2024-05-06 14:49:48, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001405494 2516 bp mRNA linear PRI 31-DEC-2022 DEFINITION Homo sapiens proline rich transmembrane protein 4 (PRRT4), transcript variant 6, mRNA. ACCESSION NM_001405494 XM_047420370 VERSION NM_001405494.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2516) AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B, Yusuf S, Gerstein HC, Engert JC and Anand S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 2 (bases 1 to 2516) AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M, Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ, Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S, Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD, Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE and Hingorani AD. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am J Hum Genet 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC010655.7. On Apr 25, 2022 this sequence version replaced XM_047420370.1. ##Evidence-Data-START## Transcript exon combination :: SRR14038192.3376125.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2163105 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-130 AC010655.7 31310-31439 c 131-247 AC010655.7 31055-31171 c 248-971 AC010655.7 29089-29812 c 972-1076 AC010655.7 28898-29002 c 1077-1196 AC010655.7 28430-28549 c 1197-1426 AC010655.7 22198-22427 c 1427-2516 AC010655.7 20074-21163 c FEATURES Location/Qualifiers source 1..2516 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q32.1" gene 1..2516 /gene="PRRT4" /note="proline rich transmembrane protein 4" /db_xref="GeneID:401399" /db_xref="HGNC:HGNC:37280" exon 1..130 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 131..247 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 248..971 /gene="PRRT4" /inference="alignment:Splign:2.1.0" misc_feature 278..280 /gene="PRRT4" /note="upstream in-frame stop codon" CDS 320..1609 /gene="PRRT4" /note="isoform 2 precursor is encoded by transcript variant 6" /codon_start=1 /product="proline-rich transmembrane protein 4 isoform 2 precursor" /protein_id="NP_001392423.1" /db_xref="CCDS:CCDS47698.2" /db_xref="GeneID:401399" /db_xref="HGNC:HGNC:37280" /translation="
MARHGCLGLGLFCCVLFAATVGPQPTPSIPGAPATTLTPVPQSEASMLSLNLGLNFKFHLRGPAAVWGSPVTETQPLSLGPGQEPGEEVASGLRTDPLWELLVGSSGNSLTEWGSTEGGSKPRASSLLPESTSRRSGPSDGPTAPYQPRRSTVTWDTALMVTALPSSAPRPHQSELELKFDMALRAGAAPTLGHRTLPLLPSLRASLAEIAGRLGPFGFFGTTLSPLRNFSGLSPPGETTSTSSASGVSGSLGFLGTTLSLPPYSLERKLSSPSPLDPAASLSFASIATTSLDPTVPISGPDDLSPPASLGNPSGQPECGPGSCSVGELPEREGQPPEAPRPLFFLTLEADWAEARARWGLAWEAHVYGRLHRGLPPALPNQPATQHRGGPLQRGPACAWPLPGPCLRGRSAWARTLPHRLAGDRGQGQ"
sig_peptide 320..388 /gene="PRRT4" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 647..775 /gene="PRRT4" /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1202..1339 /gene="PRRT4" /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 972..1076 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1077..1196 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1197..1426 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1427..2516 /gene="PRRT4" /inference="alignment:Splign:2.1.0" regulatory 2497..2502 /regulatory_class="polyA_signal_sequence" /gene="PRRT4" /note="hexamer: AATAAA" polyA_site 2516 /gene="PRRT4" /note="major polyA site" ORIGIN
agagccggctgccgcggagccccggcgcgggcggcttcgccggggagcgaggctcggagccaggaggcggcgccgctgggagggagcgcggagtgcggagtgcggagcgcggggcctggccgcccgcctgagagaagcggtgagataccacgaagcgttgcccagctgggcgccagggccgccacgaccgccccttttcggaggctcggcgaggagacctgcctgcgggagagaccccggggagcaggaccttcctcctcaaaagctgctgaacaactgagtccctgcccaccaaggccacccgaagccaggtggggccatggccaggcatggctgtctagggctgggactgttctgctgcgtcctgtttgctgctactgtgggcccccagcccaccccctccatcccaggtgcccctgccaccactttgacccccgtacctcaaagtgaggcctctatgctgtctctcaacctgggacttaacttcaaattccatcttcggggacctgctgctgtctgggggagcccagtcacagagacccagccactctctcttgggccaggccaggagccaggggaagaggtggccagtgggctgaggactgaccccctttgggaattgctggtgggctcctcagggaactctctcactgagtggggctccaccgaaggtggctcaaagccccgggcctcctccctgcttccggagtccacatcccggcgctctgggcccagcgatgggcccactgccccctatcagcccaggaggagcactgtgacctgggacactgctctgatggtgacagcacttccatccagtgctcccaggccccaccagagcgagctggagctgaagtttgacatggcactgagagcaggtgcagcccccacgcttgggcatcgaacgctgcccctgctgcccagcctgcgggccagcctggcagagattgctgggcgcctgggaccctttggattctttggcactactctgtccccactccggaacttctccggcctgagccccccaggtgaaactacatccacaagctctgcctctggagtttcgggttctctggggttccttggtaccactctgtccctgcccccatactccctggagaggaagctctccagcccaagtcctctggacccagctgcttccctaagttttgcctcgattgcaacaacatcattagaccccacagtccccatctctggcccagatgacctctctcctcccgccagcctcgggaacccttcggggcagccagagtgtgggccagggtcctgcagcgtgggagaattgcctgaacgcgaggggcagcctcccgaggcgccgaggcccctctttttcctgaccctggaggccgactgggcagaggccagggctcgctgggggctggcctgggaggcccacgtgtacgggcgattacaccgtggacttccgcccgccctccccaatcaacctgcgacgcagcatcgaggaggccctctgcagcgaggccctgcttgcgcctggcctcttccagggccctgccttcgaggacgctctgcctgggctcggactctaccgcaccgcctcgctggggaccgggggcagggccagtgagagatcaggggaggcctctggccccgctgcgcccccggagctcccctcccctggggcttggcccgcaggcagcagcgtctcatctggctcgttctgcggactctcgcgggacagctcgtccatgctgctgtgttccagccccgacaggcccccgcgctgccctctggtctgcgtcctcagtcccccgcggccctcaggaagcagccccagcctcccggcctcaggatcctaccaggccctgtccccaccctctcgcgactccccagagcctgcttctgagctgcaggccgaggaggccttgctgcaggagcagttcctggacgcctgccgacagatcgacgagctgagcgtgggcagcgacaccatagacctgtgaagaggtggccaccttgctaccctgcgatatgcccctttctggcgcctgccctgcccgagacctgcacactgtaatccttccccaatcctccctggctcagatacctctccagattccttccccatccaggggtccctgggtgggtgggtcagcagccaggctctatcgattgggaatcagtgccaccttctctggagccctgggtgctgatgccctcagctgcaaatctaggttggcaggggtcccattttccttggcattcaccagcaataaagctccaaggtgctccactcctgaccaccactccccactctggtgctgagtgagaggggctgtcctcagaggaccctgggacctgcctcaggcccccctacccacctctgccatgcctaggaatcccacccctgtgtgaatgggactccctttcctccatgtgacacccacaggggtccatgacccatctaggagactttatagcagttgggtgggaggggaatgctcttaatttatcaataaaatattttcagagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]