GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 01:18:01, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_002017               3825 bp    mRNA    linear   PRI 02-AUG-2020
DEFINITION  Homo sapiens Fli-1 proto-oncogene, ETS transcription factor (FLI1),
            transcript variant 1, mRNA.
ACCESSION   NM_002017
VERSION     NM_002017.5
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3825)
  AUTHORS   Park SW, Do HJ, Choi W and Kim JH.
  TITLE     Fli-1 promotes proliferation and upregulates NANOGP8 expression in
            T-lymphocyte leukemia cells
  JOURNAL   Biochimie 168, 1-9 (2020)
   PUBMED   31626853
  REMARK    GeneRIF: The authors demonstrate that Fli-1 is a novel upstream
            transcriptional activator of NANOGP8 (Nanog homeobox retrogene P8)
            and provide the molecular details of Fli-1-mediated NANOGP8 gene
            expression.
REFERENCE   2  (bases 1 to 3825)
  AUTHORS   Romswinkel A, Infanger M, Dietz C, Strube F and Kraus A.
  TITLE     The Role of C-X-C Chemokine Receptor Type 4 (CXCR4) in Cell
            Adherence and Spheroid Formation of Human Ewing's Sarcoma Cells
            under Simulated Microgravity
  JOURNAL   Int J Mol Sci 20 (23), E6073 (2019)
   PUBMED   31810195
  REMARK    GeneRIF: Inhibition of CXCR4 did not change spheroid count, or
            structure. Under simulated microgravity, the tumor marker EWS/FLI1
            is intensified, while targeting CXCR4, which influences adhesion
            proteins, did not affect spheroid formation.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 3825)
  AUTHORS   Fang WL, Chen MH, Huang KH, Chang SC, Lin CH, Chao Y, Lo SS, Li AF,
            Wu CW and Shyr YM.
  TITLE     Analysis of the clinical significance of DNA methylation in gastric
            cancer based on a genome-wide high-resolution array
  JOURNAL   Clin Epigenetics 11 (1), 154 (2019)
   PUBMED   31675985
  REMARK    GeneRIF: FLI1 hypermethylation was associated with more advanced
            gastric cancer (GC) and liver and distant lymphatic metastasis.
            Also, patients with FLI1 hypermethylation in plasma samples had a
            significantly worse 5-year disease free survival rate than those
            without suggesting that FLI1 hypermethylation was an independent
            prognostic factor for GC.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 3825)
  AUTHORS   Chen N, Zhao G, Yan X, Lv Z, Yin H, Zhang S, Song W, Li X, Li L, Du
            Z, Jia L, Zhou L, Li W, Hoffman AR, Hu JF and Cui J.
  TITLE     A novel FLI1 exonic circular RNA promotes metastasis in breast
            cancer by coordinately regulating TET1 and DNMT1
  JOURNAL   Genome Biol. 19 (1), 218 (2018)
   PUBMED   30537986
  REMARK    GeneRIF: FECR1, a circular RNA in the FLI1 promoter chromatin
            complex, consisting of FLI1 exons 4-2-3, acts as an upstream
            regulator to control breast cancer tumor growth by coordinating the
            regulation of DNA methylating and demethylating enzymes.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 3825)
  AUTHORS   Bhagirath T, Abe S, Nojima T and Yoshida MC.
  TITLE     Molecular analysis of a t(11;22) translocation junction in a case
            of Ewing's sarcoma
  JOURNAL   Genes Chromosomes Cancer 13 (2), 126-132 (1995)
   PUBMED   7542907
REFERENCE   6  (bases 1 to 3825)
  AUTHORS   Prasad DD, Rao VN and Reddy ES.
  TITLE     Structure and expression of human Fli-1 gene
  JOURNAL   Cancer Res. 52 (20), 5833-5837 (1992)
   PUBMED   1394211
REFERENCE   7  (bases 1 to 3825)
  AUTHORS   Watson DK, Smyth FE, Thompson DM, Cheng JQ, Testa JR, Papas TS and
            Seth A.
  TITLE     The ERGB/Fli-1 gene: isolation and characterization of a new member
            of the family of human ETS transcription factors
  JOURNAL   Cell Growth Differ. 3 (10), 705-713 (1992)
   PUBMED   1445800
REFERENCE   8  (bases 1 to 3825)
  AUTHORS   Delattre O, Zucman J, Plougastel B, Desmaze C, Melot T, Peter M,
            Kovar H, Joubert I, de Jong P, Rouleau G et al.
  TITLE     Gene fusion with an ETS DNA-binding domain caused by chromosome
            translocation in human tumours
  JOURNAL   Nature 359 (6391), 162-165 (1992)
   PUBMED   1522903
REFERENCE   9  (bases 1 to 3825)
  AUTHORS   Baud V, Lipinski M, Rassart E, Poliquin L and Bergeron D.
  TITLE     The human homolog of the mouse common viral integration region,
            FLI1, maps to 11q23-q24
  JOURNAL   Genomics 11 (1), 223-224 (1991)
   PUBMED   1765382
REFERENCE   10 (bases 1 to 3825)
  AUTHORS   Bergeron D, Poliquin L, Kozak CA and Rassart E.
  TITLE     Identification of a common viral integration region in Cas-Br-E
            murine leukemia virus-induced non-T-, non-B-cell lymphomas
  JOURNAL   J. Virol. 65 (1), 7-15 (1991)
   PUBMED   1845910
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK313370.1, AP001122.5 and
            AI354789.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 23, 2018 this sequence version replaced NM_002017.4.
            
            Summary: This gene encodes a transcription factor containing an ETS
            DNA-binding domain. The gene can undergo a t(11;22)(q24;q12)
            translocation with the Ewing sarcoma gene on chromosome 22, which
            results in a fusion gene that is present in the majority of Ewing
            sarcoma cases. An acute lymphoblastic leukemia-associated
            t(4;11)(q21;q23) translocation involving this gene has also been
            identified. Alternative splicing results in multiple transcript
            variants. [provided by RefSeq, Aug 2012].
