ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-04-02 18:16:26, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_001412258 2270 bp mRNA linear PRI 29-OCT-2024
DEFINITION Homo sapiens sialic acid binding Ig like lectin 12 (SIGLEC12),
transcript variant 3, mRNA.
ACCESSION NM_001412258
VERSION NM_001412258.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2270)
AUTHORS Cuello,H.A., Sinha,S., Verhagen,A.L., Varki,N., Varki,A. and
Ghosh,P.
TITLE Human-specific elimination of epithelial Siglec-XII suppresses the
risk of inflammation-driven colorectal cancers
JOURNAL JCI Insight 9 (16), e181539 (2024)
PUBMED 38990656
REMARK GeneRIF: Human-specific elimination of epithelial Siglec-XII
suppresses the risk of inflammation-driven colorectal cancers.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 2270)
AUTHORS Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W.,
Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B.,
Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A.,
Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A.,
Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C.,
Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M.,
Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G.,
Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S.,
Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A.,
Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S.,
Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N.,
Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A.,
Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M.,
Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J.,
Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P.,
Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J.,
Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A.
TITLE A reference map of the human binary protein interactome
JOURNAL Nature 580 (7803), 402-408 (2020)
PUBMED 32296183
REFERENCE 3 (bases 1 to 2270)
AUTHORS McDonough,C.W., Gong,Y., Padmanabhan,S., Burkley,B., Langaee,T.Y.,
Melander,O., Pepine,C.J., Dominiczak,A.F., Cooper-Dehoff,R.M. and
Johnson,J.A.
TITLE Pharmacogenomic association of nonsynonymous SNPs in SIGLEC12,
A1BG, and the selectin region and cardiovascular outcomes
JOURNAL Hypertension 62 (1), 48-54 (2013)
PUBMED 23690342
REMARK GeneRIF: cardiovascular outcomes may differ based on SIGLEC12
genotype, and antihypertensive treatment strategy.
REFERENCE 4 (bases 1 to 2270)
AUTHORS Mitra,N., Banda,K., Altheide,T.K., Schaffer,L., Johnson-Pais,T.L.,
Beuten,J., Leach,R.J., Angata,T., Varki,N. and Varki,A.
TITLE SIGLEC12, a human-specific segregating (pseudo)gene, encodes a
signaling molecule expressed in prostate carcinomas
JOURNAL J Biol Chem 286 (26), 23003-23011 (2011)
PUBMED 21555517
REMARK GeneRIF: SIGLEC12, a human-specific segregating (pseudo)gene,
encodes a signaling molecule expressed in prostate carcinomas.
REFERENCE 5 (bases 1 to 2270)
AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
CONSRTM DREAM investigators
TITLE Variation at the NFATC2 locus increases the risk of
thiazolidinedione-induced edema in the Diabetes REduction
Assessment with ramipril and rosiglitazone Medication (DREAM) study
JOURNAL Diabetes Care 33 (10), 2250-2253 (2010)
PUBMED 20628086
REMARK GeneRIF: Observational study of gene-disease association,
gene-environment interaction, and pharmacogenomic / toxicogenomic.
(HuGE Navigator)
REFERENCE 6 (bases 1 to 2270)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 7 (bases 1 to 2270)
AUTHORS Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium
TITLE Gene-centric association signals for lipids and apolipoproteins
identified via the HumanCVD BeadChip
JOURNAL Am J Hum Genet 85 (5), 628-642 (2009)
PUBMED 19913121
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 8 (bases 1 to 2270)
AUTHORS Angata,T., Varki,N.M. and Varki,A.
TITLE A second uniquely human mutation affecting sialic acid biology
JOURNAL J Biol Chem 276 (43), 40282-40287 (2001)
PUBMED 11546777
REFERENCE 9 (bases 1 to 2270)
AUTHORS Yu,Z., Lai,C.M., Maoui,M., Banville,D. and Shen,S.H.
TITLE Identification and characterization of S2V, a novel putative siglec
that contains two V set Ig-like domains and recruits
protein-tyrosine phosphatases SHPs
JOURNAL J Biol Chem 276 (26), 23816-23824 (2001)
PUBMED 11328818
REFERENCE 10 (bases 1 to 2270)
AUTHORS Foussias,G., Taylor,S.M., Yousef,G.M., Tropak,M.B., Ordon,M.H. and
Diamandis,E.P.
TITLE Cloning and molecular characterization of two splice variants of a
new putative member of the Siglec-3-like subgroup of Siglecs
JOURNAL Biochem Biophys Res Commun 284 (4), 887-899 (2001)
PUBMED 11409877
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CP068259.2.
