LOCUS       NM_001410851            1287 bp    mRNA    linear   PRI 01-MAY-2025
DEFINITION  Homo sapiens 5-hydroxytryptamine receptor 3D (HTR3D), transcript
            variant 4, mRNA.
ACCESSION   NM_001410851 XM_017005854
VERSION     NM_001410851.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1287)
  AUTHORS   Tang,F.Y., Ma,L., Tam,P.O.S., Pang,C.P., Tham,C.C. and Chen,L.J.
  TITLE     Genetic Association of the PARL-ABCC5-HTR3D-HTR3C Locus With
            Primary Angle-Closure Glaucoma in Chinese
  JOURNAL   Invest Ophthalmol Vis Sci 58 (10), 4384-4389 (2017)
   PUBMED   28813580
  REMARK    GeneRIF: These findings enrich the allelic spectrum of ABCC5 in
            PACG. We identified no tagging SNP responsible for the association
            of the whole region.
            Erratum:[Invest Ophthalmol Vis Sci. 2017 Sep 1;58(11):4799. doi:
            10.1167/iovs.17-22948a. PMID: 28973336]
REFERENCE   2  (bases 1 to 1287)
  AUTHORS   Nongpiur,M.E., Khor,C.C., Jia,H., Cornes,B.K., Chen,L.J., Qiao,C.,
            Nair,K.S., Cheng,C.Y., Xu,L., George,R., Tan,D., Abu-Amero,K.,
            Perera,S.A., Ozaki,M., Mizoguchi,T., Kurimoto,Y., Low,S.,
            Tajudin,L.S., Ho,C.L., Tham,C.C., Soto,I., Chew,P.T., Wong,H.T.,
            Shantha,B., Kuroda,M., Osman,E.A., Tang,G., Fan,S., Meng,H.,
            Wang,H., Feng,B., Yong,V.H., Ting,S.M., Li,Y., Wang,Y.X., Li,Z.,
            Lavanya,R., Wu,R.Y., Zheng,Y.F., Su,D.H., Loon,S.C., Yong,V.K.,
            Allingham,R.R., Hauser,M.A., Soumittra,N., Ramprasad,V.L.,
            Waseem,N., Yaakub,A., Chia,K.S., Kumaramanickavel,G., Wong,T.T.,
            How,A.C., Chau,T.N., Simmons,C.P., Bei,J.X., Zeng,Y.X.,
            Bhattacharya,S.S., Zhang,M., Tan,D.T., Teo,Y.Y., Al-Obeidan,S.A.,
            Hon,D.N., Tai,E.S., Saw,S.M., Foster,P.J., Vijaya,L., Jonas,J.B.,
            Wong,T.Y., John,S.W., Pang,C.P., Vithana,E.N., Wang,N. and Aung,T.
