GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:51:31, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001870               1762 bp    mRNA    linear   PRI 06-AUG-2019
DEFINITION  Homo sapiens carboxypeptidase A3 (CPA3), mRNA.
ACCESSION   NM_001870
VERSION     NM_001870.4
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1762)
  AUTHORS   Barallobre-Barreiro J, Gupta SK, Zoccarato A, Kitazume-Taneike R,
            Fava M, Yin X, Werner T, Hirt MN, Zampetaki A, Viviano A, Chong M,
            Bern M, Kourliouros A, Domenech N, Willeit P, Shah AM, Jahangiri M,
            Schaefer L, Fischer JW, Iozzo RV, Viner R, Thum T, Heineke J,
            Kichler A, Otsu K and Mayr M.
  TITLE     Glycoproteomics Reveals Decorin Peptides With Anti-Myostatin
            Activity in Human Atrial Fibrillation
  JOURNAL   Circulation 134 (11), 817-832 (2016)
   PUBMED   27559042
REFERENCE   2  (bases 1 to 1762)
  AUTHORS   Barallobre-Barreiro J, Oklu R, Lynch M, Fava M, Baig F, Yin X,
            Barwari T, Potier DN, Albadawi H, Jahangiri M, Porter KE, Watkins
            MT, Misra S, Stoughton J and Mayr M.
  TITLE     Extracellular matrix remodelling in response to venous
            hypertension: proteomics of human varicose veins
  JOURNAL   Cardiovasc. Res. 110 (3), 419-430 (2016)
   PUBMED   27068509
REFERENCE   3  (bases 1 to 1762)
  AUTHORS   Jones KD, Gelbart T, Whisenant TC, Waalen J, Mondala TS, Ikle DN,
            Salomon DR, Bennett RM and Kurian SM.
  TITLE     Genome-wide expression profiling in the peripheral blood of
            patients with fibromyalgia
  JOURNAL   Clin. Exp. Rheumatol. 34 (2 Suppl 96), S89-S98 (2016)
   PUBMED   27157394
  REMARK    GeneRIF: Carboxypeptidase A3 was differentially expressed between
            Fibromyalgia patients and healthy controls.
REFERENCE   4  (bases 1 to 1762)
  AUTHORS   Wang J, Yu L, Huang X, Wang Y and Zhao J.
  TITLE     Comparative proteome analysis of saccular intracranial aneurysms
            with iTRAQ quantitative proteomics
  JOURNAL   J Proteomics 130, 120-128 (2016)
   PUBMED   26385002
REFERENCE   5  (bases 1 to 1762)
  AUTHORS   Caughey GH.
  TITLE     Mast cell proteases as protective and inflammatory mediators
  JOURNAL   Adv. Exp. Med. Biol. 716, 212-234 (2011)
   PUBMED   21713659
  REMARK    Review article
REFERENCE   6  (bases 1 to 1762)
  AUTHORS   Natsuaki M, Stewart CB, Vanderslice P, Schwartz LB, Natsuaki M,
            Wintroub BU, Rutter WJ and Goldstein SM.
  TITLE     Human skin mast cell carboxypeptidase: functional characterization,
            cDNA cloning, and genealogy
  JOURNAL   J. Invest. Dermatol. 99 (2), 138-145 (1992)
   PUBMED   1629626
REFERENCE   7  (bases 1 to 1762)
  AUTHORS   Reynolds DS, Gurley DS and Austen KF.
  TITLE     Cloning and characterization of the novel gene for mast cell
            carboxypeptidase A
  JOURNAL   J. Clin. Invest. 89 (1), 273-282 (1992)
   PUBMED   1729276
REFERENCE   8  (bases 1 to 1762)
  AUTHORS   Reynolds DS, Gurley DS, Stevens RL, Sugarbaker DJ, Austen KF and
            Serafin WE.
  TITLE     Cloning of cDNAs that encode human mast cell carboxypeptidase A,
            and comparison of the protein with mouse mast cell carboxypeptidase
            A and rat pancreatic carboxypeptidases
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 86 (23), 9480-9484 (1989)
   PUBMED   2594780
REFERENCE   9  (bases 1 to 1762)
  AUTHORS   Goldstein SM, Kaempfer CE, Kealey JT and Wintroub BU.
