2024-05-06 19:38:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001405492 2557 bp mRNA linear PRI 01-JAN-2023 DEFINITION Homo sapiens proline rich transmembrane protein 4 (PRRT4), transcript variant 4, mRNA. ACCESSION NM_001405492 VERSION NM_001405492.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2557) AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B, Yusuf S, Gerstein HC, Engert JC and Anand S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 2 (bases 1 to 2557) AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M, Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ, Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S, Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD, Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE and Hingorani AD. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am J Hum Genet 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC010655.7. ##Evidence-Data-START## Transcript exon combination :: SRR14038191.2801223.1, SRR14038196.3546300.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA1965299, SAMEA1966682 [ECO:0006172] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-171 AC010655.7 31562-31732 c 172-288 AC010655.7 31055-31171 c 289-1012 AC010655.7 29089-29812 c 1013-1117 AC010655.7 28898-29002 c 1118-1237 AC010655.7 28430-28549 c 1238-1467 AC010655.7 22198-22427 c 1468-2557 AC010655.7 20074-21163 c FEATURES Location/Qualifiers source 1..2557 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q32.1" gene 1..2557 /gene="PRRT4" /note="proline rich transmembrane protein 4" /db_xref="GeneID:401399" /db_xref="HGNC:HGNC:37280" exon 1..171 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 172..288 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 289..1012 /gene="PRRT4" /inference="alignment:Splign:2.1.0" misc_feature 319..321 /gene="PRRT4" /note="upstream in-frame stop codon" CDS 361..1650 /gene="PRRT4" /note="isoform 2 precursor is encoded by transcript variant 4" /codon_start=1 /product="proline-rich transmembrane protein 4 isoform 2 precursor" /protein_id="NP_001392421.1" /db_xref="GeneID:401399" /db_xref="HGNC:HGNC:37280" /translation="
MARHGCLGLGLFCCVLFAATVGPQPTPSIPGAPATTLTPVPQSEASMLSLNLGLNFKFHLRGPAAVWGSPVTETQPLSLGPGQEPGEEVASGLRTDPLWELLVGSSGNSLTEWGSTEGGSKPRASSLLPESTSRRSGPSDGPTAPYQPRRSTVTWDTALMVTALPSSAPRPHQSELELKFDMALRAGAAPTLGHRTLPLLPSLRASLAEIAGRLGPFGFFGTTLSPLRNFSGLSPPGETTSTSSASGVSGSLGFLGTTLSLPPYSLERKLSSPSPLDPAASLSFASIATTSLDPTVPISGPDDLSPPASLGNPSGQPECGPGSCSVGELPEREGQPPEAPRPLFFLTLEADWAEARARWGLAWEAHVYGRLHRGLPPALPNQPATQHRGGPLQRGPACAWPLPGPCLRGRSAWARTLPHRLAGDRGQGQ"
sig_peptide 361..429 /gene="PRRT4" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 688..816 /gene="PRRT4" /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1243..1380 /gene="PRRT4" /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 1013..1117 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1118..1237 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1238..1467 /gene="PRRT4" /inference="alignment:Splign:2.1.0" exon 1468..2557 /gene="PRRT4" /inference="alignment:Splign:2.1.0" regulatory 2538..2543 /regulatory_class="polyA_signal_sequence" /gene="PRRT4" /note="hexamer: AATAAA" polyA_site 2557 /gene="PRRT4" /note="major polyA site" ORIGIN
gagtgtgtttcctggcgcgcgtgtggatgtgtgtgctgggccgccctgggagtgtgtgattgctctcgccaggctcacagcgaggcgcccgccgcggctgattgacagcgctgggtgaatgagcgcgcgtggaggcgcccggcaccgaggtggccgcggctccgcgctgctagagaagcggtgagataccacgaagcgttgcccagctgggcgccagggccgccacgaccgccccttttcggaggctcggcgaggagacctgcctgcgggagagaccccggggagcaggaccttcctcctcaaaagctgctgaacaactgagtccctgcccaccaaggccacccgaagccaggtggggccatggccaggcatggctgtctagggctgggactgttctgctgcgtcctgtttgctgctactgtgggcccccagcccaccccctccatcccaggtgcccctgccaccactttgacccccgtacctcaaagtgaggcctctatgctgtctctcaacctgggacttaacttcaaattccatcttcggggacctgctgctgtctgggggagcccagtcacagagacccagccactctctcttgggccaggccaggagccaggggaagaggtggccagtgggctgaggactgaccccctttgggaattgctggtgggctcctcagggaactctctcactgagtggggctccaccgaaggtggctcaaagccccgggcctcctccctgcttccggagtccacatcccggcgctctgggcccagcgatgggcccactgccccctatcagcccaggaggagcactgtgacctgggacactgctctgatggtgacagcacttccatccagtgctcccaggccccaccagagcgagctggagctgaagtttgacatggcactgagagcaggtgcagcccccacgcttgggcatcgaacgctgcccctgctgcccagcctgcgggccagcctggcagagattgctgggcgcctgggaccctttggattctttggcactactctgtccccactccggaacttctccggcctgagccccccaggtgaaactacatccacaagctctgcctctggagtttcgggttctctggggttccttggtaccactctgtccctgcccccatactccctggagaggaagctctccagcccaagtcctctggacccagctgcttccctaagttttgcctcgattgcaacaacatcattagaccccacagtccccatctctggcccagatgacctctctcctcccgccagcctcgggaacccttcggggcagccagagtgtgggccagggtcctgcagcgtgggagaattgcctgaacgcgaggggcagcctcccgaggcgccgaggcccctctttttcctgaccctggaggccgactgggcagaggccagggctcgctgggggctggcctgggaggcccacgtgtacgggcgattacaccgtggacttccgcccgccctccccaatcaacctgcgacgcagcatcgaggaggccctctgcagcgaggccctgcttgcgcctggcctcttccagggccctgccttcgaggacgctctgcctgggctcggactctaccgcaccgcctcgctggggaccgggggcagggccagtgagagatcaggggaggcctctggccccgctgcgcccccggagctcccctcccctggggcttggcccgcaggcagcagcgtctcatctggctcgttctgcggactctcgcgggacagctcgtccatgctgctgtgttccagccccgacaggcccccgcgctgccctctggtctgcgtcctcagtcccccgcggccctcaggaagcagccccagcctcccggcctcaggatcctaccaggccctgtccccaccctctcgcgactccccagagcctgcttctgagctgcaggccgaggaggccttgctgcaggagcagttcctggacgcctgccgacagatcgacgagctgagcgtgggcagcgacaccatagacctgtgaagaggtggccaccttgctaccctgcgatatgcccctttctggcgcctgccctgcccgagacctgcacactgtaatccttccccaatcctccctggctcagatacctctccagattccttccccatccaggggtccctgggtgggtgggtcagcagccaggctctatcgattgggaatcagtgccaccttctctggagccctgggtgctgatgccctcagctgcaaatctaggttggcaggggtcccattttccttggcattcaccagcaataaagctccaaggtgctccactcctgaccaccactccccactctggtgctgagtgagaggggctgtcctcagaggaccctgggacctgcctcaggcccccctacccacctctgccatgcctaggaatcccacccctgtgtgaatgggactccctttcctccatgtgacacccacaggggtccatgacccatctaggagactttatagcagttgggtgggaggggaatgctcttaatttatcaataaaatattttcagagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]