831
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369406521"
     variation       1836
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774501100"
     variation       1839
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406867842"
     variation       1844
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144519674"
     variation       1845
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308031858"
     variation       1851
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468678816"
     variation       1852
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767629215"
     variation       1857
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571601510"
     variation       1860
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1265772352"
     variation       1873
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429245264"
     variation       1875
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760635500"
     variation       1878
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750627825"
     variation       1879
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766176270"
     variation       1882
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753683416"
     variation       1887
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12667"
     variation       1892
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039681305"
     variation       1899
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419968335"
     variation       1902
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557450449"
     variation       1903
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244394114"
     variation       1910
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461941920"
     variation       1916
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:922507761"
     variation       1934
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460796559"
     variation       1938
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933953860"
     variation       1939
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112279926"
     variation       1955
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879850578"
     variation       1959
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002791003"
     variation       1961
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9235"
     variation       1965
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010758891"
     variation       1968
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186277663"
     variation       1970
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338746898"
     variation       1971
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555098108"
     variation       1974
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9059"
     variation       1978
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189996263"
     variation       1979
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9486"
     variation       1983
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001870717"
     variation       1984
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034728296"
     variation       1990
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353081201"
     variation       1993
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009945979"
     variation       1994
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9485"
     variation       1995
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170218553"
     variation       2001
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021308922"
     variation       2002
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:541300349"
     variation       2007
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975346755"
     variation       2014
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357419304"
     variation       2015
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443547684"
     variation       2018
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896040910"
     variation       2019
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542155813"
     variation       2021
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014530164"
     variation       2022
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479628564"
     variation       2023
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559111736"
     variation       2027
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9484"
     variation       2036
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026333067"
     variation       2037
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:951519538"
     variation       2038
                     /gene="VIM"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1360432697"
     variation       2040
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984260754"
     variation       2042
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987730587"
     variation       2044
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016934463"
     variation       2049
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577584527"
     variation       2050
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:940631919"
     variation       2055
                     /gene="VIM"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307839140"
     variation       2060
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545542"
     variation       2061
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393598482"
     variation       2071
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544641752"
     variation       2077
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975371925"
     variation       2079
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3249"
     variation       2089
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920648723"
     variation       2090
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934005023"
     variation       2091..2100
                     /gene="VIM"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /db_xref="dbSNP:948147691"
     variation       2100
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988047951"
     variation       2101
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913818319"
     variation       2103
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259054123"
     variation       2106
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530574581"
     variation       2110
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543289845"
     variation       2115
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777452849"
     variation       2116
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415508816"
     variation       2124
                     /gene="VIM"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049341"
     variation       2131..2132
                     /gene="VIM"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1199863936"
     variation       2135
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158887580"
     variation       2151
                     /gene="VIM"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937770720"
     variation       2152
                     /gene="VIM"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400391286"
     variation       2154
                     /gene="VIM"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3179873"
ORIGIN      
gggaggcccacgtatggcgcctctccaaaggctgcagaagtttcttgctaacaaaaagtccgcacattcgagcaaagacaggctttagcgagttattaaaaacttaggggcgctcttgtcccccacagggcccgaccgcacacagcaaggcgatggcccagctgtaagttggtagcactgagaactagcagcgcgcgcggagcccgctgagacttgaatcaatctggtctaacggtttcccctaaaccgctaggagccctcaatcggcgggacagcagggcgcgtcctctgccactctcgctccgaggtccccgcgccagagacgcagccgcgctcccaccacccacacccaccgcgccctcgttcgcctcttctccgggagccagtccgcgccaccgccgccgcccaggccatcgccaccctccgcagccatgtccaccaggtccgtgtcctcgtcctcctaccgcaggatgttcggcggcccgggcaccgcgagccggccgagctccagccggagctacgtgactacgtccacccgcacctacagcctgggcagcgcgctgcgccccagcaccagccgcagcctctacgcctcgtccccgggcggcgtgtatgccacgcgctcctctgccgtgcgcctgcggagcagcgtgcccggggtgcggctcctgcaggactcggtggacttctcgctggccgacgccatcaacaccgagttcaagaacacccgcaccaacgagaaggtggagctgcaggagctgaatgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaataagatcctgctggccgagctcgagcagctcaagggccaaggcaagtcgcgcctgggggacctctacgaggaggagatgcgggagctgcgccggcaggtggaccagctaaccaacgacaaagcccgcgtcgaggtggagcgcgacaacctggccgaggacatcatgcgcctccgggagaaattgcaggaggagatgcttcagagagaggaagccgaaaacaccctgcaatctttcagacaggatgttgacaatgcgtctctggcacgtcttgaccttgaacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccacgaagaggaaatccaggagctgcaggctcagattcaggaacagcatgtccaaatcgatgtggatgtttccaagcctgacctcacggctgccctgcgtgacgtacgtcagcaatatgaaagtgtggctgccaagaacctgcaggaggcagaagaatggtacaaatccaagtttgctgacctctctgaggctgccaaccggaacaatgacgccctgcgccaggcaaagcaggagtccactgagtaccggagacaggtgcagtccctcacctgtgaagtggatgcccttaaaggaaccaatgagtccctggaacgccagatgcgtgaaatggaagagaactttgccgttgaagctgctaactaccaagacactattggccgcctgcaggatgagattcagaatatgaaggaggaaatggctcgtcaccttcgtgaataccaagacctgctcaatgttaagatggcccttgacattgagattgccacctacaggaagctgctggaaggcgaggagagcaggatttctctgcctcttccaaacttttcctccctgaacctgagggaaactaatctggattcactccctctggttgatacccactcaaaaaggacacttctgattaagacggttgaaactagagatggacaggttatcaacgaaacttctcagcatcacgatgaccttgaataaaaattgcacacactcagtgcagcaatatattaccagcaagaataaaaaagaaatccatatcttaaagaaacagctttcaagtgcctttctgcagtttttcaggagcgcaagatagatttggaataggaataagctctagttcttaacaaccgacactcctacaagatttagaaaaaagtttacaacataatctagtttacagaaaaatcttgtgctagaatactttttaaaaggtattttgaataccattaaaactgcttttttttttccagcaagtatccaaccaacttggttctgcttcaataaatctttggaaaaactc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]