  TITLE     Human mast cell carboxypeptidase. Purification and characterization
  JOURNAL   J. Clin. Invest. 83 (5), 1630-1636 (1989)
   PUBMED   2708524
REFERENCE   10 (bases 1 to 1762)
  AUTHORS   Goldstein SM, Kaempfer CE, Proud D, Schwartz LB, Irani AM and
            Wintroub BU.
  TITLE     Detection and partial characterization of a human mast cell
            carboxypeptidase
  JOURNAL   J. Immunol. 139 (8), 2724-2729 (1987)
   PUBMED   2443571
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BG501260.1, M27717.1,
            DR005288.1, BC012613.1, BX105358.1 and AC092979.3.
            On Nov 23, 2018 this sequence version replaced NM_001870.3.
            
            Summary: This gene encodes a member of the carboxypeptidase A
            family of zinc metalloproteases. The encoded preproprotein is
            proteolytically processed to generate a mature protease that is
            released by mast cells and may be involved in the degradation of
            endogenous proteins and the inactivation of venom-associated
            peptides. Expression of this gene may be elevated in human asthma
            patients. [provided by RefSeq, Nov 2015].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189667.329931.1, BC012613.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000296046.4/ ENSP00000296046.3
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-12                BG501260.1         42-53
            13-523              M27717.1           1-511
            524-588             DR005288.1         514-578
            589-1640            BC012613.1         592-1643
            1641-1650           BX105358.1         584-593
            1651-1762           AC092979.3         49663-49774
FEATURES             Location/Qualifiers
     source          1..1762
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q24"
     gene            1..1762
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /note="carboxypeptidase A3"
                     /db_xref="GeneID:1359"
                     /db_xref="HGNC:HGNC:2298"
                     /db_xref="MIM:114851"
     exon            1..80
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       3..10
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:781387404"
     variation       3
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245472185"
     variation       5
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289133363"
     variation       9
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363071484"
     variation       11
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386590343"
     variation       12
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537389511"
     CDS             13..1266
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /EC_number="3.4.17.1"
                     /note="mast cell carboxypeptidase A; tissue
                     carboxypeptidase A; carboxypeptidase A3 (mast cell)"
                     /codon_start=1
                     /product="mast cell carboxypeptidase A preproprotein"
                     /protein_id="NP_001861.2"
                     /db_xref="CCDS:CCDS3138.1"
                     /db_xref="GeneID:1359"
                     /db_xref="HGNC:HGNC:2298"
                     /db_xref="MIM:114851"
                     /translation="
MRLILPVGLIATTLAIAPVRFDREKVFRVKPQDEKQADIIKDLAKTNELDFWYPGATHHVAANMMVDFRVSEKESQAIQSALDQNKMHYEILIHDLQEEIEKQFDVKEDIPGRHSYAKYNNWEKIVAWTEKMMDKYPEMVSRIKIGSTVEDNPLYVLKIGEKNERRKAIFTDCGIHAREWVSPAFCQWFVYQATKTYGRNKIMTKLLDRMNFYILPVFNVDGYIWSWTKNRMWRKNRSKNQNSKCIGTDLNRNFNASWNSIPNTNDPCADNYRGSAPESEKETKAVTNFIRSHLNEIKVYITFHSYSQMLLFPYGYTSKLPPNHEDLAKVAKIGTDVLSTRYETRYIYGPIESTIYPISGSSLDWAYDLGIKHTFAFELRDKGKFGFLLPESRIKPTCRETMLAVKFIAKYILKHTS"
     sig_peptide     13..57
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    94..318
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /note="Carboxypeptidase activation peptide; Region:
                     Propep_M14; pfam02244"
                     /db_xref="CDD:280416"
     mat_peptide     340..1263
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /product="Mast cell carboxypeptidase A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P15088.2)"
     misc_feature    352..1251
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /note="Peptidase M14 carboxypeptidase subfamily A/B-like;
                     Carboxypeptidase B subgroup; Region: M14_CPB; cd03871"
                     /db_xref="CDD:199852"
     misc_feature    order(538..540,547..549,763..765,922..924,1084..1086,
                     1093..1095,1099..1101)
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /note="putative active site [active]"
                     /db_xref="CDD:199852"
     misc_feature    order(538..540,547..549,922..924)
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:199852"
     variation       14
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758772748"
     variation       16
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111593746"
     variation       19
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224723310"
     variation       20
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766913060"
     variation       23
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751830747"
     variation       27
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777382950"
     variation       28
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242938207"
     variation       31
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143377024"
     variation       41
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778348410"
     variation       46
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745400658"
     variation       49
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480716038"
     variation       50
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761469664"
     variation       51
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323563988"
     variation       52
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771842039"
     variation       53
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409091201"
     variation       55
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199499869"
     variation       56
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746775216"
     variation       60
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768608818"
     variation       62
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348980353"
     variation       64
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457666944"
     variation       66
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776985477"
     variation       67
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449452615"
     variation       68
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:752693946"
     variation       69
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370509092"
     variation       70
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111765977"
     variation       71
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148382472"
     variation       74
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766746996"
     exon            81..156
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       83..87
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:779182356"
     variation       83
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757838642"
     variation       84
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779670062"
     variation       85
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329806072"
     variation       87
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751125624"
     variation       90
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330195186"
     variation       94
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750672324"
     variation       95
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781309145"
     variation       96
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140527015"
     variation       97
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777834773"
     variation       98
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:960757636"
     variation       99
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770909885"
     variation       100
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200479513"
     variation       104
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774345537"
     variation       106
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759623323"
     variation       110
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370087468"
     variation       112
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145828911"
     variation       115
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561390621"
     variation       116
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145785078"
     variation       117
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569817031"
     variation       119
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038754481"
     variation       124
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919938603"
     variation       127
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776004966"
     variation       128
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:919394305"
     variation       130
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375410605"
     variation       136
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764581661"
     variation       143
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464151522"
     variation       148
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750043139"
     variation       149
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762601870"
     variation       150
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766144929"
     variation       153
