GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-22 21:53:23, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001440352            1549 bp    mRNA    linear   PRI 20-MAY-2025
DEFINITION  Homo sapiens CD44 molecule (IN blood group) (CD44), transcript
            variant 37, mRNA.
ACCESSION   NM_001440352 XM_011520489 XM_054370583
VERSION     NM_001440352.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1549)
  AUTHORS   Li,C., Zhang,Y., Wang,Y., Ouyang,J., Yang,Y., Zhu,Q., Lu,Y.,
            Kang,T., Li,Y., Xia,M., Chen,J., Li,Q., Zhu,C. and Ye,L.
  TITLE     RNA-binding protein LSM7 facilitates breast cancer metastasis
            through mediating alternative splicing of CD44
  JOURNAL   Life Sci 356, 123013 (2024)
   PUBMED   39182568
  REMARK    GeneRIF: RNA-binding protein LSM7 facilitates breast cancer
            metastasis through mediating alternative splicing of CD44.
REFERENCE   2  (bases 1 to 1549)
  AUTHORS   Kashif,M., Jahan,S., Minhas,S., Amar,A., Tahir,R., Nisar,H.,
            Shehzad,F., Nagi,A.H. and Afzal,N.
  TITLE     Genetic Signatures: CD44 Single-Nucleotide Polymorphisms Affect
            Cell Surface Expression and Elevate Risk in Head and Neck Squamous
            Cell Carcinoma
  JOURNAL   JCO Glob Oncol 10, e2400084 (2024)
   PUBMED   39481067
  REMARK    GeneRIF: Genetic Signatures: CD44 Single-Nucleotide Polymorphisms
            Affect Cell Surface Expression and Elevate Risk in Head and Neck
            Squamous Cell Carcinoma.
            Erratum:[JCO Glob Oncol. 2025 Jan;11:e2400651. doi:
            10.1200/GO-24-00651. PMID: 39883899]
REFERENCE   3  (bases 1 to 1549)
  AUTHORS   Kainulainen,K., Niskanen,E.A., Kinnunen,J., Maki-Mantila,K.,
            Hartikainen,K., Paakinaho,V., Malinen,M., Ketola,K. and
            Pasonen-Seppanen,S.
  TITLE     Secreted factors from M1 macrophages drive prostate cancer stem
            cell plasticity by upregulating NANOG, SOX2, and CD44 through
            NFkappaB-signaling
  JOURNAL   Oncoimmunology 13 (1), 2393442 (2024)
   PUBMED   39175947
  REMARK    GeneRIF: Secreted factors from M1 macrophages drive prostate cancer
            stem cell plasticity by upregulating NANOG, SOX2, and CD44 through
            NFkappaB-signaling.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1549)
  AUTHORS   Yan,H., Xing,Z., Liu,S., Gao,P., Wang,Q. and Guo,G.
  TITLE     CALCR exacerbates renal cell carcinoma progression via stabilizing
            CD44
  JOURNAL   Aging (Albany NY) 16 (13), 10765-10783 (2024)
   PUBMED   38985127
  REMARK    GeneRIF: CALCR exacerbates renal cell carcinoma progression via
            stabilizing CD44.
REFERENCE   5  (bases 1 to 1549)
  AUTHORS   Liang,S., Li,L., Guo,Z., Sun,H. and Yang,Y.
  TITLE     Co-expression of CD44v6 and MMP2 predicts lung metastasis and
            unfavorable prognosis in osteosarcoma
  JOURNAL   Future Oncol 20 (25), 1799-1806 (2024)
   PUBMED   39011948
  REMARK    GeneRIF: Co-expression of CD44v6 and MMP2 predicts lung metastasis
            and unfavorable prognosis in osteosarcoma.
REFERENCE   6  (bases 1 to 1549)
  AUTHORS   Screaton,G.R., Bell,M.V., Jackson,D.G., Cornelis,F.B., Gerth,U. and
            Bell,J.I.