  TITLE     ABCC5, a gene that influences the anterior chamber depth, is
            associated with primary angle closure glaucoma
  JOURNAL   PLoS Genet 10 (3), e1004089 (2014)
   PUBMED   24603532
  REMARK    Erratum:[PLoS Genet. 2014 Apr;10(4):e1004352. Yong, Vernon K Y
            [added]]
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1287)
  AUTHORS   Ripke,S., Wray,N.R., Lewis,C.M., Hamilton,S.P., Weissman,M.M.,
            Breen,G., Byrne,E.M., Blackwood,D.H., Boomsma,D.I., Cichon,S.,
            Heath,A.C., Holsboer,F., Lucae,S., Madden,P.A., Martin,N.G.,
            McGuffin,P., Muglia,P., Noethen,M.M., Penninx,B.P., Pergadia,M.L.,
            Potash,J.B., Rietschel,M., Lin,D., Muller-Myhsok,B., Shi,J.,
            Steinberg,S., Grabe,H.J., Lichtenstein,P., Magnusson,P.,
            Perlis,R.H., Preisig,M., Smoller,J.W., Stefansson,K., Uher,R.,
            Kutalik,Z., Tansey,K.E., Teumer,A., Viktorin,A., Barnes,M.R.,
            Bettecken,T., Binder,E.B., Breuer,R., Castro,V.M., Churchill,S.E.,
            Coryell,W.H., Craddock,N., Craig,I.W., Czamara,D., De Geus,E.J.,
            Degenhardt,F., Farmer,A.E., Fava,M., Frank,J., Gainer,V.S.,
            Gallagher,P.J., Gordon,S.D., Goryachev,S., Gross,M., Guipponi,M.,
            Henders,A.K., Herms,S., Hickie,I.B., Hoefels,S., Hoogendijk,W.,
            Hottenga,J.J., Iosifescu,D.V., Ising,M., Jones,I., Jones,L.,
            Jung-Ying,T., Knowles,J.A., Kohane,I.S., Kohli,M.A., Korszun,A.,
            Landen,M., Lawson,W.B., Lewis,G., Macintyre,D., Maier,W.,
            Mattheisen,M., McGrath,P.J., McIntosh,A., McLean,A.,
            Middeldorp,C.M., Middleton,L., Montgomery,G.M., Murphy,S.N.,
            Nauck,M., Nolen,W.A., Nyholt,D.R., O'Donovan,M., Oskarsson,H.,
            Pedersen,N., Scheftner,W.A., Schulz,A., Schulze,T.G., Shyn,S.I.,
            Sigurdsson,E., Slager,S.L., Smit,J.H., Stefansson,H., Steffens,M.,
            Thorgeirsson,T., Tozzi,F., Treutlein,J., Uhr,M., van den Oord,E.J.,
            Van Grootheest,G., Volzke,H., Weilburg,J.B., Willemsen,G.,
            Zitman,F.G., Neale,B., Daly,M., Levinson,D.F. and Sullivan,P.F.
  CONSRTM   Major Depressive Disorder Working Group of the Psychiatric GWAS
            Consortium
  TITLE     A mega-analysis of genome-wide association studies for major
            depressive disorder
  JOURNAL   Mol Psychiatry 18 (4), 497-511 (2013)
   PUBMED   22472876
REFERENCE   4  (bases 1 to 1287)
  AUTHORS   Kapeller,J., Moller,D., Lasitschka,F., Autschbach,F., Hovius,R.,
            Rappold,G., Bruss,M., Gershon,M.D. and Niesler,B.
  TITLE     Serotonin receptor diversity in the human colon: Expression of
            serotonin type 3 receptor subunits 5-HT3C, 5-HT3D, and 5-HT3E
  JOURNAL   J Comp Neurol 519 (3), 420-432 (2011)
   PUBMED   21192076
  REMARK    GeneRIF: Data show that 5-HT3C, 5-HT3D, and 5-HT3E subunits are
            coexpressed with 5-HT3A in cell bodies of myenteric neurons, and
            that 5-HT3A and 5-HT3D were expressed in submucosal plexus of the
            human large intestine.
REFERENCE   5  (bases 1 to 1287)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   6  (bases 1 to 1287)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am J Hum Genet 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 1287)
  AUTHORS   Schuhmacher,A., Mossner,R., Quednow,B.B., Kuhn,K.U., Wagner,M.,
            Cvetanovska,G., Rujescu,D., Zill,P., Moller,H.J., Rietschel,M.,
            Franke,P., Wolwer,W., Gaebel,W. and Maier,W.
  TITLE     Influence of 5-HT3 receptor subunit genes HTR3A, HTR3B, HTR3C,
            HTR3D and HTR3E on treatment response to antipsychotics in
            schizophrenia
  JOURNAL   Pharmacogenet Genomics 19 (11), 843-851 (2009)
   PUBMED   19794330
  REMARK    GeneRIF: Six functional and coding variants of the subunit genes
            HTR3A, HTR3B as well as the novel HTR3C, HTR3D, and HTR3E subunits
            in the response to haloperidol or risperidone, were assessed.