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758483100"
     variation       154
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751066330"
     variation       155
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754567654"
     variation       156
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199942135"
     exon            157..281
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       158
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752571237"
     variation       162
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350964672"
     variation       163
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756011183"
     variation       166
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291454727"
     variation       169
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763949968"
     variation       172
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1559965588"
     variation       174
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376722929"
     variation       176
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757071231"
     variation       178
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779071784"
     variation       181
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142834901"
     variation       182
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312402164"
     variation       183
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365667064"
     variation       187
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780045131"
     variation       189
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146101762"
     variation       190
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138685459"
     variation       194
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777037736"
     variation       196
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748515344"
     variation       197
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75478109"
     variation       199
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454852497"
     variation       201
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17850953"
     variation       202
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759327749"
     variation       203
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335907788"
     variation       204
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353232433"
     variation       210
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440238709"
     variation       213
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767282280"
     variation       214
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774219245"
     variation       216
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760123667"
     variation       217
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764049448"
     variation       218
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753756118"
     variation       220
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757019989"
     variation       221
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194660550"
     variation       223
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1307517703"
     variation       226
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351154570"
     variation       227
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252720266"
     variation       232
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267599641"
     variation       241
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575898817"
     variation       248
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183171999"
     variation       249
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943735091"
     variation       250
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750227213"
     variation       253
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2270523"
     variation       254
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780164300"
     variation       256
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372351044"
     variation       258
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114531478"
     variation       259
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755054597"
     variation       262
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396524808"
     variation       272
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781709131"
     variation       274
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936553108"
     variation       276
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748661593"
     exon            282..384
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       283
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457815805"
     variation       284
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779731268"
     variation       285
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746693413"
     variation       289
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1484749949"
     variation       291
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768364468"
     variation       292
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775949190"
     variation       293
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761338426"
     variation       295
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866956006"
     variation       296
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769681649"
     variation       297
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247006810"
     variation       299
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762715744"
     variation       306
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766145394"
     variation       309
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157828534"
     variation       311
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750582936"
     variation       315
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452014552"
     variation       318
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290974053"
     variation       321
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050032879"
     variation       322
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759608831"
     variation       323
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404868107"
     variation       326
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1192167367"
     variation       327
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767793731"
     variation       331
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:891390161"
     variation       334
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752773216"
     variation       335
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347607588"
     variation       344..356
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="cag"
                     /replace="caggcaggcacag"
                     /db_xref="dbSNP:1219922146"
     variation       346
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376999632"
     variation       347
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315329852"
     variation       348
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1408477146"
     variation       351
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218262711"
     variation       360
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138751736"
     variation       361
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754441144"
     variation       368
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363348618"
     variation       369
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757624575"
     variation       371
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61733455"
     variation       372
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746262682"
     variation       373
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176146435"
     variation       375
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370991073"
     variation       378
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780857203"
     variation       382
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1159462144"
     exon            385..486
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       388
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192753847"
     variation       389
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775837205"
     variation       391
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539944476"
     variation       394
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764428082"
     variation       395
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75229139"
     variation       397
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473338310"
     variation       404
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368209657"
     variation       406
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990832586"
     variation       412
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418029205"
     variation       413
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146235151"
     variation       417
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748436457"
     variation       418
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171444251"
     variation       420
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750988849"
     variation       429
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770652989"
     variation       430
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339005961"
     variation       434
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766795653"
     variation       436
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429769999"
     variation       437
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374800491"
     variation       438