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660809.81592.1,
                                           SRR1660809.226136.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000527786.7/ ENSP00000433488.2
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1546              AK313370.1         11-1556
            1547-3388           AP001122.5         162455-164296
            3389-3825           AI354789.1         15-451              c
FEATURES             Location/Qualifiers
     source          1..3825
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q24.3"
     gene            1..3825
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="Fli-1 proto-oncogene, ETS transcription factor"
                     /db_xref="GeneID:2313"
                     /db_xref="HGNC:HGNC:3749"
                     /db_xref="MIM:193067"
     exon            1..205
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       13
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343996201"
     variation       16..25
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="acaacaa"
                     /replace="acaacaacaa"
                     /db_xref="dbSNP:778508207"
     variation       16
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033034681"
     variation       24
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1375162994"
     variation       30
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171371379"
     variation       33
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1349472028"
     variation       34
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957428954"
     variation       36
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989273541"
     variation       37
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389132102"
     variation       39
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469446614"
     variation       46..62
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="gcagggcgctcgcaggg"
                     /replace="gcagggcgctcgcagggcgctcgcaggg"
                     /db_xref="dbSNP:1334972439"
     variation       46
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913334472"
     variation       53
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474123987"
     variation       56
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385336385"
     variation       57
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542842246"
     variation       62
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057464718"
     variation       76
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453470342"
     variation       78
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591724500"
     variation       81
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277840656"
     variation       83
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209034165"
     variation       84
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314114494"
     variation       85
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279568031"
     variation       86
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1214098603"
     variation       88
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779080271"
     variation       95
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986657774"
     variation       97
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355264123"
     variation       102
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145654087"
     misc_feature    107..109
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="upstream in-frame stop codon"
     variation       113
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436951081"
     variation       117
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371783978"
     variation       129
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359421921"
     variation       131
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942657889"
     variation       138
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372817629"
     variation       139
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1037979628"
     variation       140
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919567291"
     variation       143
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286017687"
     variation       146
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296946295"
     variation       156
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748604139"
     variation       159
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376557878"
     variation       160
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112860445"
     variation       161..166
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ggggg"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:746564927"
     variation       162
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772912959"
     variation       164
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762545912"
     variation       165
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047214343"
     variation       166
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281668606"
     variation       167
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486831752"
     variation       169
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305844319"
     variation       171
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031551701"
     variation       173
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1219807761"
     variation       174
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766178380"
     variation       175
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232707808"
     variation       176
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774127474"
     variation       184
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759182658"
     CDS             188..1546
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="isoform 1 is encoded by transcript variant 1;
                     transcription factor ERGB; Ewing sarcoma breakpoint region
                     2; Friend leukemia virus integration 1"
                     /codon_start=1
                     /product="Friend leukemia integration 1 transcription
                     factor isoform 1"
                     /protein_id="NP_002008.2"
                     /db_xref="CCDS:CCDS44768.1"
                     /db_xref="GeneID:2313"
                     /db_xref="HGNC:HGNC:3749"
                     /db_xref="MIM:193067"
                     /translation="
MDGTIKEALSVVSDDQSLFDSAYGAAAHLPKADMTASGSPDYGQPHKINPLPPQQEWINQPVRVNVKREYDHMNGSRESPVDCSVSKCSKLVGGGESNPMNYNSYMDEKNGPPPPNMTTNERRVIVPADPTLWTQEHVRQWLEWAIKEYSLMEIDTSFFQNMDGKELCKMNKEDFLRATTLYNTEVLLSHLSYLRESSLLAYNTTSHTDQSSRLSVKEDPSYDSVRRGAWGNNMNSGLNKSPPLGGAQTISKNTEQRPQPDPYQILGPTSSRLANPGSGQIQLWQFLLELLSDSANASCITWEGTNGEFKMTDPDEVARRWGERKSKPNMNYDKLSRALRYYYDKNIMTKVHGKRYAYKFDFHGIAQALQPHPTESSMYKYPSDISYMPSYHAHQQKVNFVPPHPSSMPVTSSSFFGAASQYWTSPTGGIYPNPNVPRHPNTHVPSHLGSYY"
     misc_feature    302..304
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P26323; propagated from
                     UniProtKB/Swiss-Prot (Q01543.1); phosphorylation site"
     misc_feature    527..799
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="Sterile alpha motif (SAM)/Pointed domain of friend
                     leukemia integration 1 transcription activator; Region:
                     SAM_PNT-FLI-1; cd08541"
                     /db_xref="CDD:188883"
     misc_feature    1025..1276
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /note="erythroblast transformation specific domain;
                     Region: ETS; smart00413"
                     /db_xref="CDD:197710"
     variation       194
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767250889"
     variation       195
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752471336"
     variation       196
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955904174"
     variation       199
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425813965"
     variation       201
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756020021"
     exon            206..417
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       209
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781469287"
     variation       214
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748499880"
     variation       215
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443136271"
     variation       217
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756528214"
     variation       218
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778237229"
     variation       223
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241457903"
     variation       226
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475597382"
     variation       227
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749847585"
     variation       229
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370876689"
     variation       230
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778299772"
     variation       235
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053256"
     variation       242
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930543754"
     variation       249
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745372049"
     variation       250
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455202083"
     variation       252
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771690679"
     variation       253
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775179408"
     variation       256
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567772163"
     variation       257
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373912179"
     variation       258
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1355289095"
     variation       260
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1591786807"
     variation       261
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200865469"
     variation       262
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765141939"
     variation       264
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327090593"
     variation       267
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751654742"
     variation       270
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285098123"
     variation       271
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759626716"
     variation       273
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591786849"
     variation       274
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767679813"
     variation       275
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255136135"
     variation       277
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431081211"
     variation       279
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752988685"
     variation       283
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539499213"
     variation       284
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778290469"
     variation       286
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754201848"
     variation       291
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370622805"
     variation       292
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412645415"
     variation       294
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385109234"
     variation       295
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887980506"
     variation       297
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402939267"
     variation       298
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201047249"
     variation       300
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573507310"
     variation       301
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755045136"
     variation       302
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314944105"
     variation       304
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326640656"
     variation       311
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148200397"
     variation       313
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779389569"
     variation       314
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280197829"
     variation       319
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558168664"
     variation       322
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768239056"
     variation       327
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776467314"
     variation       328
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992129665"
     variation       329
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368549466"
     variation       331
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1289492833"
     variation       333
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591786990"
     variation       335
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371445653"
     variation       337
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969709718"
     variation       338
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437379488"
     variation       339
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773175996"
     variation       343
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762753309"
     variation       344
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363867469"
     variation       346
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1470881531"
     variation       349
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767669371"
     variation       362
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021176968"
     variation       369
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979405206"
     variation       377
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752656842"
     variation       382
