ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-22 21:53:23, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001440352 1549 bp mRNA linear PRI 20-MAY-2025
DEFINITION Homo sapiens CD44 molecule (IN blood group) (CD44), transcript
variant 37, mRNA.
ACCESSION NM_001440352 XM_011520489 XM_054370583
VERSION NM_001440352.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1549)
AUTHORS Li,C., Zhang,Y., Wang,Y., Ouyang,J., Yang,Y., Zhu,Q., Lu,Y.,
Kang,T., Li,Y., Xia,M., Chen,J., Li,Q., Zhu,C. and Ye,L.
TITLE RNA-binding protein LSM7 facilitates breast cancer metastasis
through mediating alternative splicing of CD44
JOURNAL Life Sci 356, 123013 (2024)
PUBMED 39182568
REMARK GeneRIF: RNA-binding protein LSM7 facilitates breast cancer
metastasis through mediating alternative splicing of CD44.
REFERENCE 2 (bases 1 to 1549)
AUTHORS Kashif,M., Jahan,S., Minhas,S., Amar,A., Tahir,R., Nisar,H.,
Shehzad,F., Nagi,A.H. and Afzal,N.
TITLE Genetic Signatures: CD44 Single-Nucleotide Polymorphisms Affect
Cell Surface Expression and Elevate Risk in Head and Neck Squamous
Cell Carcinoma
JOURNAL JCO Glob Oncol 10, e2400084 (2024)
PUBMED 39481067
REMARK GeneRIF: Genetic Signatures: CD44 Single-Nucleotide Polymorphisms
Affect Cell Surface Expression and Elevate Risk in Head and Neck
Squamous Cell Carcinoma.
Erratum:[JCO Glob Oncol. 2025 Jan;11:e2400651. doi:
10.1200/GO-24-00651. PMID: 39883899]
REFERENCE 3 (bases 1 to 1549)
AUTHORS Kainulainen,K., Niskanen,E.A., Kinnunen,J., Maki-Mantila,K.,
Hartikainen,K., Paakinaho,V., Malinen,M., Ketola,K. and
Pasonen-Seppanen,S.
TITLE Secreted factors from M1 macrophages drive prostate cancer stem
cell plasticity by upregulating NANOG, SOX2, and CD44 through
NFkappaB-signaling
JOURNAL Oncoimmunology 13 (1), 2393442 (2024)
PUBMED 39175947
REMARK GeneRIF: Secreted factors from M1 macrophages drive prostate cancer
stem cell plasticity by upregulating NANOG, SOX2, and CD44 through
NFkappaB-signaling.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1549)
AUTHORS Yan,H., Xing,Z., Liu,S., Gao,P., Wang,Q. and Guo,G.
TITLE CALCR exacerbates renal cell carcinoma progression via stabilizing
CD44
JOURNAL Aging (Albany NY) 16 (13), 10765-10783 (2024)
PUBMED 38985127
REMARK GeneRIF: CALCR exacerbates renal cell carcinoma progression via
stabilizing CD44.
REFERENCE 5 (bases 1 to 1549)
AUTHORS Liang,S., Li,L., Guo,Z., Sun,H. and Yang,Y.
TITLE Co-expression of CD44v6 and MMP2 predicts lung metastasis and
unfavorable prognosis in osteosarcoma
JOURNAL Future Oncol 20 (25), 1799-1806 (2024)
PUBMED 39011948
REMARK GeneRIF: Co-expression of CD44v6 and MMP2 predicts lung metastasis
and unfavorable prognosis in osteosarcoma.
REFERENCE 6 (bases 1 to 1549)
AUTHORS Screaton,G.R., Bell,M.V., Jackson,D.G., Cornelis,F.B., Gerth,U. and
Bell,J.I.
TITLE Genomic structure of DNA encoding the lymphocyte homing receptor
CD44 reveals at least 12 alternatively spliced exons
JOURNAL Proc Natl Acad Sci U S A 89 (24), 12160-12164 (1992)
PUBMED 1465456
REFERENCE 7 (bases 1 to 1549)
AUTHORS Kugelman,L.C., Ganguly,S., Haggerty,J.G., Weissman,S.M. and
Milstone,L.M.