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1363967205"
     variation       442
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390047521"
     variation       447
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755705481"
     variation       449
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261965365"
     variation       450
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777424403"
     variation       451
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753245625"
     variation       455
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770430908"
     variation       456
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200383775"
     variation       457
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111881854"
     variation       459
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367753806"
     variation       463
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240767136"
     variation       464
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1479070268"
     variation       469
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372213795"
     variation       471
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377284175"
     variation       474
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746826544"
     variation       476
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768964496"
     variation       477
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733456"
     variation       485
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403213382"
     exon            487..588
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       488
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780176741"
     variation       489
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420088577"
     variation       490
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455407240"
     variation       498
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746771498"
     variation       511
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363661614"
     variation       514
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144291888"
     variation       515
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769913394"
     variation       523
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773285261"
     variation       524
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12489516"
     variation       526
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149768841"
     variation       528
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356209982"
     variation       533
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241362694"
     variation       538
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291574461"
     variation       540
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149879184"
     variation       541
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192487183"
     variation       544
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145845146"
     variation       545
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753425662"
     variation       551..553
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:746472423"
     variation       553
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382432293"
     variation       555
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761457578"
     variation       557
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764806730"
     variation       559
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321000398"
     variation       560
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935155498"
     variation       563
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553767929"
     variation       566
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756425253"
     variation       570
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350423486"
     variation       571
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758026243"
     variation       574
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778144890"
     variation       575
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149006068"
     variation       580
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766399483"
     variation       583
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389179546"
     variation       585
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751608540"
     variation       586
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893692248"
     variation       587
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754817012"
     exon            589..699
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       589
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749569168"
     variation       594
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203205424"
     variation       606
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200899484"
     variation       608
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389476893"
     variation       611
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228959294"
     variation       612
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009864078"
     variation       615
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1484086741"
     variation       618
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043728371"
     variation       619
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903884776"
     variation       621
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778893744"
     variation       623
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037102562"
     variation       624
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78356818"
     variation       625
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423655991"
     variation       628
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479828535"
     variation       632
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138401564"
     variation       636
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772578098"
     variation       637
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141357361"
     variation       638
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772998748"
     variation       642
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762629045"
     variation       659
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766142950"
     variation       660
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773951867"
     variation       661
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280665817"
     variation       662
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759001048"
     variation       663
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223012993"
     variation       667
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767456762"
     variation       668
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145039073"
     variation       675
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760505038"
     variation       676
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763942534"
     variation       677
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474115260"
     variation       688
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753631842"
     variation       689
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757408076"
     variation       691
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779127001"
     variation       693
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263855669"
     variation       699
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369939168"
     exon            700..790
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       702
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247933098"
     variation       703
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370747287"
     variation       704
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765856914"
     variation       706
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116686228"
     variation       707
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761624530"
     variation       712
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765426086"
     variation       714..719
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:759848761"
     variation       719
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975049062"
     variation       720
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199944830"
     variation       720
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:767600438"
     variation       721
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199600994"
     variation       722
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374150898"
     variation       725
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297774861"
     variation       727
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751674825"
     variation       732
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755494551"
     variation       733
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781772953"
     variation       738
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358535903"
     variation       741
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748494421"
     variation       742..744
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:752921459"
     variation       748
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770330448"
     variation       750
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778693111"
     variation       751
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745573726"
     variation       752
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203231636"
     variation       753
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559969178"