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186120614"
     variation       383
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175896968"
     variation       386
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764399072"
     variation       389
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754322278"
     variation       390
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201118331"
     variation       395
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750968869"
     variation       397
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191270159"
     variation       400
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438835993"
     variation       407
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301112496"
     variation       414
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474853611"
     variation       416
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245794377"
     exon            418..572
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       418
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271348934"
     variation       420
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340932654"
     variation       422
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266575591"
     variation       424
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239005257"
     variation       426
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574828243"
     variation       427
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368251838"
     variation       433
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1247235445"
     variation       434
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763860996"
     variation       439
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146694829"
     variation       440
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377050968"
     variation       448
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750227544"
     variation       451
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172454817"
     variation       453
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887582204"
     variation       456
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758472441"
     variation       457
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780103598"
     variation       460
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748308796"
     variation       461
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388322483"
     variation       462
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559788217"
     variation       464
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018854833"
     variation       465
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429306672"
     variation       466
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185251679"
     variation       467
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749474182"
     variation       472
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545501579"
     variation       473
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565481092"
     variation       475
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920357140"
     variation       477
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368969366"
     variation       478
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250771940"
     variation       481..484
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1565490310"
     variation       485
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234006479"
     variation       486
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192095459"
     variation       489
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292162184"
     variation       496
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770373355"
     variation       508
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772608802"
     variation       517
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775842771"
     variation       519
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761199818"
     variation       520
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763547819"
     variation       521
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776142665"
     variation       523
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235751770"
     variation       525
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373376557"
     variation       527
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375828068"
     variation       532
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163313975"
     variation       535
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376782867"
     variation       545
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1397078147"
     variation       546
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758240930"
     variation       547
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370809611"
     variation       548
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751482659"
     variation       562
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754876810"
     variation       563
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374178191"
     variation       568
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376181944"
     variation       569
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532130250"
     exon            573..776
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       574
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766483744"
     variation       579
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311386972"
     variation       580
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774236717"
     variation       581
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228053917"
     variation       583
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340485680"
     variation       603
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759858907"
     variation       604
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767846870"
     variation       611
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753153302"
     variation       613
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756526458"
     variation       614
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764505452"
     variation       615
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754401134"
     variation       617
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757642355"
     variation       621
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256870329"
     variation       622
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227155929"
     variation       637
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425646679"
     variation       638
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766752439"
     variation       641
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1362022581"
     variation       649
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745359490"
     variation       650
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566872436"
     variation       654
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180719406"
     variation       655
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895933507"
     variation       657
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432410002"
     variation       662
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768467692"
     variation       664
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201473472"
     variation       667
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372247210"
     variation       670
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375288472"
     variation       672
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769604569"
     variation       676
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975547418"
     variation       680
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774555801"
     variation       681
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288594591"
     variation       685
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759656652"
     variation       686
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751862379"
     variation       696
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182601025"
     variation       699
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775879879"
     variation       702
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484253669"
     variation       707
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411030692"
     variation       709
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175523281"
     variation       713
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1421586900"
     variation       714
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249978436"
     variation       716
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760940767"
     variation       717
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370316451"
     variation       718
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367910414"
     variation       719
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372454174"
     variation       721
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749995325"
     variation       722
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166920984"
     variation       723
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247006536"
     variation       724
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359353263"
     variation       727
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1467300409"
     variation       728
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295929600"
     variation       730
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404192753"
     variation       732
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398999055"
     variation       738
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199855586"
     variation       739
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201742274"
     variation       743
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591800696"
     variation       745
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369172388"
     variation       755
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746665962"
     variation       757
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:928028753"
     variation       760
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408294515"
     variation       765
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314151855"
     variation       773
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866503409"
     exon            777..842
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       777
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212969560"
     variation       781
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751054528"
     variation       782
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754691120"
     variation       788
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022191111"
     variation       790
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271407777"
     variation       795
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781142038"
     variation       796
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220825523"
     variation       798
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752585829"
     variation       799
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357705865"
     variation       800
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227775694"
     variation       801
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200254689"
     variation       802
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777583857"
     variation       803
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1309467335"
     variation       805
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952247955"
     variation       810
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749243304"
     variation       811
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770937644"
     variation       812
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747086030"
     variation       814
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768967434"
     variation       817
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35195224"
     variation       820
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972084757"
     variation       822
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166127709"
     variation       823
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351934698"
     variation       824
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770055770"
     variation       825
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369164251"
     variation       827
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763507751"
     variation       837
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766864970"
     variation       841
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374117160"
     exon            843..908
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       849
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284961106"
     variation       855
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1354165686"
     variation       856
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218279703"
     variation       857
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276105388"
     variation       859
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441530872"
     variation       860
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879016743"
     variation       862
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759172206"
     variation       863