  TITLE     Genomic structure of DNA encoding the lymphocyte homing receptor
            CD44 reveals at least 12 alternatively spliced exons
  JOURNAL   Proc Natl Acad Sci U S A 89 (24), 12160-12164 (1992)
   PUBMED   1465456
REFERENCE   7  (bases 1 to 1549)
  AUTHORS   Kugelman,L.C., Ganguly,S., Haggerty,J.G., Weissman,S.M. and
            Milstone,L.M.
  TITLE     The core protein of epican, a heparan sulfate proteoglycan on
            keratinocytes, is an alternative form of CD44
  JOURNAL   J Invest Dermatol 99 (6), 886-891 (1992)
   PUBMED   1281868
REFERENCE   8  (bases 1 to 1549)
  AUTHORS   Arch,R., Wirth,K., Hofmann,M., Ponta,H., Matzku,S., Herrlich,P. and
            Zoller,M.
  TITLE     Participation in normal immune responses of a metastasis-inducing
            splice variant of CD44
  JOURNAL   Science 257 (5070), 682-685 (1992)
   PUBMED   1496383
REFERENCE   9  (bases 1 to 1549)
  AUTHORS   Jackson,D.G., Buckley,J. and Bell,J.I.
  TITLE     Multiple variants of the human lymphocyte homing receptor CD44
            generated by insertions at a single site in the extracellular
            domain
  JOURNAL   J Biol Chem 267 (7), 4732-4739 (1992)
   PUBMED   1537855
REFERENCE   10 (bases 1 to 1549)
  AUTHORS   Aruffo,A., Stamenkovic,I., Melnick,M., Underhill,C.B. and Seed,B.
  TITLE     CD44 is the principal cell surface receptor for hyaluronate
  JOURNAL   Cell 61 (7), 1303-1313 (1990)
   PUBMED   1694723
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL356215.11 and AL133330.14.
            
            On or before May 19, 2025 this sequence version replaced
            XM_011520489.4, XM_054370583.1.
            
            Summary: The protein encoded by this gene is a cell-surface
            glycoprotein involved in cell-cell interactions, cell adhesion and
            migration. It is a receptor for hyaluronic acid (HA) and can also
            interact with other ligands, such as osteopontin, collagens, and
            matrix metalloproteinases (MMPs). This protein participates in a
            wide variety of cellular functions including lymphocyte activation,
            recirculation and homing, hematopoiesis, and tumor metastasis.
            Transcripts for this gene undergo complex alternative splicing that
            results in many functionally distinct isoforms, however, the full
            length nature of some of these variants has not been determined.
            Alternative splicing is the basis for the structural and functional
            diversity of this protein, and may be related to tumor metastasis.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR12921934.3535048.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1968540
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-200               AL356215.11        23071-23270         c
            201-366             AL133330.14        175136-175301       c
            367-500             AL133330.14        171469-171602       c
            501-569             AL133330.14        164976-165044       c
            570-800             AL133330.14        161811-162041       c
            801-926             AL133330.14        153630-153755       c
            927-1040            AL133330.14        150681-150794       c
            1041-1157           AL133330.14        150089-150205       c
            1158-1286           AL133330.14        147236-147364       c
            1287-1549           AL133330.14        145829-146091       c
FEATURES             Location/Qualifiers
     source          1..1549
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11p13"
     gene            1..1549
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /note="CD44 molecule (IN blood group)"
                     /db_xref="GeneID:960"
                     /db_xref="HGNC:HGNC:1681"
                     /db_xref="MIM:107269"
     exon            1..200
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     CDS             134..1342
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /note="isoform 37 precursor is encoded by transcript
                     variant 37; hematopoietic cell E- and L-selectin ligand;