     variation       756
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376034347"
     variation       759
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141391874"
     variation       760
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458791547"
     variation       762
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774801756"
     variation       766
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760251410"
     variation       767
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444406501"
     variation       768
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180587358"
     variation       770
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416622808"
     variation       775
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370838199"
     variation       779
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768538060"
     variation       783
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528603640"
     variation       784
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150822877"
     variation       785..786
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:35324938"
     variation       786
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765086873"
     exon            791..993
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       793
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1443369379"
     variation       797
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769740402"
     variation       806
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772834373"
     variation       811
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138181056"
     variation       812
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551117050"
     variation       813
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766481019"
     variation       814
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182878244"
     variation       815
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253905041"
     variation       818
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367496402"
     variation       821
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759673159"
     variation       827
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431302626"
     variation       829
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767770938"
     variation       830
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143184657"
     variation       832
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022003195"
     variation       837
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399929155"
     variation       839
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296218522"
     variation       841
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147228563"
     variation       844
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400580348"
     variation       849
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754107419"
     variation       850
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779547580"
     variation       852
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438096782"
     variation       856
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754634028"
     variation       857
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780627972"
     variation       860
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140470073"
     variation       861
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200538548"
     variation       863
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262058297"
     variation       869
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773243188"
     variation       871
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214046746"
     variation       872
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200639407"
     variation       874
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218067738"
     variation       875
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266741194"
     variation       876
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1369475498"
     variation       877
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144437234"
     variation       879
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201231979"
     variation       882
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247538575"
     variation       887
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774430813"
     variation       888
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156584064"
     variation       889
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759764300"
     variation       891
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772436839"
     variation       898
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867230201"
     variation       899..901
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1559969566"
     variation       901
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162604055"
     variation       903
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309258074"
     variation       906
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368374752"
     variation       907
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144470644"
     variation       908
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388040656"
     variation       912
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225764930"
     variation       917
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760865331"
     variation       918
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334781781"
     variation       920
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764474068"
     variation       924
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369290033"
     variation       927
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201909511"
     variation       929
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385559153"
     variation       930
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374063108"
     variation       932
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765574175"
     variation       934
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265404514"
     variation       938
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024356415"
     variation       940
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1354282677"
     variation       942
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750802884"
     variation       943
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559969598"
     variation       947
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754580788"
     variation       950
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457481533"
     variation       951
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146653585"
     variation       953
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752171832"
     variation       956
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755700128"
     variation       958
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777560531"
     variation       959
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366666897"
     variation       960
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332005882"
     variation       962
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142588358"
     variation       964
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770777059"
     variation       965
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909926759"
     variation       967
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778791335"
     variation       969
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745680661"
     variation       974
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463718891"
     variation       975
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332961948"
     variation       977
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191216293"
     variation       981
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402821968"
     variation       984
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758158860"
     variation       987
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140411214"
     variation       989
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180790542"
     variation       991
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367976187"
     variation       993
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760646834"
     exon            994..1078
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       995
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423801611"
     variation       997
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760316726"
     variation       998
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763675729"
     variation       1000
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413120300"
     variation       1004
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753348542"
     variation       1010
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765241300"
     variation       1013
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139830547"
     variation       1025
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360420920"
     variation       1026
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139521475"
     variation       1033
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779939415"
     variation       1034
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61747091"
     variation       1035
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146641016"
     variation       1036
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769920358"
     variation       1038
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773706185"
     variation       1045