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774860112"
     variation       864
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887724822"
     variation       872
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005120730"
     variation       873
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760049183"
     variation       874
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7113191"
     variation       876
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338530017"
     variation       879
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314562082"
     variation       881
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381241961"
     variation       882
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549977412"
     variation       884
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171000249"
     variation       896
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399384509"
     variation       901
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328693764"
     variation       902
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401733206"
     variation       906
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415308855"
     variation       907
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591389442"
     exon            909..968
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       909
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749462686"
     variation       911
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957900326"
     variation       914
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1159112717"
     variation       916
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441757619"
     variation       920
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201425969"
     variation       925
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1393122275"
     variation       926
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370779379"
     variation       931
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772620694"
     variation       933
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375560426"
     variation       934
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200640652"
     variation       936
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976634800"
     variation       938
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370479993"
     variation       939
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530820815"
     variation       944
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258201062"
     variation       952
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186469317"
     variation       955
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374722269"
     variation       956
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543480265"
     variation       957
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199555637"
     variation       958
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267031470"
     variation       961
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209519352"
     exon            969..1016
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       972
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772919605"
     variation       973
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762785401"
     variation       978
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046480676"
     variation       983
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375259681"
     variation       985
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974518707"
     variation       990
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751545687"
     variation       991
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363259180"
     variation       992..993
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:373481448"
     variation       992
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273162067"
     variation       1000
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422162101"
     variation       1002
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759402782"
     variation       1012
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368505169"
     exon            1017..3825
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1020
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425076357"
     variation       1021
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375151134"
     variation       1022
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457299867"
     variation       1036
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179005819"
     variation       1045
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409973781"
     variation       1049
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431024186"
     variation       1054
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369900426"
     variation       1055
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174929544"
     variation       1057
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766821081"
     variation       1058
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470685669"
     variation       1060
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565512817"
     variation       1063
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369798344"
     variation       1064
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400188697"
     variation       1069
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448246958"
     variation       1070
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555150627"
     variation       1071
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748615215"
     variation       1075
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373070689"
     variation       1076
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171222613"
     variation       1079
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302274076"
     variation       1087
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325974001"
     variation       1096
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777080800"
     variation       1099
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311597294"
     variation       1102
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1224911315"
     variation       1105
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748983663"
     variation       1108
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317217597"
     variation       1111
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770478495"
     variation       1117
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371028645"
     variation       1123
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773448214"
     variation       1126
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774270439"
     variation       1127
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190228942"
     variation       1129
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733405"
     variation       1130
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481244317"
     variation       1132
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167904956"
     variation       1138
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887292064"
     variation       1141
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359146212"
     variation       1145
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172264766"
     variation       1150
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466540970"
     variation       1153
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200962985"
     variation       1154
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760569858"
     variation       1156
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765367649"
     variation       1157
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773148506"
     variation       1158
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763299138"
     variation       1163
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395695165"
     variation       1164
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766475254"
     variation       1174
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168213332"
     variation       1178..1182
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="aatta"
                     /db_xref="dbSNP:1064797085"
     variation       1179
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386635255"
     variation       1183
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752016751"
     variation       1192
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755414716"
     variation       1196
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1064797083"
     variation       1197
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1064797086"
     variation       1198
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767951495"
     variation       1201
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1186925913"
     variation       1204
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275059600"
     variation       1206
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1131691896"
     variation       1215
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1064797084"
     variation       1220
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1064797087"
     variation       1222
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319894662"
     variation       1226..1230
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1220534435"
     variation       1226
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1292307381"
     variation       1228
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753259644"
     variation       1240
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191071402"
     variation       1243
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371530389"
     variation       1244
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475468866"
     variation       1252
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330768597"
     variation       1255
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374459474"
     variation       1273
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748743560"
     variation       1276
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556748974"
     variation       1277
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778517558"
     variation       1281
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745476175"
     variation       1283
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771888543"
     variation       1287
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297840530"
     variation       1288
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775203255"
     variation       1294
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432933380"
     variation       1300
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290029672"
     variation       1305
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747021663"
     variation       1306
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768469579"
     variation       1309
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377471737"
     variation       1314
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766430761"
     variation       1315
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766521149"
     variation       1317
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201671275"
     variation       1319
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213948992"
     variation       1320
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284906569"
     variation       1321
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759764204"
     variation       1323
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217293356"
     variation       1324
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774448454"
     variation       1328
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768006640"
     variation       1329
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1472717533"
     variation       1331
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355183747"
     variation       1336
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184765149"
     variation       1341
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906927453"
     variation       1342..1346
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:1387412409"
     variation       1343
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266178629"
     variation       1345
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370266659"
     variation       1347
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939529769"
     variation       1348
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438258861"
     variation       1349
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158457075"
     variation       1352
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408952807"
     variation       1358
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053261"
     variation       1360
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753098147"
     variation       1362
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591393739"
     variation       1363
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056664553"
     variation       1364
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139830377"
     variation       1365
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447131318"
     variation       1366
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764478182"
     variation       1376
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197172974"
     variation       1377
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753438511"