TITLE The core protein of epican, a heparan sulfate proteoglycan on
keratinocytes, is an alternative form of CD44
JOURNAL J Invest Dermatol 99 (6), 886-891 (1992)
PUBMED 1281868
REFERENCE 8 (bases 1 to 1549)
AUTHORS Arch,R., Wirth,K., Hofmann,M., Ponta,H., Matzku,S., Herrlich,P. and
Zoller,M.
TITLE Participation in normal immune responses of a metastasis-inducing
splice variant of CD44
JOURNAL Science 257 (5070), 682-685 (1992)
PUBMED 1496383
REFERENCE 9 (bases 1 to 1549)
AUTHORS Jackson,D.G., Buckley,J. and Bell,J.I.
TITLE Multiple variants of the human lymphocyte homing receptor CD44
generated by insertions at a single site in the extracellular
domain
JOURNAL J Biol Chem 267 (7), 4732-4739 (1992)
PUBMED 1537855
REFERENCE 10 (bases 1 to 1549)
AUTHORS Aruffo,A., Stamenkovic,I., Melnick,M., Underhill,C.B. and Seed,B.
TITLE CD44 is the principal cell surface receptor for hyaluronate
JOURNAL Cell 61 (7), 1303-1313 (1990)
PUBMED 1694723
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL356215.11 and AL133330.14.
On or before May 19, 2025 this sequence version replaced
XM_011520489.4, XM_054370583.1.
Summary: The protein encoded by this gene is a cell-surface
glycoprotein involved in cell-cell interactions, cell adhesion and
migration. It is a receptor for hyaluronic acid (HA) and can also
interact with other ligands, such as osteopontin, collagens, and
matrix metalloproteinases (MMPs). This protein participates in a
wide variety of cellular functions including lymphocyte activation,
recirculation and homing, hematopoiesis, and tumor metastasis.
Transcripts for this gene undergo complex alternative splicing that
results in many functionally distinct isoforms, however, the full
length nature of some of these variants has not been determined.
Alternative splicing is the basis for the structural and functional
diversity of this protein, and may be related to tumor metastasis.
[provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR12921934.3535048.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMEA1965299, SAMEA1968540
[ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-200 AL356215.11 23071-23270 c
201-366 AL133330.14 175136-175301 c
367-500 AL133330.14 171469-171602 c
501-569 AL133330.14 164976-165044 c
570-800 AL133330.14 161811-162041 c
801-926 AL133330.14 153630-153755 c
927-1040 AL133330.14 150681-150794 c
1041-1157 AL133330.14 150089-150205 c
1158-1286 AL133330.14 147236-147364 c
1287-1549 AL133330.14 145829-146091 c
FEATURES Location/Qualifiers
source 1..1549
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11p13"
gene 1..1549
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/note="CD44 molecule (IN blood group)"
/db_xref="GeneID:960"
/db_xref="HGNC:HGNC:1681"
/db_xref="MIM:107269"
exon 1..200
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
CDS 134..1342
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/note="isoform 37 precursor is encoded by transcript
variant 37; hematopoietic cell E- and L-selectin ligand;
chondroitin sulfate proteoglycan 8; cell surface
glycoprotein CD44; GP90 lymphocyte homing/adhesion
receptor; heparan sulfate proteoglycan; hyaluronate
receptor; Indian blood group antigen; Hermes antigen;
homing function and Indian blood group system; CD44
antigen; CD44 molecule (Indian blood group); phagocyte