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749726492"
     variation       1046
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377005273"
     variation       1049
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200305769"
     variation       1050
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199984711"
     variation       1052
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274939412"
     variation       1053
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570897012"
     variation       1057
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763766372"
     variation       1059
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225993391"
     variation       1063
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229350848"
     variation       1064
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776192506"
     variation       1065
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269054413"
     variation       1069..1073
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="tcaac"
                     /replace="tcaacttcaac"
                     /db_xref="dbSNP:754347389"
     variation       1073
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:539543369"
     variation       1076
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380141932"
     variation       1078
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201872849"
     exon            1079..1762
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /inference="alignment:Splign:2.1.0"
     variation       1080
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559066208"
     variation       1081
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1162768717"
     variation       1082
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977154600"
     variation       1083
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752932811"
     variation       1087
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756335873"
     variation       1091
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:528150649"
     variation       1094
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448751453"
     variation       1101
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749389267"
     variation       1104
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378305016"
     variation       1105
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771383713"
     variation       1106
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465088710"
     variation       1107
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779324115"
     variation       1109
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328905961"
     variation       1112
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746221789"
     variation       1119
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411019812"
     variation       1121
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197544074"
     variation       1123
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772377917"
     variation       1124
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337125091"
     variation       1128
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761488997"
     variation       1132
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1559972885"
     variation       1138
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418899067"
     variation       1142
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373298908"
     variation       1146
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:910148131"
     variation       1148
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769594594"
     variation       1150
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375364662"
     variation       1151
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374679149"
     variation       1154..1156
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1415967826"
     variation       1154
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1475597035"
     variation       1156
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170183028"
     variation       1159
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450975508"
     variation       1163
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148623762"
     variation       1169
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932000880"
     variation       1171
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467419939"
     variation       1173
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384927517"
     variation       1176
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335215644"
     variation       1177
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329290056"
     variation       1180
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052226415"
     variation       1182
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751513384"
     variation       1183
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445651417"
     variation       1187
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304514609"
     variation       1189
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355495080"
     variation       1190
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141324442"
     variation       1202
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275808254"
     variation       1203
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767152780"
     variation       1205
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752500522"
     variation       1207
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1274083266"
     variation       1210
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369125831"
     variation       1212
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733453"
     variation       1215
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318987467"
     variation       1217
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777998209"
     variation       1219
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61733454"
     variation       1224
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463388350"
     variation       1232
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1486314654"
     variation       1237
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193005831"
     variation       1238
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779461155"
     variation       1239
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476504654"
     variation       1240
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168723718"
     variation       1244
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145833901"
     variation       1249
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772635320"
     variation       1254
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178083087"
     variation       1257
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290852621"
     variation       1258
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112825175"
     variation       1259
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375967828"
     variation       1260
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780234673"
     variation       1264
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747411043"
     variation       1274
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341852200"
     variation       1275
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:995112092"
     variation       1276
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769541119"
     variation       1279..1284
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="tg"
                     /replace="tgtttg"
                     /db_xref="dbSNP:746848603"
     variation       1285
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773048186"
     variation       1288
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217815664"
     variation       1291
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894407769"
     variation       1292
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349229726"
     variation       1295
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468830778"
     variation       1296
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770417510"
     variation       1302
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773920097"
     variation       1303..1308
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1013910171"
     variation       1303
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759336710"
     variation       1307
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767509849"
     variation       1309
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375706071"
     variation       1313
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760500166"
     variation       1315
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195228122"
     variation       1318
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764274208"
     variation       1329
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1318415515"
     variation       1330
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307258668"
     variation       1331
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967036273"
     variation       1338
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1368121981"
     variation       1344
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572952464"
     variation       1353
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933766437"
     variation       1359
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050871943"
     variation       1360..1362
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1443793795"
     variation       1366
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892272831"
     variation       1367