     variation       1378
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201109280"
     variation       1388
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308334230"
     variation       1394
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758847193"
     variation       1395
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350937257"
     variation       1396
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414724871"
     variation       1405
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778358115"
     variation       1406
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750084176"
     variation       1408
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441353835"
     variation       1409
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779887574"
     variation       1418
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779993972"
     variation       1419
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768685480"
     variation       1423
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367970398"
     variation       1437
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767560146"
     variation       1441
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371247490"
     variation       1442
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186156572"
     variation       1444
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774514059"
     variation       1445
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976558650"
     variation       1450
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987289153"
     variation       1454
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243527409"
     variation       1457
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1334622147"
     variation       1460
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1459464785"
     variation       1461..1465
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1565513371"
     variation       1463
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235520274"
     variation       1465
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759896141"
     variation       1467
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531254948"
     variation       1468
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374370811"
     variation       1473
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760927892"
     variation       1475
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1327859525"
     variation       1479
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764473254"
     variation       1481
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754336205"
     variation       1483
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368298758"
     variation       1484
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565513421"
     variation       1486
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343897959"
     variation       1491
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223565660"
     variation       1492
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372364609"
     variation       1493
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764743895"
     variation       1498
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749926274"
     variation       1499
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251622944"
     variation       1500
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375383556"
     variation       1508
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779654903"
     variation       1511
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754757497"
     variation       1512
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909090459"
     variation       1513
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763694366"
     variation       1516
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373018480"
     variation       1517
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371183121"
     variation       1518
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779201816"
     variation       1519
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396888425"
     variation       1520
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745912015"
     variation       1521
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772473111"
     variation       1528
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931533717"
     variation       1546..1552
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gaagctt"
                     /db_xref="dbSNP:779583322"
     variation       1549
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775599356"
     variation       1550
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747186747"
     variation       1553
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1405254194"
     variation       1554
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149837029"
     variation       1556
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337801221"
     variation       1560
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777002121"
     variation       1566
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762352696"
     variation       1567
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408999613"
     variation       1570
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376209645"
     variation       1574
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466909411"
     variation       1579..1581
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:746336056"
     variation       1582
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369195794"
     variation       1585
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762467076"
     variation       1592
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765810888"
     variation       1595
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751204647"
     variation       1597
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908826547"
     variation       1600
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547062589"
     variation       1603
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279519389"
     variation       1613
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747372310"
     variation       1621
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055947276"
     variation       1624
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057360711"
     variation       1627
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343279660"
     variation       1630
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307881765"
     variation       1633..1641
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="gaag"
                     /replace="gaagggaag"
                     /db_xref="dbSNP:769718312"
     variation       1641
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916788045"
     variation       1642
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570570601"
     variation       1648
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1043956855"
     variation       1649
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533111924"
     variation       1650
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904087604"
     variation       1655
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591394107"
     variation       1663
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904533937"
     variation       1664
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999493906"
     variation       1666
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455332731"
     variation       1670
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591394121"
     variation       1675
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364303724"
     variation       1681
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252850161"
     variation       1685
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1192505117"
     variation       1700..1707
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1339755588"
     variation       1703
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052947429"
     variation       1704
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052472890"
     variation       1707
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1193834612"
     variation       1710
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901839816"
     variation       1715
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284082092"
     variation       1717
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203751685"
     variation       1724
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394161"
     variation       1731
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891752789"
     variation       1733
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289806235"
     variation       1734
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490911656"
     variation       1735
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1008675856"
     variation       1738
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305910701"
     variation       1746
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441848548"
     variation       1750
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326058544"
     variation       1759
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018742570"
     variation       1760
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964778029"
     variation       1761
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432361487"
     variation       1762
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565513682"
     variation       1764
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566678282"
     variation       1765
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029460730"
     variation       1766
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537880683"
     variation       1767
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995958415"
     variation       1769
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191549748"
     variation       1774
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449049998"
     variation       1790
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264574819"
     variation       1791
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006034708"
     variation       1795
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016203477"
     variation       1797
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961985208"
     variation       1801
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427249921"
     variation       1813
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778325713"
     variation       1824
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282632145"
     variation       1825
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195867058"
     variation       1826
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569932015"
     variation       1827
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374156053"
     variation       1850
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268611815"
     variation       1856
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229368439"
     variation       1863
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555900665"
     variation       1864
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781007890"
     variation       1867
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74630747"
     variation       1871
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416975986"
     variation       1877
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169249882"
     variation       1886
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41302401"
     variation       1889
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:917439074"
     variation       1891
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948784152"
     variation       1894..1896
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1485014358"
     variation       1896
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41302403"
     variation       1904
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394302"
     variation       1907
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534300746"
     variation       1909
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925440482"
     variation       1910
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554194861"
     variation       1913
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271185757"
     variation       1921
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053110283"
     variation       1927
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749468266"
     variation       1934
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339845330"
     variation       1945
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997889197"
     variation       1946
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41302405"
     variation       1947
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1008772372"
     variation       1949
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440878705"
     variation       1957
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297567544"
     variation       1967
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040160646"
     variation       1971
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1591394362"
     variation       1975
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394364"
     variation       1977
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591394368"
     variation       1981
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410244547"
     variation       1990
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243748359"
     variation       1991
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164706559"