glycoprotein 1; In(Lu) related-p80; homing cell adhesion
molecule; epican; soluble CD44; phagocytic glycoprotein 1;
extracellular matrix receptor III"
/codon_start=1
/product="CD44 antigen isoform 37 precursor"
/protein_id="NP_001427281.1"
/db_xref="GeneID:960"
/db_xref="HGNC:HGNC:1681"
/db_xref="MIM:107269"
/translation="
MDKFWWHAAWGLCLVPLSLAQIDLNITCRFAGVFHVEKNGRYSISRTEAADLCKAFNSTLPTMAQMEKALSIGFETCRYGFIEGHVVIPRIHPNSICAANNTGVYILTSNTSQYDTYCFNASAPPEEDCTSVTDLPNAFDGPITITIVNRDGTRYVQKGEYRTNPEDIYPSNPTDDDVSSGSSSERSSTSGGYIFYTFSTVHPIPDEDSPWITDSTDRIPATSTSSNTISAGWEPNEENEDERDRHLSFSGSGIDDDEDFISSTISTTPRAFDHTKQNQDWTQWNPSHSNPEVLLQTTTRMTDVDRNGTTAYEGNWNPEAHPPLIHHEHHEEEETPHSTSTIQATPSSTTEETATQKEQWFGNRWHEGYRQTPKEDSHSTTGTAGDCGSMAWVKKYFSFIFL"
sig_peptide 134..193
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="COORDINATES: ab initio prediction:SignalP:6.0"
exon 201..366
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 367..500
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 501..569
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 570..800
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 801..926
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 927..1040
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 1041..1157
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 1158..1286
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
exon 1287..1549
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/inference="alignment:Splign:2.1.0"
regulatory 1525..1530
/regulatory_class="polyA_signal_sequence"
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/note="hexamer: AATAAA"
polyA_site 1549
/gene="CD44"
/gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
MIC4; Pgp1"
/note="major polyA site"
ORIGIN
ctcattgcccagcggaccccagcctctgccaggttcggtccgccatcctcgtcccgtcctccgccggcccctgccccgcgcccagggatcctccagctcctttcgcccgcgccctccgttcgctccggacaccatggacaagttttggtggcacgcagcctggggactctgcctcgtgccgctgagcctggcgcagatcgatttgaatataacctgccgctttgcaggtgtattccacgtggagaaaaatggtcgctacagcatctctcggacggaggccgctgacctctgcaaggctttcaatagcaccttgcccacaatggcccagatggagaaagctctgagcatcggatttgagacctgcaggtatgggttcatagaagggcacgtggtgattccccggatccaccccaactccatctgtgcagcaaacaacacaggggtgtacatcctcacatccaacacctcccagtatgacacatattgcttcaatgcttcagctccacctgaagaagattgtacatcagtcacagacctgcccaatgcctttgatggaccaattaccataactattgttaaccgtgatggcacccgctatgtccagaaaggagaatacagaacgaatcctgaagacatctaccccagcaaccctactgatgatgacgtgagcagcggctcctccagtgaaaggagcagcacttcaggaggttacatcttttacaccttttctactgtacaccccatcccagacgaagacagtccctggatcaccgacagcacagacagaatccctgctaccagtacgtcttcaaataccatctcagcaggctgggagccaaatgaagaaaatgaagatgaaagagacagacacctcagtttttctggatcaggcattgatgatgatgaagattttatctccagcaccatttcaaccacaccacgggcttttgaccacacaaaacagaaccaggactggacccagtggaacccaagccattcaaatccggaagtgctacttcagacaaccacaaggatgactgatgtagacagaaatggcaccactgcttatgaaggaaactggaacccagaagcacaccctcccctcattcaccatgagcatcatgaggaagaagagaccccacattctacaagcacaatccaggcaactcctagtagtacaacggaagaaacagctacccagaaggaacagtggtttggcaacagatggcatgagggatatcgccaaacacccaaagaagactcccattcgacaacagggacagctggggactgtggcagcatggcatgggtcaagaagtacttctccttcatcttcctttgatgtcggtaactcatcctttctgcactgcgggagttgttaatgcttttgtgtcctccagttcacatgctgattgctaagaagaaaatgagcatgagtgaacccaaagctgctgaaacattctgcgtttatgcaacttccttgccctctatacaaggaagatggtttcattgtcttgtctagagaataaagtcttttttaaaaataaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]