Summary: Sialic acid-binding immunoglobulin-like lectins (SIGLECs)
are a family of cell surface proteins belonging to the
immunoglobulin superfamily. They mediate protein-carbohydrate
interactions by selectively binding to different sialic acid
moieties present on glycolipids and glycoproteins. This gene
encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members
of this subfamily are characterized by an extracellular V-set
immunoglobulin-like domain followed by two C2-set
immunoglobulin-like domains, and the cytoplasmic tyrosine-based
motifs ITIM and SLAM-like. The encoded protein, upon tyrosine
phosphorylation, has been shown to recruit the Src homology 2
domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It
has been suggested that the protein is involved in the negative
regulation of macrophage signaling by functioning as an inhibitory
receptor. This gene is located in a cluster with other SIGLEC3-like
genes on 19q13.4. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Aug 2013].
Transcript Variant: This variant (3) uses the same exon combination
as variant 1 but represents the allele encoded by the T2T-CHM13v2.0
genome assembly. The encoded isoform (c) has a shorter and
frameshifted N-terminus compared to isoform a.
##Evidence-Data-START##
Transcript exon combination :: AY358140.1, BC035809.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
polymorphic pseudogene :: PMID: 21555517
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-495 CP068259.2 54589933-54590427 c
496-876 CP068259.2 54588546-54588926 c
877-1155 CP068259.2 54588064-54588342 c
1156-1203 CP068259.2 54587796-54587843 c
1204-1473 CP068259.2 54586644-54586913 c
1474-1570 CP068259.2 54585975-54586071 c
1571-1667 CP068259.2 54585506-54585602 c
1668-2270 CP068259.2 54579849-54580451 c
FEATURES Location/Qualifiers
source 1..2270
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19q13.41"
gene 1..2270
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="sialic acid binding Ig like lectin 12"
/db_xref="GeneID:89858"
/db_xref="HGNC:HGNC:15482"
/db_xref="MIM:606094"
exon 1..495
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
misc_feature 162..164
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="upstream in-frame stop codon"
CDS 219..1856
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="isoform c is encoded by transcript variant 3;
SIGLEC-like 1; sialic acid-binding Ig-like lectin-like 1"
/codon_start=1
/product="sialic acid-binding Ig-like lectin 12 isoform c"
/protein_id="NP_001399187.1"
/db_xref="GeneID:89858"
/db_xref="HGNC:HGNC:15482"
/db_xref="MIM:606094"
/translation="
MAGLPPIQFMATGSGAGDHVSRNIPVATNNPVRAVQEETRDRFHLLGDPQNKDCTLSIRDTRESDAGTYVFCVERGNMKWNYKYDQLSVNVTASQDLLSRYRLEVPESVTVQEGLCVSVPCSVLYPHYNWTASSPVYGSWFKEGADIPWDIPVATNTPSGKVQEDTQGRFLLLGDPQTNNCSLSIRDARKGDSGKYYFQVERGSRKWNYIYDKLSVHVTALTHMPTFSIPGTLESGHPRNLTCSVPWACEQGTPPTITWMGASVSSLDPTITRSSMLSLIPQPQDHGTSLTCQVTLPGAGVTMTRAVRLNISYPPQNLTMTVFQGDGTASTTLRNGSALSVLEGQSLYLVCAVDSNPPARLSWTWGSLTLSPSQSSNLGVLELPRVHVKDEGEFTCRAQNPLGSQHISLSLSLQNEYTGKMRPISGVMLGAFGGAGATALVFLSFCIIFVVVRSCRKKSARPAVGVGDTGMEDANAVRGSASQGPLIESPADDSPPHHAPPALATPSPEEGEIQYASLSFHKARPQYPQEQEAIGYEYSEINIPK"
misc_feature <291..494
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:472250"
misc_feature 378..392
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409353"
misc_feature 420..437
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409353"
misc_feature 459..479
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409353"
misc_feature 519..875
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Immunoglobulin Variable (IgV) domain at the
N-terminus of CD33 and related Siglecs (sialic
acid-binding Ig-like lectins); Region: IgV_CD33; cd05712"
/db_xref="CDD:409377"
misc_feature 519..593
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="FR1 [structural motif]; Region: FR1"
/db_xref="CDD:409377"
misc_feature 519..533
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand A [structural motif]; Region: Ig strand
A"
/db_xref="CDD:409377"
misc_feature 540..554
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand A' [structural motif]; Region: Ig strand
A'"
/db_xref="CDD:409377"
misc_feature 558..593
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409377"
misc_feature 594..623
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="CDR1 [structural motif]; Region: CDR1"
/db_xref="CDD:409377"
misc_feature 624..647
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="FR2 [structural motif]; Region: FR2"
/db_xref="CDD:409377"
misc_feature 624..647
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409377"
misc_feature 648..719
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="CDR2 [structural motif]; Region: CDR2"
/db_xref="CDD:409377"
misc_feature 678..689