     variation       1993
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900346260"
     variation       1998
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996441756"
     variation       2000
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1182909095"
     variation       2007
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571947575"
     variation       2008
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565513860"
     variation       2009
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006297959"
     variation       2018
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867981825"
     variation       2023
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053264"
     variation       2025
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016129571"
     variation       2026
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231187557"
     variation       2027
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206700425"
     variation       2028
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527556457"
     variation       2029
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556624427"
     variation       2034
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576311027"
     variation       2036
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993462529"
     variation       2037
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027390382"
     variation       2039
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1591394421"
     variation       2040
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1591394423"
     variation       2048
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272759784"
     variation       2056
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361838788"
     variation       2088..2093
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:1223585417"
     variation       2090
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035982256"
     variation       2092
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959736123"
     variation       2093
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328543334"
     variation       2098
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394444"
     variation       2101
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371079260"
     variation       2107..2127
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="agacgccaagggcattgcaga"
                     /replace="agacgccaagggcattgcagacgccaagggcattgcaga"
                     /db_xref="dbSNP:1565513917"
     variation       2109
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:951929494"
     variation       2110
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375154406"
     variation       2111
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1369848945"
     variation       2113
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561369755"
     variation       2117
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545686596"
     variation       2118
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968466734"
     variation       2132..2133
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gga"
                     /db_xref="dbSNP:1565513966"
     variation       2132
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147953720"
     variation       2134
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925489884"
     variation       2149
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935465715"
     variation       2150
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961595531"
     variation       2151
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141891993"
     variation       2155
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147030479"
     variation       2169
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180185179"
     variation       2170
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252644376"
     variation       2174
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7130622"
     variation       2175
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565514015"
     variation       2176..2178
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:749209355"
     variation       2178
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423784714"
     variation       2187
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923496748"
     variation       2188
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182112774"
     variation       2198
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569517133"
     variation       2201
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315095923"
     variation       2206
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1286231014"
     variation       2218
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387538843"
     variation       2219
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980716868"
     variation       2221
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926050962"
     variation       2229
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549940641"
     variation       2231
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767613683"
     variation       2232
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563472268"
     variation       2240
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1343973878"
     variation       2246
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760067517"
     variation       2247
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470640977"
     variation       2249
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420388773"
     variation       2250..2264
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ttttttttttttt"
                     /replace="tttttttttttttt"
                     /replace="ttttttttttttttt"
                     /replace="tttttttttttttttt"
                     /db_xref="dbSNP:201085556"
     variation       2264
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529222932"
     variation       2265
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549262715"
     variation       2266
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385544902"
     variation       2267
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942133154"
     variation       2268
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037780925"
     variation       2275
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334439133"
     variation       2279
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745738986"
     variation       2300
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485066167"
     variation       2324
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384634537"
     variation       2327
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897669173"
     variation       2328
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564070091"
     variation       2335
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771986773"
     variation       2340
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360228357"
     variation       2341
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534133325"
     variation       2345
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401211645"
     variation       2361
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241233925"
     variation       2364
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375372175"
     variation       2365
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1049403487"
     variation       2374
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190134547"
     variation       2381
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483202165"
     variation       2390
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426518008"
     variation       2392
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202404474"
     variation       2393
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1421312639"
     variation       2394
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1012820628"
     variation       2400
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474877038"
     variation       2403..2406
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1255278954"
     variation       2408
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212431787"
     variation       2417
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181502037"
     variation       2420
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483268620"
     variation       2421
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:539677800"
     variation       2427
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775332838"
     variation       2445
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201936634"
     variation       2452
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1014568389"
     variation       2453
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280569764"
     variation       2454
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394703"
     variation       2455
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219602686"
     variation       2457
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355439953"
     variation       2460
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291921163"
     variation       2466
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968351595"
     variation       2467
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556695014"
     variation       2477
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576203387"
     variation       2478
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896138642"
     variation       2479
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460709760"
     variation       2481
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031346113"
     variation       2483
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956914905"
     variation       2490
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988688896"
     variation       2491
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394752"
     variation       2492
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024557956"
     variation       2498
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189899774"
     variation       2499
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970750331"
     variation       2502
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249278354"
     variation       2507
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160634992"
     variation       2509
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481435337"
     variation       2510
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147660004"
     variation       2511
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363940883"
     variation       2517
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1468835199"
     variation       2518..2525
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1174104569"
     variation       2518
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247547087"
     variation       2521
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341579272"
     variation       2525
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033597335"
     variation       2534
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408239149"
     variation       2538
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379457082"
     variation       2541
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555600613"
     variation       2542
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957429369"
     variation       2551
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391945330"
     variation       2553
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164768216"
     variation       2561
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453048408"
     variation       2565
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988869778"
     variation       2566
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363130000"
     variation       2568
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933591414"
     variation       2569
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944691881"
     variation       2571
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552203685"
     variation       2582
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192540552"
     variation       2584
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910588736"
     variation       2595
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941975935"
     variation       2601
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393418436"
     variation       2606
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251582000"
     variation       2608
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307793165"
     variation       2610
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357721046"
     variation       2611
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260626850"
     variation       2613
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186058867"
     variation       2616
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976096050"
     variation       2618
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310280392"
     variation       2623
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440520243"
     variation       2630
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325330415"
     variation       2631
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369649681"
     variation       2635
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221779276"
     variation       2671
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384198055"
     variation       2672
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921865765"
     variation       2675
