GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-11-03 08:22:53, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001405492            2557 bp    mRNA    linear   PRI 01-MAY-2025
DEFINITION  Homo sapiens proline rich transmembrane protein 4 (PRRT4),
            transcript variant 4, mRNA.
ACCESSION   NM_001405492
VERSION     NM_001405492.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2557)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   2  (bases 1 to 2557)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am J Hum Genet 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC010655.7.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038191.2801223.1,
                                           SRR14038196.3546300.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-171               AC010655.7         31562-31732         c
            172-288             AC010655.7         31055-31171         c
            289-1012            AC010655.7         29089-29812         c
            1013-1117           AC010655.7         28898-29002         c
            1118-1237           AC010655.7         28430-28549         c
            1238-1467           AC010655.7         22198-22427         c
            1468-2557           AC010655.7         20074-21163         c
FEATURES             Location/Qualifiers
     source          1..2557
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q32.1"
     gene            1..2557
                     /gene="PRRT4"
                     /note="proline rich transmembrane protein 4"
                     /db_xref="GeneID:401399"
                     /db_xref="HGNC:HGNC:37280"
     exon            1..171
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            172..288
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            289..1012
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    319..321
                     /gene="PRRT4"
                     /note="upstream in-frame stop codon"
     CDS             361..1650
                     /gene="PRRT4"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 4"
                     /codon_start=1
                     /product="proline-rich transmembrane protein 4 isoform 2
                     precursor"
                     /protein_id="NP_001392421.1"
                     /db_xref="GeneID:401399"
                     /db_xref="HGNC:HGNC:37280"
                     /translation="
MARHGCLGLGLFCCVLFAATVGPQPTPSIPGAPATTLTPVPQSEASMLSLNLGLNFKFHLRGPAAVWGSPVTETQPLSLGPGQEPGEEVASGLRTDPLWELLVGSSGNSLTEWGSTEGGSKPRASSLLPESTSRRSGPSDGPTAPYQPRRSTVTWDTALMVTALPSSAPRPHQSELELKFDMALRAGAAPTLGHRTLPLLPSLRASLAEIAGRLGPFGFFGTTLSPLRNFSGLSPPGETTSTSSASGVSGSLGFLGTTLSLPPYSLERKLSSPSPLDPAASLSFASIATTSLDPTVPISGPDDLSPPASLGNPSGQPECGPGSCSVGELPEREGQPPEAPRPLFFLTLEADWAEARARWGLAWEAHVYGRLHRGLPPALPNQPATQHRGGPLQRGPACAWPLPGPCLRGRSAWARTLPHRLAGDRGQGQ"
     sig_peptide     361..429
                     /gene="PRRT4"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    688..816
                     /gene="PRRT4"
                     /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1243..1380
                     /gene="PRRT4"
                     /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            1013..1117
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1118..1237
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1238..1467
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1468..2557
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2538..2543
                     /regulatory_class="polyA_signal_sequence"
                     /gene="PRRT4"
                     /note="hexamer: AATAAA"
     polyA_site      2557
                     /gene="PRRT4"
                     /note="major polyA site"
ORIGIN      
gagtgtgtttcctggcgcgcgtgtggatgtgtgtgctgggccgccctgggagtgtgtgattgctctcgccaggctcacagcgaggcgcccgccgcggctgattgacagcgctgggtgaatgagcgcgcgtggaggcgcccggcaccgaggtggccgcggctccgcgctgctagagaagcggtgagataccacgaagcgttgcccagctgggcgccagggccgccacgaccgccccttttcggaggctcggcgaggagacctgcctgcgggagagaccccggggagcaggaccttcctcctcaaaagctgctgaacaactgagtccctgcccaccaaggccacccgaagccaggtggggccatggccaggcatggctgtctagggctgggactgttctgctgcgtcctgtttgctgctactgtgggcccccagcccaccccctccatcccaggtgcccctgccaccactttgacccccgtacctcaaagtgaggcctctatgctgtctctcaacctgggacttaacttcaaattccatcttcggggacctgctgctgtctgggggagcccagtcacagagacccagccactctctcttgggccaggccaggagccaggggaagaggtggccagtgggctgaggactgaccccctttgggaattgctggtgggctcctcagggaactctctcactgagtggggctccaccgaaggtggctcaaagccccgggcctcctccctgcttccggagtccacatcccggcgctctgggcccagcgatgggcccactgccccctatcagcccaggaggagcactgtgacctgggacactgctctgatggtgacagcacttccatccagtgctcccaggccccaccagagcgagctggagctgaagtttgacatggcactgagagcaggtgcagcccccacgcttgggcatcgaacgctgcccctgctgcccagcctgcgggccagcctggcagagattgctgggcgcctgggaccctttggattctttggcactactctgtccccactccggaacttctccggcctgagccccccaggtgaaactacatccacaagctctgcctctggagtttcgggttctctggggttccttggtaccactctgtccctgcccccatactccctggagaggaagctctccagcccaagtcctctggacccagctgcttccctaagttttgcctcgattgcaacaacatcattagaccccacagtccccatctctggcccagatgacctctctcctcccgccagcctcgggaacccttcggggcagccagagtgtgggccagggtcctgcagcgtgggagaattgcctgaacgcgaggggcagcctcccgaggcgccgaggcccctctttttcctgaccctggaggccgactgggcagaggccagggctcgctgggggctggcctgggaggcccacgtgtacgggcgattacaccgtggacttccgcccgccctccccaatcaacctgcgacgcagcatcgaggaggccctctgcagcgaggccctgcttgcgcctggcctcttccagggccctgccttcgaggacgctctgcctgggctcggactctaccgcaccgcctcgctggggaccgggggcagggccagtgagagatcaggggaggcctctggccccgctgcgcccccggagctcccctcccctggggcttggcccgcaggcagcagcgtctcatctggctcgttctgcggactctcgcgggacagctcgtccatgctgctgtgttccagccccgacaggcccccgcgctgccctctggtctgcgtcctcagtcccccgcggccctcaggaagcagccccagcctcccggcctcaggatcctaccaggccctgtccccaccctctcgcgactccccagagcctgcttctgagctgcaggccgaggaggccttgctgcaggagcagttcctggacgcctgccgacagatcgacgagctgagcgtgggcagcgacaccatagacctgtgaagaggtggccaccttgctaccctgcgatatgcccctttctggcgcctgccctgcccgagacctgcacactgtaatccttccccaatcctccctggctcagatacctctccagattccttccccatccaggggtccctgggtgggtgggtcagcagccaggctctatcgattgggaatcagtgccaccttctctggagccctgggtgctgatgccctcagctgcaaatctaggttggcaggggtcccattttccttggcattcaccagcaataaagctccaaggtgctccactcctgaccaccactccccactctggtgctgagtgagaggggctgtcctcagaggaccctgggacctgcctcaggcccccctacccacctctgccatgcctaggaatcccacccctgtgtgaatgggactccctttcctccatgtgacacccacaggggtccatgacccatctaggagactttatagcagttgggtgggaggggaatgctcttaatttatcaataaaatattttcagagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]