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand C' [structural motif]; Region: Ig strand
C'"
/db_xref="CDD:409377"
misc_feature 720..821
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="FR3 [structural motif]; Region: FR3"
/db_xref="CDD:409377"
misc_feature 723..737
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand D [structural motif]; Region: Ig strand
D"
/db_xref="CDD:409377"
misc_feature 753..779
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409377"
misc_feature 798..824
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409377"
misc_feature order(813..815,837..842)
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:409377"
misc_feature 834..875
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="FR4 [structural motif]; Region: FR4"
/db_xref="CDD:409377"
misc_feature 834..875
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409377"
misc_feature 891..1148
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:472250"
misc_feature 933..947
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409579"
misc_feature 984..998
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409579"
misc_feature 1041..1055
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409579"
misc_feature 1083..1100
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409579"
misc_feature 1128..1139
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409579"
misc_feature 1224..1460
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:472250"
misc_feature 1257..1271
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409353"
misc_feature 1296..1310
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409353"
misc_feature 1362..1376
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409353"
misc_feature 1395..1412
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409353"
misc_feature 1440..1451
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409353"
exon 496..876
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 877..1155
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 1156..1203
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 1204..1473
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 1474..1570
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 1571..1667
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
exon 1668..2270
/gene="SIGLEC12"
/gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
/inference="alignment:Splign:2.1.0"
ORIGIN
agttcctgagagaagaaccctgaggaacagacttacctcagcaaccctggcacctccaacccgacacatgctactgctgctgctactgctgccacccctgctctgtgggagagtgggggctaaggaacagaaggattacctgctgacaatgcagaagtccgtgacggtgcaggagggcctgtgtgtctctgtgctttgctccttctcctacccccaaaatggctggactgcctccgatccagttcatggctactggttcaggggcaggggaccatgtaagccggaacattccagtggccacaaacaacccagttcgagcagtgcaggaggagactcgggaccgattccacctccttggggacccacagaacaaggattgtaccctgagcatcagagacaccagagagagtgatgcagggacatacgtcttttgtgtagagagaggaaatatgaaatggaattataaatatgaccagctctctgtgaatgtgacagcgtcccaggacctactgtcaagatacaggctggaggtgccagagtcggtgactgtgcaggagggtctgtgtgtctctgtgccctgcagtgtcctttacccccattacaactggactgcctctagccctgtttatggatcctggttcaaggaaggggccgatataccatgggatattccagtggccacaaacaccccaagtggaaaagtgcaagaggatacccagggtcgattcctcctccttggggacccacagaccaacaactgctccctgagcatcagagatgccaggaagggggattcagggaagtactacttccaggtggagagaggaagcaggaaatggaactacatatatgacaagctctctgtgcatgtgacagccctgactcacatgcccaccttctccatcccggggaccctggagtctggccaccccaggaacctgacctgctctgtgccctgggcctgtgaacaggggacgccccccacgatcacctggatgggggcctccgtgtcctccctggaccccactatcactcgctcctcgatgctcagcctcatcccacagccccaggaccatggcaccagcctcacctgtcaggtgaccttgcctggggccggtgtgaccatgaccagggctgtccgactcaacatatcctatcctcctcagaacttgaccatgactgtcttccaaggagatggcacagcatccacaaccttgaggaatggctcggccctttcagtcctggagggccagtccctgtaccttgtctgtgctgtcgacagcaatccccctgccaggctgagctggacctgggggagcctgaccctgagcccctcacagtcctcgaaccttggggtgctggagctgcctcgagtgcatgtgaaggatgaaggggaattcacctgccgagctcagaaccctctaggctcccagcacatttccctgagcctctccctgcaaaacgagtacacaggcaaaatgaggcctatatcaggagtgatgctaggggcattcgggggagctggagccacagccctggtcttcctgtccttctgcatcatcttcgttgtagtgaggtcctgcaggaagaaatcggcaaggccagcagtgggcgtgggggatacaggcatggaggacgcaaacgctgtcaggggctcagcctctcagggacccctgattgaatccccggcagatgacagccccccacaccatgctccgccagccctggccaccccctccccagaggaaggagagatccagtatgcatccctcagcttccacaaagcgaggcctcagtacccacaggaacaggaggccatcggctatgagtactccgagatcaacatccccaagtgagaaactgcagagactcaggcctgtttgagggctcacgacccctgcagcaaagaagcccgagactgattcctttagaattaacagccctccatgctgtgcaacaggacatcagaacttattcctcttgtcaaactgaaaatgcgtgcctgatgaccaaactctccctttctccatccaatcggtccacactccccgcccccggcctctggtacccaccattctcttctctacttctctgaggtcgactattttaggttccaaatatagtgagatcgtagagtgtttgtctctctgtacctggcttatttcactcaacataatgttctctaggttcatccgtgttgttccaaataacagaataatgtattgaatatttcaaaatggctaaaagagaggagtttaaatgttgtcacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]