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775923780"
     variation       2680
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420988243"
     variation       2688
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380311357"
     variation       2696
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172457466"
     variation       2697
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591394899"
     variation       2698
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265495030"
     variation       2707
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1037791524"
     variation       2709
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:897888155"
     variation       2715
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564068864"
     variation       2720
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591394919"
     variation       2733
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929166207"
     variation       2740
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048850260"
     variation       2743
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201528134"
     variation       2744
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057385013"
     variation       2745
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577653825"
     variation       2747
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203844362"
     variation       2748
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198377984"
     variation       2749..2761
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="aa"
                     /replace="aacagtactgcaa"
                     /db_xref="dbSNP:1286917209"
     variation       2752
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:532388559"
     variation       2754
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346055726"
     variation       2756
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544562453"
     variation       2769
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565514419"
     variation       2772
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022804299"
     variation       2777
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286130638"
     variation       2778
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325564067"
     variation       2786
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562763921"
     variation       2787
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538076192"
     variation       2788
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1023729553"
     variation       2797
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999796107"
     variation       2798
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1403935357"
     variation       2802..2810
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ggag"
                     /replace="ggagaggag"
                     /db_xref="dbSNP:906075232"
     variation       2808
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002212540"
     variation       2811
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372927259"
     variation       2814..2817
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ttt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1431311348"
     variation       2826
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470289382"
     variation       2827
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169468559"
     variation       2829
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1033153061"
     variation       2832
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210290007"
     variation       2834
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957521894"
     variation       2835
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1281006675"
     variation       2837
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530163034"
     variation       2840
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1338963337"
     variation       2856
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268264831"
     variation       2862
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020325697"
     variation       2875
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341105285"
     variation       2877
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298905004"
     variation       2883
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1412417639"
     variation       2885..2890
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:966135453"
     variation       2886
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956011882"
     variation       2890
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1220511681"
     variation       2895
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285322379"
     variation       2903
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1169052975"
     variation       2905
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142350198"
     variation       2916
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218631469"
     variation       2918
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271507162"
     variation       2925
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190817266"
     variation       2931
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:976510635"
     variation       2939
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309568697"
     variation       2961
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239341074"
     variation       2964
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1205684265"
     variation       2971
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030956591"
     variation       2976
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954894681"
     variation       2982..2983
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1256371330"
     variation       3001
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986388215"
     variation       3002
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270483080"
     variation       3003..3007
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:754016151"
     variation       3007
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143267974"
     variation       3008
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985098535"
     variation       3014
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185793989"
     variation       3021
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185653133"
     variation       3031
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570410024"
     variation       3033
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440809491"
     variation       3041
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333645367"
     variation       3048
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417314751"
     variation       3054
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1430033060"
     variation       3055
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332911074"
     variation       3062
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170926345"
     variation       3066
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449477312"
     variation       3072
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973372378"
     variation       3073
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940500901"
     variation       3080
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404161190"
     variation       3082
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416545741"
     variation       3088
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036230852"
     variation       3092
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:919249482"
     variation       3098
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1591395165"
     variation       3102
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557923086"
     variation       3104
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113905165"
     variation       3108
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929403682"
     variation       3112
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764854814"
     variation       3114..3118
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="gtggt"
                     /replace="gtggtggt"
                     /db_xref="dbSNP:1305023011"
     variation       3117
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148337526"
     variation       3123
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:682695"
     variation       3124
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222741777"
     variation       3125..3133
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="ttgttgttg"
                     /replace="ttgttgttgttg"
                     /db_xref="dbSNP:1290447775"
     variation       3127
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591395208"
     variation       3129
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044310861"
     variation       3138
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350784365"
     variation       3139
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311022287"
     variation       3146
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591395215"
     variation       3149
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111491175"
     variation       3150
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364733303"
     variation       3153..3161
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="tgtgtgt"
                     /replace="tgtgtgtgt"
                     /db_xref="dbSNP:1325694641"
     variation       3154
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434733771"
     variation       3157
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757870416"
     variation       3159
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352142684"
     variation       3164
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1324737210"
     variation       3180
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000566392"
     variation       3184
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215491696"
     variation       3188
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000059353"
     variation       3196
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440594201"
     variation       3203
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547753163"
     variation       3205
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189275277"
     variation       3212
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489318158"
     variation       3213
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055098601"
     variation       3215
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:893429445"
     variation       3224
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287618232"
     variation       3227
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240199792"
     variation       3229
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293500680"
     variation       3230
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1490354526"
     variation       3234
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891458859"
     variation       3235
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570884414"
     variation       3242
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1275975959"
     variation       3244
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029378586"
     variation       3249
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781576720"
     variation       3250
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553004325"
     variation       3251
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020420648"
     variation       3258
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1174143930"
     variation       3262..3263
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1434703238"
     variation       3265
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476376604"
     variation       3267
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591395296"
     variation       3269
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1148066"
     variation       3270
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549974772"
     variation       3272
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265214081"
     variation       3283
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216729488"
     variation       3284
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591395316"
     variation       3285
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973630773"
     variation       3288
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591395325"
     variation       3291
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919289152"
     variation       3294
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253886728"
     variation       3299
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442545508"
     variation       3302
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950738040"
     variation       3303
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565514775"
     variation       3305
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165637749"
     variation       3315
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386114689"
     variation       3317
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400146886"
     variation       3319
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778136756"
     variation       3320
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569924534"
     variation       3326
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280606431"
     variation       3335
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565514803"
     variation       3337
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909119470"
     variation       3338