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191632954"
     variation       1373
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866263235"
     variation       1376
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009370790"
     variation       1380
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528695033"
     variation       1381
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032734264"
     variation       1388
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022157150"
     variation       1393
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866685772"
     variation       1394
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434291195"
     variation       1396
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903804297"
     variation       1398
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393386650"
     variation       1407
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1195509780"
     variation       1407
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183788880"
     variation       1410
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260943738"
     variation       1412
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:143922613"
     variation       1412
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486707442"
     variation       1418
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000150732"
     variation       1423
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260996112"
     variation       1434
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775204801"
     variation       1439
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209737431"
     variation       1440
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345242884"
     variation       1441
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868793787"
     variation       1448
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234303856"
     variation       1455
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313353158"
     variation       1456
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295489934"
     variation       1460
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1468440790"
     variation       1461
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174080351"
     variation       1473
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188163066"
     variation       1481
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958741997"
     variation       1484
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:565019435"
     variation       1486
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312422436"
     variation       1487
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539121245"
     variation       1492
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142056121"
     variation       1495
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393150587"
     variation       1501
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372474903"
     variation       1504
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1168208954"
     variation       1516
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1430183349"
     variation       1524
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262207221"
     variation       1525
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024411083"
     variation       1529
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150807042"
     variation       1531
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237381505"
     variation       1533
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211058688"
     variation       1534
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276962705"
     variation       1537
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:982977082"
     variation       1538
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249065657"
     variation       1542
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225920281"
     variation       1554
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309714638"
     variation       1558
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279253204"
     variation       1562
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12962"
     variation       1571
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557011159"
     variation       1578
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940680040"
     variation       1591
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277682786"
     variation       1596
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314970462"
     variation       1613
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415530619"
     variation       1637
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941631644"
     variation       1639
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1296480166"
     variation       1651
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463463166"
     variation       1663
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975065711"
     variation       1665
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920892676"
     variation       1666
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930473925"
     variation       1667
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2298884"
     variation       1671..1672
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1436825710"
     variation       1673
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1051261195"
     variation       1676..1678
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1435987749"
     variation       1679
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1196973474"
     variation       1681
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481940471"
     variation       1682..1686
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="t"
                     /replace="tctct"
                     /db_xref="dbSNP:1259267009"
     variation       1688
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213506649"
     variation       1698..1704
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aat"
                     /replace="aatcaat"
                     /db_xref="dbSNP:1200806190"
     variation       1701
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1333125943"
     variation       1701
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892245790"
     variation       1704
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559973095"
     variation       1713..1722
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="cattca"
                     /replace="cattcattca"
                     /db_xref="dbSNP:1295450501"
     variation       1713
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245835708"
     variation       1714
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559973100"
     variation       1723..1728
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="gt"
                     /replace="gtctgt"
                     /db_xref="dbSNP:1335324580"
     variation       1723
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304970623"
     variation       1727
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395450262"
     variation       1731
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393199932"
     variation       1735
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369102063"
     variation       1736..1741
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aa"
                     /replace="aaataa"
                     /db_xref="dbSNP:1325102052"
     variation       1737..1743
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="aata"
                     /replace="aataata"
                     /db_xref="dbSNP:1459721811"
     variation       1739..1747
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="taatatctt"
                     /replace="taatatctttaatatctt"
                     /db_xref="dbSNP:1396454604"
     variation       1750
                     /gene="CPA3"
                     /gene_synonym="MC-CPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173262438"
ORIGIN      
caaagaagaaccatgaggctcatcctgcctgtgggtttgattgctaccactcttgcaattgctcctgtccgctttgacagggagaaggtgttccgcgtgaagccccaggatgaaaaacaagcagacatcataaaggacttggccaaaaccaatgagcttgacttctggtatccaggtgccacccaccacgtagctgctaatatgatggtggatttccgagttagtgagaaggaatcccaagccatccagtctgccttggatcaaaataaaatgcactatgaaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaagaagatatcccaggcaggcacagctacgcaaaatacaataattgggaaaagattgtggcttggactgaaaagatgatggataagtatcctgaaatggtctctcgtattaaaattggatctactgttgaagataatccactatatgttctgaagattggggaaaagaatgaaagaagaaaggctatttttacggattgtggcattcacgcacgagaatgggtctccccagcattctgccagtggtttgtctatcaggcaaccaaaacttatgggagaaacaaaattatgaccaaactcttggaccgaatgaatttttacattcttcctgtgttcaatgttgatggatatatttggtcatggacaaagaaccgcatgtggagaaaaaatcgttccaagaaccaaaactccaaatgcatcggcactgacctcaacaggaattttaatgcttcatggaactccattcctaacaccaatgacccatgtgcagataactatcggggctctgcaccagagtccgagaaagagacgaaagctgtcactaatttcattagaagccacctgaatgaaatcaaggtttacatcaccttccattcctactcccagatgctattgtttccctatggatatacatcaaaactgccacctaaccatgaggacttggccaaagttgcaaagattggcactgatgttctatcaactcgatatgaaacccgctacatctatggcccaatagaatcaacaatttacccgatatcaggttcttctttagactgggcttatgacctgggcatcaaacacacatttgcctttgagctccgagataaaggcaaatttggttttctccttccagaatcccggataaagccaacgtgcagagagaccatgctagctgtcaaatttattgccaagtatatcctcaagcatacttcctaaagaactgccctctgtttggaataagccaattaatccttttttgtgcctttcatcagaaagtcaatcttcagttatccccaaatgcagcttctatttcacctgaatccttctcttgctcatttaagtcccatgttactgctgtttgcttttacttactttcagtagcaccataacgaagtagctttaagtgaaaccttttaactacctttctttgctccaagtgaagtttggacccagcagaaagcattattttgaaaggtgatatacagtggggcacagaaaacaaatgaaaaccttcagtttctcacagattttcaccatgtggcttcatcaatttatgtgctaatacaataaaataaaatgcacttaatgctttaaaattcatctttttatgataaactatattctctgtatttctctatagcattaataatcaatattaatgccattcattcagtctgttaataagaaataatatcttcaattttcaaaaaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]