                     chondroitin sulfate proteoglycan 8; cell surface
                     glycoprotein CD44; GP90 lymphocyte homing/adhesion
                     receptor; heparan sulfate proteoglycan; hyaluronate
                     receptor; Indian blood group antigen; Hermes antigen;
                     homing function and Indian blood group system; CD44
                     antigen; CD44 molecule (Indian blood group); phagocyte
                     glycoprotein 1; In(Lu) related-p80; homing cell adhesion
                     molecule; epican; soluble CD44; phagocytic glycoprotein 1;
                     extracellular matrix receptor III"
                     /codon_start=1
                     /product="CD44 antigen isoform 37 precursor"
                     /protein_id="NP_001427281.1"
                     /db_xref="GeneID:960"
                     /db_xref="HGNC:HGNC:1681"
                     /db_xref="MIM:107269"
                     /translation="
MDKFWWHAAWGLCLVPLSLAQIDLNITCRFAGVFHVEKNGRYSISRTEAADLCKAFNSTLPTMAQMEKALSIGFETCRYGFIEGHVVIPRIHPNSICAANNTGVYILTSNTSQYDTYCFNASAPPEEDCTSVTDLPNAFDGPITITIVNRDGTRYVQKGEYRTNPEDIYPSNPTDDDVSSGSSSERSSTSGGYIFYTFSTVHPIPDEDSPWITDSTDRIPATSTSSNTISAGWEPNEENEDERDRHLSFSGSGIDDDEDFISSTISTTPRAFDHTKQNQDWTQWNPSHSNPEVLLQTTTRMTDVDRNGTTAYEGNWNPEAHPPLIHHEHHEEEETPHSTSTIQATPSSTTEETATQKEQWFGNRWHEGYRQTPKEDSHSTTGTAGDCGSMAWVKKYFSFIFL"
     sig_peptide     134..193
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     exon            201..366
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            367..500
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            501..569
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            570..800
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            801..926
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            927..1040
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            1041..1157
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            1158..1286
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     exon            1287..1549
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1525..1530
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /note="hexamer: AATAAA"
     polyA_site      1549
                     /gene="CD44"
                     /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM;
                     HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3;
                     MIC4; Pgp1"
                     /note="major polyA site"
ORIGIN      
ctcattgcccagcggaccccagcctctgccaggttcggtccgccatcctcgtcccgtcctccgccggcccctgccccgcgcccagggatcctccagctcctttcgcccgcgccctccgttcgctccggacaccatggacaagttttggtggcacgcagcctggggactctgcctcgtgccgctgagcctggcgcagatcgatttgaatataacctgccgctttgcaggtgtattccacgtggagaaaaatggtcgctacagcatctctcggacggaggccgctgacctctgcaaggctttcaatagcaccttgcccacaatggcccagatggagaaagctctgagcatcggatttgagacctgcaggtatgggttcatagaagggcacgtggtgattccccggatccaccccaactccatctgtgcagcaaacaacacaggggtgtacatcctcacatccaacacctcccagtatgacacatattgcttcaatgcttcagctccacctgaagaagattgtacatcagtcacagacctgcccaatgcctttgatggaccaattaccataactattgttaaccgtgatggcacccgctatgtccagaaaggagaatacagaacgaatcctgaagacatctaccccagcaaccctactgatgatgacgtgagcagcggctcctccagtgaaaggagcagcacttcaggaggttacatcttttacaccttttctactgtacaccccatcccagacgaagacagtccctggatcaccgacagcacagacagaatccctgctaccagtacgtcttcaaataccatctcagcaggctgggagccaaatgaagaaaatgaagatgaaagagacagacacctcagtttttctggatcaggcattgatgatgatgaagattttatctccagcaccatttcaaccacaccacgggcttttgaccacacaaaacagaaccaggactggacccagtggaacccaagccattcaaatccggaagtgctacttcagacaaccacaaggatgactgatgtagacagaaatggcaccactgcttatgaaggaaactggaacccagaagcacaccctcccctcattcaccatgagcatcatgaggaagaagagaccccacattctacaagcacaatccaggcaactcctagtagtacaacggaagaaacagctacccagaaggaacagtggtttggcaacagatggcatgagggatatcgccaaacacccaaagaagactcccattcgacaacagggacagctggggactgtggcagcatggcatgggtcaagaagtacttctccttcatcttcctttgatgtcggtaactcatcctttctgcactgcgggagttgttaatgcttttgtgtcctccagttcacatgctgattgctaagaagaaaatgagcatgagtgaacccaaagctgctgaaacattctgcgtttatgcaacttccttgccctctatacaaggaagatggtttcattgtcttgtctagagaataaagtcttttttaaaaataaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]