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485800151"
     variation       3339
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192414366"
     variation       3344
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:917317243"
     variation       3347
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948568965"
     variation       3352
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114437685"
     variation       3353
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765276527"
     variation       3354
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555689028"
     variation       3355
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1591395384"
     variation       3357
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925773091"
     variation       3367
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751490785"
     variation       3370
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053036450"
     variation       3375
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566026855"
     variation       3379..3380
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="ctcaattttgaaatct"
                     /replace="ctcaattttgaaatctgcaaagtattcattag"
                     /replace="ctcaattttgaaatctgcaaagtattcattagggaaaat"
                     /replace="ctcaattttgaaatctgcaaagtattcattagggaaaatggaggcata
                     tatttctgagt"
                     /replace="ctcaattttgaaatctgcaaagtattcattagggaaaatggaggcata
                     tatttctgagtgctgtaagaagat"
                     /db_xref="dbSNP:rs1565514831"
     variation       3379
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="actcaattttgaaatctgcaaagtattcatta"
                     /db_xref="dbSNP:1316340464"
     variation       3380
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374231560"
     variation       3381..3382
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gaaaatggaggc"
                     /db_xref="dbSNP:1248645377"
     variation       3381
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478546967"
     variation       3382..3383
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="aaatggagg"
                     /db_xref="dbSNP:1316655200"
     variation       3383..3384
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1356653503"
     variation       3384..3385
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="caa"
                     /db_xref="dbSNP:1222680264"
     variation       3385
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1281591021"
     variation       3387
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448651125"
     variation       3390..3393
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gctc"
                     /db_xref="dbSNP:1216498304"
     variation       3393
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242469003"
     variation       3394..3395
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="aatc"
                     /db_xref="dbSNP:1459773431"
     variation       3394
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:534357212"
     variation       3398
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1185226770"
     variation       3399..3400
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1243938888"
     variation       3402..3403
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1469861187"
     variation       3403
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156879870"
     variation       3406..3407
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gggaaaatgg"
                     /db_xref="dbSNP:1410339111"
     variation       3410
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1401362926"
     variation       3413..3414
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1176267807"
     variation       3414..3415
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1404566483"
     variation       3419..3420
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="gagtgctg"
                     /db_xref="dbSNP:1454880656"
     variation       3421..3423
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="ccc"
                     /db_xref="dbSNP:1337852442"
     variation       3426..3427
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1340682592"
     variation       3427
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045202158"
     variation       3431..3433
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1183064955"
     variation       3431
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483401505"
     variation       3436
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1250366563"
     variation       3439
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557715616"
     variation       3448
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577529562"
     variation       3463
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198449218"
     variation       3474
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441104242"
     variation       3480
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260568408"
     variation       3486
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438799305"
     variation       3498
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1219848903"
     variation       3500
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321642884"
     variation       3501
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891464347"
     variation       3508
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277265128"
     variation       3510
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997821383"
     variation       3513
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543512196"
     variation       3514
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352140843"
     variation       3515
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380191415"
     variation       3537
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749669808"
     variation       3539
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565514960"
     variation       3545
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184045466"
     variation       3546
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889512573"
     variation       3549
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402128347"
     variation       3555
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262383468"
     variation       3569
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457404476"
     variation       3571
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867578432"
     variation       3575
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187498128"
     variation       3580
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1321371695"
     variation       3585
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166320144"
     variation       3599
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006628564"
     variation       3604..3605
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:926417769"
     variation       3604
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017809386"
     variation       3606
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936333071"
     variation       3607
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199627013"
     variation       3608
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488470760"
     variation       3615
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264155690"
     variation       3618
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591395542"
     variation       3627
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963536514"
     variation       3628
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454039060"
     variation       3629
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542833329"
     variation       3632
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238321175"
     variation       3635
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379391611"
     variation       3637
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995120116"
     variation       3641
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1331846717"
     variation       3645..3653
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:1385963172"
     variation       3653
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1591395564"
     variation       3664
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1591395566"
     variation       3677
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774693767"
     variation       3682
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295145156"
     variation       3693
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457979844"
     variation       3709
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141254318"
     variation       3712
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528363940"
     variation       3720
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544946098"
     variation       3724
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893357480"
     variation       3727
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1451356734"
     variation       3732
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265891732"
     variation       3735
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970139841"
     variation       3743
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980155631"
     variation       3751
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1489086565"
     variation       3753
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565515039"
     variation       3756
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444085934"
     variation       3760
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234829717"
     variation       3773..3776
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1214503408"
     variation       3776
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356150770"
     variation       3777
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310210765"
     variation       3791
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1232264032"
     variation       3809
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925825398"
     variation       3814
                     /gene="FLI1"
                     /gene_synonym="BDPLT21; EWSR2; SIC-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329078026"
ORIGIN      
ctctttcgctccgctacaacaacaaacgtgcacaggggagtgagggcagggcgctcgcagggggcacgcagggagggcccagggcgccagggaggccgcgccgggctaatccgaaggggctgcgaggtcaggctgtaaccgggtcaatgtgtggaatattggggggctcggctgcagacttggccaaatggacgggactattaaggaggctctgtcggtggtgagcgacgaccagtccctctttgactcagcgtacggagcggcagcccatctccccaaggccgacatgactgcctcggggagtcctgactacgggcagccccacaagatcaaccccctcccaccacagcaggagtggatcaatcagccagtgagggtcaacgtcaagcgggagtatgaccacatgaatggatccagggagtctccggtggactgcagcgttagcaaatgcagcaagctggtgggcggaggcgagtccaaccccatgaactacaacagctatatggacgagaagaatggcccccctcctcccaacatgaccaccaacgagaggagagtcatcgtccccgcagaccccacactgtggacacaggagcatgtgaggcaatggctggagtgggccataaaggagtacagcttgatggagatcgacacatcctttttccagaacatggatggcaaggaactgtgtaaaatgaacaaggaggacttcctccgcgccaccaccctctacaacacggaagtgctgttgtcacacctcagttacctcagggaaagttcactgctggcctataatacaacctcccacaccgaccaatcctcacgattgagtgtcaaagaagacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaaacattatgaccaaagtgcacggcaaaagatatgcttacaaatttgacttccacggcattgcccaggctctgcagccacatccgaccgagtcgtccatgtacaagtacccttctgacatctcctacatgccttcctaccatgcccaccagcagaaggtgaactttgtccctccccatccatcctccatgcctgtcacttcctccagcttctttggagccgcatcacaatactggacctcccccacggggggaatctaccccaaccccaacgtcccccgccatcctaacacccacgtgccttcacacttaggcagctactactagaagcttactcatcagtggccttctagctgaagcccatcctgcacacttactggatgctttggactcaacaggacatatgtggccttgaagggaagacaaaactggatgttctttcttgttggatagaacctttgtatttgttctttaaaaacattttttttaatgttggtaacttttgcttcctctacctgaacaaagagatgaataattccatgggccagtatgccagtttgaattctcagtctcctagcatcttgtgagttgcatattaagattactggaatggttaagtcatggttctgagaaagaagctgtacgttttctttatgtttttatgaccaaagcagtttcttgtcaatacacggggttcagtatgacacagaatcatggacttaacccgtcatgttctggtttgagatttagtgacaaatagaggtgggaagcttataatctaattttaggaggaccaaattcagtggatggcaactggaacattgattgtaaggccagtgaagttttcacccaactggaatttgatggaaagaaggtttgtgtgtttaagacgccaagggcattgcagaatccctctcagtggacagtatgcactcagctgaccactctctctagaaatagtcaagatatgaactaagaaattttaatgcaaatacatacattcctgaaagacggggaattaaattactaatttttttttttttttaaatgatgacagtggtcccagaacttggaaaagttgtagggatttctaaactcaagcagattcgcaagtgctgtgcgcttgtcagaccatcagaccagggccaaccaatcagaaggcaacttactgtataaattatgcagagttattttcctatatctcacagtattaaaaataaataattaaaaattaagaataaataaacgagttgacctcggtcacaaaagcagttttactatcgaatcaatcgctgttattttttttaatgtaatttgtacatcttttttcaatctgtacatttgggctgtctgtatgtttttatagctggtttttaaaaagcataatatgcctatagctgaaaaggaaacagggctgtttaagtcactgacttatgagaaagcaaagcactggtacagttatttaacaggcatacacaagcagggaaaagataatccatttagatctttaatgctttggaaatgcgtgtaacagtactgcaataatcacagctctgggaaaaacaacgaaactttcccttgtggagaggagggattttcctgctctatataagcaacatatttttagacattaaaatatatataattttgcaggtaattgttgacttttttaactatattaagtgttaagctgacaactgtcaaagaagaccatgttgtaaaataatttgactaaataaatggttccttctctcagtgctgaggacagttttcttatttaccgcccccgttaggtcaaagggttttccctggggaactttcctatttacttcttgcactatcaagaatttttcgaatgtacctactgcagtacagcagaaggtaaaaaatcagtgtggtttttcattgttgttgatgatgtttgtagtgtttttgtgtgtgttatttaaatcttcctccagcctaaaagggttttataaaacagcagctaaggccatggataaacctgtatgtaaggactggagcaaagcgagctggtctatccagactggtctgtgagatttaactctgcagcctcccctgggcacttcagacccagacggccaccttctgccactccagcaaagaataagcgccctgcttccttcaggtctcagaccaggactttatggctcatgcagatttttaaggtcatttttcttcccaaggaagaaacttgcctccagttccttcactgttaggtagcttattttcattttctctattttacaatgaaaagagtgagacctgggaagtccttgatttgcaaggaattagactcacagcattggtaaccctagaaccttcttagggtaacactaagtaccttctagacaacatgtctacctaaatgaaatgggatgtgtttcggaacatttgtctccagtttttttttaatcttgcaccctgccatttaaaaagatgtgtaaagcacatattctcaacatatgcacattgatttataaatcatatatacaaactgttacattattcttcatattagaaaacaaatacaaaatagaacattttaaatggtgatataaaaataaattgaaactgaaattcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]