REFERENCE   8  (bases 1 to 1287)
  AUTHORS   Niesler,B., Walstab,J., Combrink,S., Moller,D., Kapeller,J.,
            Rietdorf,J., Bonisch,H., Gothert,M., Rappold,G. and Bruss,M.
  TITLE     Characterization of the novel human serotonin receptor subunits
            5-HT3C,5-HT3D, and 5-HT3E
  JOURNAL   Mol Pharmacol 72 (1), 8-17 (2007)
   PUBMED   17392525
REFERENCE   9  (bases 1 to 1287)
  AUTHORS   Karnovsky,A.M., Gotow,L.F., McKinley,D.D., Piechan,J.L.,
            Ruble,C.L., Mills,C.J., Schellin,K.A., Slightom,J.L.,
            Fitzgerald,L.R., Benjamin,C.W. and Roberds,S.L.
  TITLE     A cluster of novel serotonin receptor 3-like genes on human
            chromosome 3
  JOURNAL   Gene 319, 137-148 (2003)
   PUBMED   14597179
REFERENCE   10 (bases 1 to 1287)
  AUTHORS   Niesler,B., Frank,B., Kapeller,J. and Rappold,G.A.
  TITLE     Cloning, physical mapping and expression analysis of the human
            5-HT3 serotonin receptor-like genes HTR3C, HTR3D and HTR3E
  JOURNAL   Gene 310, 101-111 (2003)
   PUBMED   12801637
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC068644.15 and AC131235.4.
            
            On Aug 16, 2022 this sequence version replaced XM_017005854.2.
            
            Summary: The protein encoded this gene belongs to the ligand-gated
            ion channel receptor superfamily. This gene encodes subunit D of
            the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic
            hormone that functions as a neurotransmitter, a mitogen and a
            hormone. This hormone has been linked to neuropsychiatric
            disorders, including anxiety, depression, and migraine. Serotonin
            receptors causes fast and depolarizing responses in neurons
            following activation. The genes encoding subunits C, D and E of
            this type 3 receptor form a cluster on chromosome 3. Alternatively
            spliced transcript variants encoding different isoforms have been
            found for this gene. [provided by RefSeq, Jul 2009].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC101090.2 [ECO:0000331]
            RNAseq introns       :: partial sample support SAMEA2159931
                                    [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-28                AC068644.15        170943-170970
            29-194              AC068644.15        174456-174621
            195-447             AC068644.15        177420-177672
            448-663             AC068644.15        177808-178023
            664-1207            AC068644.15        178145-178688
            1208-1287           AC131235.4         172438-172517       c
FEATURES             Location/Qualifiers
     source          1..1287
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q27.1"
     gene            1..1287
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="5-hydroxytryptamine receptor 3D"
                     /db_xref="GeneID:200909"
                     /db_xref="HGNC:HGNC:24004"
                     /db_xref="MIM:610122"
     exon            1..28
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /inference="alignment:Splign:2.1.0"
     exon            29..194
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    132..134
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="upstream in-frame stop codon"
     CDS             192..893
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="isoform 4 is encoded by transcript variant 4;
                     5-hydroxytryptamine receptor 3 subunit D; serotonin
                     5-HT-3D receptor; serotonin receptor 3D;
                     5-hydroxytryptamine (serotonin) receptor 3 family member
                     D; 5-hydroxytryptamine (serotonin) receptor 3D,
                     ionotropic"
                     /codon_start=1
                     /product="5-hydroxytryptamine receptor 3D isoform 4"
                     /protein_id="NP_001397780.1"
                     /db_xref="CCDS:CCDS93429.1"
                     /db_xref="GeneID:200909"
                     /db_xref="HGNC:HGNC:24004"
                     /db_xref="MIM:610122"
                     /translation="

MVAIRRRCRPSPYVVNFLVPSGILIAIDALSFYLPLESGNCAPFKMTVLLGYSVFLLMMNDLLPATSTSSHASLVRPHPSRDQKRGVYFALCLSLMVGSLLETIFITHLLHVATTQPLPLPRWLHSLLLHCTGQGRCCPTAPQKGNKGPGLTPTHLPGVKEPEVSAGQMPGPGEAELTGGSEWTRAQREHEAQKQHSVELWVQFSHAMDALLFRLYLLFMASSIITVICLWNT"

     misc_feature    222..887
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="transmembrane domain of 5-hydroxytryptamine 3
                     (5-HT3) receptor; Region: LGIC_TM_5-HT3; cd19063"
                     /db_xref="CDD:349865"
     misc_feature    222..296
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="TM1 helix [structural motif]; Region: TM1 helix"
                     /db_xref="CDD:349865"
     misc_feature    order(258..260,270..272,279..281,288..296,306..311,
                     315..323,327..332,336..344,348..350,360..365,381..386,
                     468..470,480..482,489..494,501..503,510..515,522..524,
                     795..797,807..809)
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="pentamer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:349865"
     misc_feature    318..383
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="TM2 helix [structural motif]; Region: TM2 helix"
                     /db_xref="CDD:349865"
     misc_feature    450..518
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="TM3 helix [structural motif]; Region: TM3 helix"
                     /db_xref="CDD:349865"
     misc_feature    810..878
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /note="TM4 helix [structural motif]; Region: TM4 helix"
                     /db_xref="CDD:349865"
     exon            195..447
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /inference="alignment:Splign:2.1.0"
     exon            448..663
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /inference="alignment:Splign:2.1.0"
     exon            664..1287
                     /gene="HTR3D"
                     /gene_synonym="5HT3D"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctagattcaggcccagttaaagcacaggtggcttagatcaaaaatcattattgccacatggaccagccttggaagtgaacaaggagagggtggtggcatgggacctgccttcctggagttaatcatctagatgaaagctgctattccaggattcacaccttcaactggtgacatcgttcctgtggctaaatatggtggccatcaggcgcaggtgcaggcccagcccctacgtggtaaactttctggtgcccagtggcattctgattgccatcgatgccctcagtttctacctgccactggaaagtgggaattgtgccccattcaagatgactgttctgctgggctacagcgtcttcctgctcatgatgaatgacttgctcccagccactagcacttcatcacatgcttcactagtacgtcctcatccatcaagagaccaaaagcgaggtgtctacttcgccctgtgcctgtccctgatggtgggcagcctgctggagaccatcttcatcacccacctgctgcacgtggccaccacccagcccctacctctgcctcggtggctccactccctgctgctgcactgcaccggccaagggagatgctgtcccactgcgccccagaagggaaataagggcccgggtctcacccccacccacctgcccggtgtgaaggagccagaggtatcagcagggcagatgccaggccctggggaggcagagctgacagggggctcagaatggacaagggcccagcgggaacacgaggcccagaagcagcactcggtggagctgtgggtgcagttcagccacgcgatggacgccctgctcttccgcctctacctgctcttcatggcctcctccatcatcaccgtcatatgcctctggaacacctaggcaggtgctcacctgcaaacttcagtctggacttctttttgccagagaactccagaaaccagtcaggctctcagtcagccttgtggccctgtcaaccgcctcatttttaacccagtcctctgtgtagtttcagaccagacctgaatagtctcctatgccctccaaaagtcgggtccttgctcctgcatgccatcagccccactcagccctcccatacctccctggctcctcaggattcaggttcctagggtacgtccttgattaaatcaccccaatatgcccctttgcagaaagtattggcttttccctgaattctgttatggtaaaaaaaatcttgggattgagagtcttcttgcagaaacttctcagccaaagtaaaaaggattttctctta

//